ID: 1147605176

View in Genome Browser
Species Human (GRCh38)
Location 17:41770341-41770363
Sequence GGTCTGGGAGTCCCACAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147605171_1147605176 -9 Left 1147605171 17:41770327-41770349 CCATCCCCTGGGTGGGTCTGGGA 0: 1
1: 0
2: 1
3: 35
4: 345
Right 1147605176 17:41770341-41770363 GGTCTGGGAGTCCCACAGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 184
1147605164_1147605176 3 Left 1147605164 17:41770315-41770337 CCTCTCTAGCTTCCATCCCCTGG 0: 1
1: 0
2: 5
3: 27
4: 331
Right 1147605176 17:41770341-41770363 GGTCTGGGAGTCCCACAGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 184
1147605163_1147605176 24 Left 1147605163 17:41770294-41770316 CCTCAGCTGAGACGTCAGGTTCC 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1147605176 17:41770341-41770363 GGTCTGGGAGTCCCACAGGTAGG 0: 1
1: 0
2: 0
3: 9
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147605176 Original CRISPR GGTCTGGGAGTCCCACAGGT AGG Intronic
901511860 1:9721607-9721629 GGGCTGGGATTCCCACAGAACGG - Intronic
902415476 1:16236455-16236477 GGTGTGGGGGTCCCAGAGCTAGG + Intronic
904996735 1:34637203-34637225 GGGCTGGCCATCCCACAGGTGGG + Intergenic
906791153 1:48659706-48659728 AGTCTGGGAGGCCCACACCTGGG + Intronic
907467865 1:54651468-54651490 GGTCTGGGTCTTCCACAGGCTGG - Intronic
909392784 1:75135504-75135526 GGTCCGGGAGGCCCCCAGGTTGG + Intronic
910624935 1:89296479-89296501 GGCCTTGGATTTCCACAGGTTGG + Intergenic
911445528 1:97987133-97987155 GGGCTGGCAATCCCACAGGGTGG - Intergenic
912953916 1:114139524-114139546 GGTCTGTGATCCCCACAGGCTGG + Intronic
918095781 1:181333017-181333039 GGTATGGGAGTCATGCAGGTAGG + Intergenic
922219958 1:223550860-223550882 GGGCTGGCAGCACCACAGGTGGG - Intronic
922822478 1:228493891-228493913 GCTCTGGGACTGCCACGGGTTGG - Exonic
924443518 1:244106376-244106398 GGACTGAGAATGCCACAGGTGGG - Intergenic
1064075969 10:12269041-12269063 GGTGAGGGGGCCCCACAGGTGGG + Intergenic
1064566477 10:16644603-16644625 GGTCTGGGAGACCCAGAGCCTGG - Intronic
1065940739 10:30562179-30562201 GGTCTGTAAGTCACACAGCTGGG - Intergenic
1067686261 10:48467421-48467443 GGGATGGGAGTCCCAAGGGTAGG + Intronic
1067694965 10:48528054-48528076 TCTCTGGGAGACCCACAGTTGGG + Intronic
1067837872 10:49652757-49652779 GGTGTGGGAGGGCCTCAGGTGGG - Intronic
1071214500 10:83384230-83384252 GATCTGGCAATCCCACAGCTGGG - Intergenic
1071999855 10:91184878-91184900 GGGATGGGACTCCCACAGGAAGG - Intronic
1074184193 10:111086851-111086873 GGACTGGGAGTGCCAGGGGTGGG + Intergenic
1075165585 10:120065312-120065334 GGGATGGGAGGCCCACAGGATGG - Intergenic
1075657219 10:124169903-124169925 GGGCTGAGGGTACCACAGGTGGG - Intergenic
1075797660 10:125132456-125132478 GGCCTGGGGTTCCCACAGTTGGG + Intronic
1076712852 10:132348126-132348148 GGTCTGGCTTTTCCACAGGTGGG - Exonic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1081744011 11:45460380-45460402 GGTCTTTGAGCCCCACTGGTGGG + Intergenic
1083770241 11:64863196-64863218 AGTCTGAGAGTCGCACAGCTTGG + Intronic
