ID: 1147603267

View in Genome Browser
Species Human (GRCh38)
Location 17:41758875-41758897
Sequence CAAAAAAAGGGGCAGTGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147603258_1147603267 9 Left 1147603258 17:41758843-41758865 CCAGATTCCTGATCAAGCCGATG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1147603267 17:41758875-41758897 CAAAAAAAGGGGCAGTGATCAGG 0: 1
1: 0
2: 1
3: 19
4: 199
1147603260_1147603267 2 Left 1147603260 17:41758850-41758872 CCTGATCAAGCCGATGGTTGCCT 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1147603267 17:41758875-41758897 CAAAAAAAGGGGCAGTGATCAGG 0: 1
1: 0
2: 1
3: 19
4: 199
1147603262_1147603267 -8 Left 1147603262 17:41758860-41758882 CCGATGGTTGCCTGGCAAAAAAA 0: 1
1: 0
2: 0
3: 21
4: 189
Right 1147603267 17:41758875-41758897 CAAAAAAAGGGGCAGTGATCAGG 0: 1
1: 0
2: 1
3: 19
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147603267 Original CRISPR CAAAAAAAGGGGCAGTGATC AGG Intronic
901724963 1:11234332-11234354 CAGAAAAAGTGGCAGGGAACTGG + Intronic
902961585 1:19967253-19967275 CAAAAGAAGGTGCAGTTAGCAGG - Intergenic
904900608 1:33854414-33854436 CAGAGAAAGAGGCAGTGAGCAGG + Intronic
905573108 1:39021837-39021859 CAAGAAAAGGGGCAGGGGACTGG + Intergenic
908694380 1:66821668-66821690 TAAAAAAATGGGCAATGGTCAGG - Intronic
910309719 1:85809616-85809638 CAATAAAAGGGGCACAGTTCTGG + Intronic
910594751 1:88968331-88968353 TAAATAAAGGGTCAGTGCTCAGG + Intronic
911512493 1:98824920-98824942 CATAAAAAGGGGAAGTGGTTTGG - Intergenic
918390971 1:184061467-184061489 CAATAAAAGAGACAGTTATCAGG - Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919044438 1:192433070-192433092 CAAAATAAGAGGCACTGATGAGG + Intergenic
919138705 1:193542982-193543004 CCAAAAAAGGAGAAGGGATCTGG - Intergenic
919283705 1:195525944-195525966 CAAGAAAAGGGGCATTGAGGAGG + Intergenic
920014039 1:202891497-202891519 AAAAGAATGGGGCAGTAATCAGG + Exonic
920024033 1:202978896-202978918 CAAAATAAGGGGTAGTGGGCAGG - Intergenic
921193280 1:212728737-212728759 CAACAAAGGGGACGGTGATCAGG - Intronic
921774333 1:219079629-219079651 TAGAAAATGGGGCAGGGATCAGG - Intergenic
922051274 1:221992888-221992910 CACATGATGGGGCAGTGATCAGG + Intergenic
923706672 1:236349799-236349821 AAAAAAAAAGGGCAGTGGTGGGG + Intronic
924203088 1:241680819-241680841 CAAGAAATGGGCCAGTGAGCTGG - Intronic
1064322043 10:14314473-14314495 AAAAATAAGGGGAAGTGTTCTGG + Intronic
1065049167 10:21773133-21773155 CAAAAAGCAGGGCAGTGATATGG - Intronic
1069792456 10:71031702-71031724 CATAAAAAGGGGCTGGGCTCAGG + Intergenic
1069895776 10:71679273-71679295 CCAAAAAAGGAGCTGTGAACAGG + Intronic
1070557690 10:77541759-77541781 CAAAGAAAAGGCCAGTGATTTGG + Intronic
1071972393 10:90921389-90921411 AGAAAAAAAGGGCAGTGATGTGG - Intergenic
1076475136 10:130746485-130746507 CAAGAGACTGGGCAGTGATCCGG - Intergenic
1076599897 10:131650709-131650731 GAAACAGAGGGGCAGGGATCCGG + Intergenic
1080299869 11:30772058-30772080 CAAAAAAGGGGGCAGAGGTCGGG - Intergenic
1080527763 11:33144117-33144139 AAAAAAAAGGGGGAGTGGTGGGG - Intronic
1081327748 11:41766892-41766914 CAAAAAAAGAAGCAGTGGACGGG + Intergenic
1081970471 11:47194893-47194915 AAAAAAAAGGGACAGTGTGCTGG + Intergenic
1085311891 11:75521803-75521825 CAAACAAAGGGGCTGTGATGGGG + Intronic
1086028550 11:82324626-82324648 CAAAAAAAGAGGGAGAGAACTGG + Intergenic
1089133433 11:116230562-116230584 CAAAAAAAGGTGAATTTATCTGG + Intergenic
1090228124 11:125083705-125083727 CGGAAAAGGGGGCAGTGGTCTGG + Intronic
1091602575 12:1926859-1926881 TACAAAAAGGGGCAGAGATCGGG + Intergenic
1093062479 12:14621696-14621718 CCAAAAAATGGGCAGTGTTTAGG - Intronic
1093561661 12:20549374-20549396 CAAAGAAAGAGGCAATGATGGGG - Intronic
1094457191 12:30649136-30649158 CAAAGGAAGGGGAATTGATCAGG - Exonic
1094727761 12:33139623-33139645 AAAAAAAAAGGTCAGTGAGCAGG - Intergenic
1098161857 12:67653316-67653338 TAAAAAATGGGGCAGAGAGCAGG - Intronic
1098607699 12:72412945-72412967 GGAAGAAATGGGCAGTGATCGGG + Intronic
1101263241 12:103056693-103056715 AGAAAAAAGGATCAGTGATCTGG - Intergenic
1101863769 12:108504407-108504429 CAAATAAGGGGGCAGTGCGCTGG - Intergenic
1103280558 12:119754689-119754711 CAAAAGAAGAGGGACTGATCTGG + Intronic
1103398028 12:120622955-120622977 CGAAGAAAGGGGCAGGGACCAGG - Intergenic
1106682179 13:32019288-32019310 GAAAAAAAGTGGCAGGGACCTGG - Intergenic
1110229138 13:73150623-73150645 CAAATAAAGGGGCATTGGCCGGG + Intergenic
1110289292 13:73785595-73785617 AAAAAAAATGGGCAGAGATTTGG - Intronic
1110450350 13:75633611-75633633 CAAAAAAAGGGGGAGTGTGGAGG + Intronic
1112349985 13:98624898-98624920 CAAAATAAAGTCCAGTGATCTGG - Intergenic
1116374138 14:44175963-44175985 CAAGAAAAGGAGCAGGGATGGGG - Intergenic
1118377086 14:65187003-65187025 CAAAAAGAGGAGCAGTGTTGGGG - Intergenic
1121458632 14:94055857-94055879 CAAAGAAATGGGCAGTGTTCAGG - Intronic
1121804787 14:96808262-96808284 CAAAAACAGGGGCAGAAAGCAGG - Intronic
1121857387 14:97282512-97282534 AAAGAAAAGGGGCAGAGAACTGG + Intergenic
1127408055 15:58674026-58674048 CAAAAAAAGAGGCAGTGGCTGGG - Intronic
1129011612 15:72423363-72423385 CACACACAGGGGCAGGGATCTGG + Intergenic
1129126049 15:73442405-73442427 CAAAATAAGGTCCAGTGACCAGG - Intergenic
1135754108 16:25082210-25082232 ATAAAAAATGGGCAGTGAGCTGG + Intergenic
1135801520 16:25501323-25501345 AAAAAAAAGGGGCAGTGGGGGGG + Intergenic
1138450285 16:57089852-57089874 TAAAAAAAAGGCCAGGGATCAGG - Intergenic
1138889222 16:61121918-61121940 CAGAAAAAGGTGCAGTGCTACGG + Intergenic