1084431588 11:69114362-69114384 GGGCTGGGGGTGCCACAGGGAGG + Intergenic
1085054996 11:73398273-73398295 GGCCGGGGACTCCCACAGGCTGG - Intergenic
1085833473 11:79928204-79928226 AGCTTGGGAGTCCCACAGATGGG + Intergenic
1089320732 11:117625090-117625112 GGTCTGGGACTCCTACAGAGAGG + Intronic
1089498529 11:118919680-118919702 GGTCTGGGAGGAACACAGGCTGG - Intronic
1091683953 12:2548299-2548321 GCTCTGGGAGCACCACAGGAGGG - Intronic
1091778307 12:3198922-3198944 GGTCTGGAAGTCCCTCTGGCTGG + Intronic
1092013675 12:5138788-5138810 GGTCTGGCAGCCCCTCAGGAGGG - Intergenic
1092052642 12:5483300-5483322 GGTCTGCAAGCCCCACGGGTCGG - Intronic
1095952894 12:47791186-47791208 GGCCTGGGAGAACCACAGGGAGG + Intronic
1097223767 12:57465111-57465133 GGGCTGGGAATCCCAGAGATGGG - Exonic
1101901205 12:108792439-108792461 AGTTTGGGAGTCCCAAAGGTCGG - Exonic
1104856993 12:131906970-131906992 GCCCTGGGAGCCCCACAGGGAGG + Intronic
1111539990 13:89657224-89657246 GGTACGGGAGTCTCAGAGGTTGG - Intergenic
1113838231 13:113343542-113343564 GGTCTGTGAGTCACACAGCCAGG + Intronic
1115419164 14:33172710-33172732 GGTCTGGCTGTCACCCAGGTTGG - Intronic
1116583807 14:46676643-46676665 GATCTGAGAGTCCCACTGGTAGG + Intergenic
1117542496 14:56761981-56762003 CTTCTGGCAGTCCCAAAGGTAGG - Intergenic
1118641246 14:67794472-67794494 GGGCTCTGAGACCCACAGGTTGG - Intronic
1119767500 14:77199631-77199653 GGTCTCTGAGCCCCACAGCTTGG + Intronic
1119788280 14:77328516-77328538 GACTTAGGAGTCCCACAGGTAGG + Intronic
1122938301 14:104970039-104970061 GGTCTGCAAGTCCCCAAGGTGGG - Intronic
1123405594 15:20018005-20018027 GGTCTCGGGGCCCCACAGGGTGG - Intergenic
1123514924 15:21024653-21024675 GGTCTCGGGGCCCCACAGGGTGG - Intergenic
1123972895 15:25525514-25525536 GGCCCGGCAGTCACACAGGTGGG - Intergenic
1126250261 15:46559262-46559284 GATCTGGCAGTCCCACTGCTGGG - Intergenic
1130994960 15:88898596-88898618 GCTCAGGGAGGACCACAGGTGGG + Intergenic
1132673079 16:1109713-1109735 GGCCTGGGACTTCCCCAGGTAGG - Intergenic
1134194264 16:12146753-12146775 GATGTGGGACTCCCAAAGGTGGG + Intronic
1135288121 16:21211503-21211525 GCTCTTGGAGTCCCTCAGGCTGG - Exonic
1136081773 16:27856917-27856939 GGCCTGGGAATCCCCCAGGGAGG + Intronic
1136230703 16:28883691-28883713 GGCCAGGGAGACGCACAGGTGGG - Intronic
1138126895 16:54446603-54446625 GGTCTGGGAGACTGACTGGTGGG - Intergenic
1139041599 16:63005199-63005221 GGTCTGGCAGCCCCACTGGGTGG - Intergenic
1139256253 16:65545715-65545737 GGTCTTGGAGTCAGAGAGGTTGG + Intergenic
1139379237 16:66520121-66520143 GTCCTGGCCGTCCCACAGGTTGG - Intronic
1140703733 16:77606556-77606578 GGTCTGGAAGACACTCAGGTTGG + Intergenic
1146006166 17:29162044-29162066 GGTCTTGGTGACCCACTGGTAGG - Intronic
1146912960 17:36659846-36659868 GGTCTGAGGGTCCCAGAGGAGGG + Intergenic
1147605176 17:41770341-41770363 GGTCTGGGAGTCCCACAGGTAGG + Intronic
1152199346 17:78936032-78936054 GCGCTGGGAGGCCCACAGGCCGG + Intergenic
1152367092 17:79862557-79862579 GGTCAGGGAGACCCAAGGGTGGG + Intergenic