1138894342 16:61184852-61184874 TAAAAAGAGGGGCAGAGATAAGG - Intergenic
1139179070 16:64724537-64724559 CAAAAGCAGGGGCAGTGACCTGG - Intergenic
1140253195 16:73312950-73312972 CCAAAAATGGGTCAGTGATATGG + Intergenic
1142439059 16:90082587-90082609 AAAAAAAACGAGCACTGATCCGG - Intronic
1142617441 17:1144594-1144616 AAAAAAAAGGGGCAGGGGCCAGG + Intronic
1144718277 17:17449541-17449563 AAAAATTAGGGGCAGTGTTCTGG + Intergenic
1145770635 17:27490452-27490474 GAAAAAAAGGGGGATTGCTCTGG - Intronic
1146293382 17:31629442-31629464 TAAAAAAAGGGACACTCATCTGG + Intergenic
1147411182 17:40253714-40253736 CAAAAAAATGGACAGTCCTCAGG - Intronic
1147603267 17:41758875-41758897 CAAAAAAAGGGGCAGTGATCAGG + Intronic
1147979671 17:44266735-44266757 CAAAACTTGGGGCAGCGATCTGG - Intronic
1148191937 17:45685303-45685325 GAATAAAAGGGGGAGGGATCAGG - Intergenic
1148227415 17:45908602-45908624 CAGGAAAAGGGGGAGTGATGGGG + Intronic
1148561558 17:48609697-48609719 CAAGAAAAGGGTCACTTATCTGG + Intronic
1149263335 17:54901613-54901635 GAAAAGAAGGAGCAGTGAGCTGG - Intronic
1150059174 17:62049527-62049549 CAAAAAAAGTGGCAGAGTACAGG + Intronic
1151164140 17:72189742-72189764 CAAACAAAGGGTCAGAGCTCTGG - Intergenic
1152318278 17:79593537-79593559 CAGAGAATGGGGCAGAGATCTGG + Intergenic
1152398343 17:80048878-80048900 CAATAAACGGTGCAGTGAACAGG - Intronic
1155134385 18:22973770-22973792 CAAAAAAAGGGCAACTGAGCTGG - Intronic
1156555732 18:38065968-38065990 CAGAAATAGGGGCAGTGGTTTGG + Intergenic
1156986896 18:43359734-43359756 CATAAAAAGGGACAGAGCTCAGG - Intergenic
1158670033 18:59466316-59466338 CAATACAAGGGGCAGTTCTCCGG + Intronic
1161643452 19:5437758-5437780 CAAAACAAGAGGCAGTGGACTGG - Intergenic
1163655101 19:18541367-18541389 CAAAAAAAGATGCATTGATGGGG + Intronic
1163796413 19:19340820-19340842 CAAAACAAGAGGCAGGGGTCAGG - Intronic
1164011565 19:21207172-21207194 CAAAAACAGGGGGAGTGCCCAGG + Intergenic
1164216492 19:23155164-23155186 CAAACAAAGGAGCAGTAAGCAGG + Intergenic
1166023058 19:40050540-40050562 CAAATAAACTGGCAGTGAACAGG + Intronic
1167359186 19:49020783-49020805 CAAAAAGAGGGACAGGGACCTGG + Intergenic
1167525503 19:49981243-49981265 CAAAACAAGGTGTATTGATCGGG - Intronic
931062882 2:58550643-58550665 CTAAAAAATGGGCAATGAGCAGG - Intergenic
932337876 2:70941351-70941373 CAGAAAGAGGGGCAGTGGGCTGG - Exonic
932533959 2:72571377-72571399 AAAAAAAAGAGGGAGTGATGAGG - Intronic
933738430 2:85513790-85513812 CAAAAATAGGGGCAGGGTGCAGG - Intergenic
935718302 2:105958123-105958145 CAAAAAAAAGAGCAGTCTTCAGG - Intergenic
936535401 2:113307205-113307227 CCAAAGAAGGGGCTGTGCTCAGG - Intergenic
936870671 2:117131756-117131778 CAAAAAATGGGCAAATGATCTGG + Intergenic
937177863 2:119959577-119959599 CACATAAAGGGGCAGTGAGTGGG + Intronic
938585501 2:132686409-132686431 GACAACAAGGGGCAGTCATCAGG - Intronic
938644975 2:133321085-133321107 CAAGACATGGGTCAGTGATCAGG - Intronic
939280257 2:140054841-140054863 CAAAAAAAAGGAAAGTGAACTGG + Intergenic
939931188 2:148235785-148235807 CTAAAAAAGGGGGAGTGTTTTGG + Intronic
941134250 2:161694054-161694076 AAAGAAAAGGGGCTGTAATCTGG - Intronic
944563949 2:200968645-200968667 AAAAAAAGGGGGCAGTCAGCAGG + Intergenic
945091343 2:206179041-206179063 AAAAAAAAGGGACAGGGAGCGGG - Intronic
946727194 2:222672124-222672146 CAATAAAAGGCGCAGTTATACGG + Intronic
947216880 2:227757949-227757971 CAGAAAAAGGAGCAGTGATGAGG - Intergenic
947688528 2:232113012-232113034 AAAAAAAATGGGCTGTGATGAGG + Intronic
948236305 2:236393655-236393677 CAAGGAAAGGGGCAGGGATAAGG + Intronic
948938491 2:241183964-241183986 CAAAAAATGTGGAAGTGATGAGG + Intergenic
1168862970 20:1059333-1059355 AAAAGAAAGGGGCAGGAATCAGG + Intergenic
1172291819 20:33782304-33782326 GAAAAAAGGGAGCAGTGGTCAGG - Intronic
1172518626 20:35553300-35553322 CAGATAAAGGGAAAGTGATCTGG + Intronic
1174431847 20:50475823-50475845 CAAAAATAGCAGCAGTGATGAGG - Intergenic
1177234390 21:18368195-18368217 CAAAAAAATGCGTAGTGAACAGG - Intronic
1178396815 21:32250163-32250185 AAAAAAAAGGGGCAAGAATCAGG - Intergenic
1181088066 22:20452836-20452858 AAAAGAATGGGGCAGTAATCAGG - Intronic
1182264517 22:29103345-29103367 CACACCAAGGGGCAGAGATCTGG - Intronic
1183916176 22:41121411-41121433 AGATAGAAGGGGCAGTGATCTGG + Intronic
1184378889 22:44132623-44132645 CAATAAATTGGGCAGTGATGAGG - Intronic
1184770505 22:46594309-46594331 CAAAAACAGGGGCAGGGAGGAGG - Intronic
1185321962 22:50205637-50205659 AGAAAAAGGGGGCAGTCATCTGG + Intronic
949219969 3:1620271-1620293 CAAAAAACAGGTCAGTGATGGGG + Intergenic
950408155 3:12817269-12817291 CATAAACAGGCGCAGTGAGCAGG - Exonic
953398946 3:42595726-42595748 CAAAAAAAGGAGCAGGGACCTGG - Intronic
954754100 3:52829694-52829716 CCAGAAAAAGGGCAGTGACCAGG + Intronic
957255886 3:77837550-77837572 AAAATTAAGGGACAGTGATCAGG + Intergenic
958718503 3:97817117-97817139 CAGAAAAAGTGGCTGTGAACTGG - Intergenic
958759779 3:98293070-98293092 CAAAAAGAGGGCAAATGATCTGG - Intergenic
959556999 3:107731665-107731687 AAAAAAAAGGGGCAGGGGTTGGG - Intronic
960414545 3:117368442-117368464 CAAAAAAATGGCTAGAGATCAGG + Intergenic
961609668 3:128126551-128126573 AAAAAAAAAGGTCATTGATCTGG + Intronic
962337718 3:134551389-134551411 TAAAAAAAGGAGCAGTGAGGAGG + Intronic
964601447 3:158505160-158505182 TAAAAAAACTGGCAGTGACCTGG - Intronic
964626885 3:158768325-158768347 CAAAAAAAGGGGTCCAGATCAGG + Intronic
964741832 3:159974702-159974724 CAAAGAGAGGGGCTTTGATCAGG - Intergenic
966671288 3:182529351-182529373 CAAAAAAAGGGACAGTAATAGGG + Intergenic