1154167825 18:12029141-12029163 GGTCTTGGTGTCACACAGGATGG + Intronic
1155331828 18:24726730-24726752 GGGCTTGGAGACCCACAGATTGG + Intergenic
1155771602 18:29707879-29707901 AGTCTGGGAGTTCCAGAGTTAGG + Intergenic
1159910277 18:74138998-74139020 GGTCGGGGAGCCCATCAGGTGGG - Intronic
1160306740 18:77747273-77747295 GGTCTGGTAGGTGCACAGGTGGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161768261 19:6218368-6218390 GGGCTTGAAGTCCCACAGGTGGG + Intronic
1162480263 19:10923467-10923489 GGTCTGGGGTGGCCACAGGTGGG - Intronic
1163425817 19:17240536-17240558 GGTCTGGGTGCCTCACAGGGTGG - Intronic
1163632346 19:18423946-18423968 GGTCTGGGGGCGCCACCGGTTGG - Intronic
1164129845 19:22351451-22351473 TGTCTGGTCTTCCCACAGGTGGG + Intergenic
1164169704 19:22714558-22714580 TGTCTGGTCTTCCCACAGGTGGG - Intergenic
1165261568 19:34623593-34623615 GGTCTGGGATACCCAGAGATAGG - Intronic
1165953167 19:39486094-39486116 GTTCTGGGAATCCCCCAGGCTGG + Intronic
1166096573 19:40543037-40543059 GGTCAGGGAGTCCCTGATGTTGG + Intronic
1167578886 19:50330744-50330766 GGGCTAGGAGTCTCAGAGGTCGG + Intronic
927981121 2:27375785-27375807 GGTCAGGGAGCCAGACAGGTTGG + Intronic
928224755 2:29438971-29438993 TGGCTTGGAGTCCCACAGGCAGG - Intronic
932721302 2:74140643-74140665 GGGCTGTGATTCCCACAGTTTGG - Intronic
933437023 2:82261148-82261170 GGTGTGGGAGGGCCCCAGGTGGG - Intergenic
934886611 2:98030782-98030804 AATCTGGGAGTCCCTCAGCTGGG - Intergenic
941585289 2:167350940-167350962 GGTCAGGTAGTGCCACAGGATGG - Intergenic
945249817 2:207755348-207755370 GGTCTGGATGTCGCCCAGGTTGG - Intronic
946536660 2:220637153-220637175 GGTCTGTGAGGCCGAGAGGTAGG + Intergenic
947544489 2:231001313-231001335 GATCTGTGAGGCCCTCAGGTGGG - Intronic
947899707 2:233711267-233711289 GGTCTAGGAGTCCTAGACGTGGG + Intronic
948017142 2:234700015-234700037 GGCCTGGGAGTGCACCAGGTGGG - Intergenic
948646990 2:239411504-239411526 GGTCAGGAAGTCCAAGAGGTGGG + Intergenic
948654378 2:239467254-239467276 GGTGTGGGGGTCTCATAGGTGGG + Intergenic
1169131505 20:3168322-3168344 GGCCTGCGTTTCCCACAGGTGGG + Intronic
1171184063 20:23112180-23112202 GCTCTGGCAGCCCCACAGGCAGG + Intergenic
1173594082 20:44247624-44247646 GGTTTGGGGGTCCCGGAGGTCGG + Intronic
1176041271 20:63067159-63067181 GGTCTGGGCGTCCTTCAGTTAGG + Intergenic
1178522298 21:33296467-33296489 GGTCTGGGAGTTCTAGATGTGGG - Exonic
1178990835 21:37355156-37355178 GATCTGGGATTCCCCCAGATGGG + Intergenic
1179329386 21:40384149-40384171 GTTCAGGGAGGCCCACAGGTTGG + Intronic
1181126949 22:20708267-20708289 GGCCTCGGAGTCCCCCGGGTTGG - Intronic
1181495116 22:23283323-23283345 GGACTAGGAGTTCCACATGTGGG + Intronic
1183218364 22:36495922-36495944 GGTCTGAGGAGCCCACAGGTTGG + Intronic
1183785015 22:40024239-40024261 GCTTTGGGAGGCCCAGAGGTAGG - Intronic
1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG + Intronic
1184765341 22:46569298-46569320 GATCAGGGAGACCCACAGGAGGG + Intergenic
1184767728 22:46580314-46580336 GGTTTGGGCATCCCACAGGCTGG + Intronic