966827770 3:183979353-183979375 AAAAAAAAGGGGCAGTGGGGAGG + Intronic
968005821 3:195242108-195242130 CAAATAAAGGGGCAGAGAGGAGG + Intronic
968598295 4:1496484-1496506 CAACAAAAGGGGCAGTGAGTGGG + Intergenic
969047463 4:4346791-4346813 CAAAAGCTGGGGCAGGGATCGGG + Intergenic
972447787 4:39162565-39162587 CAGAAAATGAGGCAGTAATCAGG + Intergenic
973565195 4:52179065-52179087 AAAAAAAAGGGAGAGGGATCTGG + Intergenic
978258148 4:106718010-106718032 TAAAGAAAGGGGCACTGATGAGG + Intergenic
978610459 4:110532826-110532848 AAAACAAAGTGGCATTGATCTGG - Intronic
979697456 4:123629518-123629540 CTGAAAAAGGGGCAGGGTTCTGG + Intergenic
981185794 4:141801388-141801410 CAGATAAAGGGGCAGTGCTATGG - Intergenic
981642452 4:146960258-146960280 TAAAAAAAGGAGAAGTGATTTGG - Intergenic
982399413 4:154949829-154949851 AAAAAAAAGGGGGAGGGATGTGG + Intergenic
984424828 4:179570059-179570081 CAAAAAAAGAGGCATTGAAGTGG - Intergenic
984708306 4:182863778-182863800 CAGGAGAAGGGGCAGTGCTCTGG - Intergenic
984792668 4:183628712-183628734 CAGAAAGAGGGGTAGTGAGCTGG + Intergenic
985897531 5:2757701-2757723 GAAATAAAGGGGCAGGGATGGGG + Intergenic
987104802 5:14627751-14627773 CAAATAAAATGGCAGTTATCAGG + Intergenic
988493087 5:31721502-31721524 AAAAAAAAGAGGCAGTTATTTGG - Intronic
989637053 5:43547380-43547402 CAAAACAAGGGGCAGGGTTTTGG + Intronic
990070966 5:51782197-51782219 ATTAAAAAGGGACAGTGATCAGG - Intergenic
995466362 5:112453269-112453291 CAAAAAAAGAGGCAGTGGAGTGG - Intergenic
998114390 5:139525089-139525111 CAAAATAAGTGGCAGTGCTGGGG + Intergenic
999237581 5:150108353-150108375 CAAAAAAAGGGGCAGAGGTCAGG + Intronic
999602486 5:153282540-153282562 TAAAAAAAGGGGAGGGGATCTGG + Intergenic
999712864 5:154333754-154333776 GAGAAAAGGGGGCAGTGATCAGG - Intronic
1001118064 5:168955991-168956013 CAAAATGAAGGGCAGTGATTGGG + Intronic
1001270773 5:170309923-170309945 CAAAAGAAGGGGCAGTGGGTAGG + Intergenic
1002095780 5:176829867-176829889 AAAAAAAAGGAGCAGTGATGTGG - Intronic
1003857342 6:10289974-10289996 CAGAATGAGGGGCAGTGATGTGG - Intergenic
1005699554 6:28386743-28386765 CAAAAAAAGGTGGAGTGACATGG - Intronic
1008789308 6:55210663-55210685 CACAGGAAGGGACAGTGATCAGG - Intronic
1010265164 6:73857464-73857486 TAAACAAAGGGGCATTGAGCAGG + Intergenic
1010830260 6:80518781-80518803 AAGAAAATGGGGCAGTGATGTGG - Intergenic
1012065352 6:94543535-94543557 CAAGAAGAGGGGCAGAGATCTGG + Intergenic
1020045503 7:5037349-5037371 CAAAAAAAAGGTCAGAGATCAGG - Intronic
1021274112 7:18627752-18627774 CAAAAGGTGGGGCAGAGATCAGG - Intronic
1023450283 7:40277115-40277137 CAAAAAAAGTAGCAGTGATTTGG + Intronic
1023503906 7:40880083-40880105 CAAAAGAATGTGCAGTGAGCTGG - Intergenic
1024189439 7:46990862-46990884 CAAAGAATAAGGCAGTGATCAGG + Intergenic
1027323562 7:77030051-77030073 CAAAAGAAGGGTCAGAGGTCAGG - Intergenic
1029486547 7:100846223-100846245 CAAACAAAGGAGCAGTAAGCAGG - Intronic
1029719773 7:102355517-102355539 GAAAAGAAGGGTCAGTGGTCAGG - Intergenic
1029752840 7:102553741-102553763 GAAAAGAAGGGTCAGTGGTCAGG + Intronic
1029770791 7:102652833-102652855 GAAAAGAAGGGTCAGTGGTCAGG + Intronic
1029974793 7:104822842-104822864 AAAAAAAGGGGGCAGTGGGCTGG + Intronic
1030333158 7:108294797-108294819 CCAAAAAAGGGGAAGTGATTCGG - Intronic
1031025645 7:116676844-116676866 CAAAAACAGGGGCACTATTCAGG - Intronic
1031101691 7:117488502-117488524 CAAAAAAAGAGGCAATGAAATGG - Intronic
1035288329 7:157820685-157820707 CAAGCCAAGGGGGAGTGATCTGG + Intronic
1035916662 8:3631920-3631942 CATACAAAGAGGCAGTGATCTGG - Intronic
1037709373 8:21343460-21343482 CAGAACAAGGGACAGTGATTAGG - Intergenic
1039104881 8:33979459-33979481 CCAAAAAATGGGCAGAGATTAGG - Intergenic
1040276994 8:46018888-46018910 GAAAAAAAGGGGCACAGCTCAGG - Intergenic
1046028398 8:108752866-108752888 AGAAAAAAGGGCCAGTGAACTGG - Intronic
1046409776 8:113826502-113826524 CATATAAAAGGACAGTGATCTGG - Intergenic
1046687261 8:117241570-117241592 CAAAGAAAGGGGAAGTTATAGGG - Intergenic
1047535377 8:125714799-125714821 TACAAAAACGGGCAGTGGTCAGG - Intergenic
1048240842 8:132740376-132740398 CAAGAAAAGGGGAAGTGATGGGG - Intronic
1051831052 9:21277184-21277206 CAAAAATAGAGGCAGTCATGTGG - Intergenic
1055511771 9:77002070-77002092 CAAAAAAAGGTGAAGACATCAGG - Intergenic
1055763535 9:79636331-79636353 AAATAAAAGGGGCAGCCATCAGG - Intronic
1056180173 9:84075396-84075418 CAAAAATAGGGCCAGTGAACTGG - Intergenic
1059053195 9:110951461-110951483 CAGAAAAAGGGGCACCGATGTGG + Intronic
1059818470 9:117945206-117945228 CAAACAAGGGAGCAGTGATGGGG + Intergenic
1060167045 9:121425937-121425959 CTAAAAAGGAGGCAATGATCTGG + Intergenic
1061653076 9:132066709-132066731 CAAAGAAAAGTGCAGTGAGCAGG + Intronic
1062333076 9:136053024-136053046 CAAAAGAAGGGGCAGGGTCCAGG + Intronic
1186598400 X:11009313-11009335 GGAAAAAAGGAGCAGAGATCTGG - Intergenic
1188644372 X:32546356-32546378 CAAGCAAAGGAGCAGGGATCTGG + Intronic
1189172261 X:38920512-38920534 TAAAAAAAGTGGCAGGGAACAGG - Intergenic
1191576387 X:62710912-62710934 ACAAAAAAGGGGAAGTGATAAGG - Intergenic
1193081809 X:77413451-77413473 TAAAATAAGGGGCAGAGCTCTGG - Intergenic
1194723655 X:97369526-97369548 CAAAAAAAGGAGCACTGATGAGG - Intronic
1196899464 X:120368667-120368689 CATGAAATGGGGCAGTGTTCTGG - Intronic
1197984809 X:132256141-132256163 AAAGAAAAGAGGCAGTGAGCAGG - Intergenic
1198077530 X:133208466-133208488 CAAAAAAAGGAGTTGTGTTCAGG - Intergenic
1200094874 X:153652994-153653016 CAAAACAAGAAACAGTGATCTGG + Intergenic
1200420655 Y:2962841-2962863 CAAAAAAAGGGGGAGTAAGGTGG + Intronic