1184808538 22:46812463-46812485 GCTCTGGGGCTCCCACGGGTTGG + Intronic
1185012665 22:48323955-48323977 GGTCCTGGAGACCCACAGCTAGG - Intergenic
1185274418 22:49944187-49944209 GGCCTGGGTGACCCGCAGGTGGG - Intergenic
950525148 3:13518929-13518951 GGTCTGCGAGGCCCACGGGCTGG - Intergenic
954556304 3:51520136-51520158 GGGCTGAGAGTCCCAGAGGAGGG - Intergenic
957739968 3:84252676-84252698 GTTCTGGGAGTTCCAAAGATAGG - Intergenic
957889283 3:86334226-86334248 GGTCTTGGAGCACCACAGTTGGG + Intergenic
959943824 3:112106794-112106816 GGTGTGGTAGTCACACAGGCTGG - Intronic
961616225 3:128183348-128183370 GGCTTGGGAGCCCAACAGGTTGG - Intronic
963105619 3:141644768-141644790 GGTCTACAAGTTCCACAGGTGGG - Intergenic
964263220 3:154864630-154864652 GCTCTGAAATTCCCACAGGTGGG - Intergenic
966217095 3:177515073-177515095 AGACTGGGAGTGCCACAGGAAGG + Intergenic
966628537 3:182046543-182046565 GGTCTTGGCGCCCAACAGGTAGG - Intergenic
966874416 3:184314410-184314432 GGTCTGGGAGTTTCAAAGTTCGG + Intronic
968503479 4:961542-961564 GCTGTCGGAGCCCCACAGGTCGG + Exonic
968910994 4:3476965-3476987 GCTCTGGGCGGCCCACAGGCGGG - Intronic
971357397 4:25907434-25907456 GGTCTGCGAGGCCCACAGCATGG + Intronic
980023932 4:127742298-127742320 TATCTGGGAGGCCCAAAGGTTGG - Intronic
982280487 4:153679602-153679624 GGTGTCGGAGTGCCACAGGGTGG + Intergenic
983373979 4:166900054-166900076 GGTTGTGGAGTCCCACAGGTAGG - Intronic
985656296 5:1133282-1133304 TGGCTGGGAGTCGCACATGTGGG + Intergenic
996923857 5:128800089-128800111 GGGCTGCCAGTCCCACAGATGGG - Intronic
997215023 5:132103133-132103155 GGTGTCGGGGTCCCACTGGTTGG - Intergenic
1000237620 5:159377074-159377096 AGCCTGGTAGTCCCACTGGTGGG + Intergenic
1001475353 5:172046568-172046590 GGCTTTGGAGTCACACAGGTGGG - Intronic
1001631593 5:173179461-173179483 GGTCTGTGAGTCCCTGAGGCAGG - Intergenic
1001975426 5:175994797-175994819 TGTCTGAGAGTCACACAGGCTGG - Intronic
1002068453 5:176664540-176664562 GGTCTGGGAGTCTTGCAGGTCGG + Intergenic
1002242007 5:177848973-177848995 TGTCTGAGAGTCACACAGGCTGG + Intergenic
1003171246 6:3723507-3723529 CGTCTGGGAGTTCCAGAGCTGGG + Exonic
1004462046 6:15846828-15846850 GGTCTGGATGTCGCCCAGGTTGG + Intergenic
1006378188 6:33683357-33683379 GTTCTTGTAGTCCCACTGGTTGG - Exonic
1007214671 6:40227964-40227986 GGGCTGGGTGCTCCACAGGTGGG + Intergenic
1007262594 6:40574375-40574397 GGCCTGGGAGTCAGACAGCTGGG - Intronic
1007665964 6:43513096-43513118 GATCTGGGCGTTGCACAGGTAGG + Exonic
1007684230 6:43655755-43655777 TGTCTGGGAGTCCAGCAGGGGGG + Intronic
1009509519 6:64531895-64531917 AGTCTGGGAGTCACACCAGTGGG + Intronic
1010246562 6:73664982-73665004 GATCTGGCAGTCCCACTGCTAGG + Intergenic
1019477971 7:1253061-1253083 GGCCTGGGGGTCCCCAAGGTGGG + Intergenic
1021024173 7:15643634-15643656 CCTCTGGGAGTCCCACAGTCTGG - Intronic
1021072760 7:16262800-16262822 GGTCTGGGAGATCCACGGGCAGG + Intronic
1025725355 7:64053189-64053211 CATCTGGAAGTCCCACATGTAGG + Intronic
1028284226 7:88975292-88975314 GGTCTAGCAATCCCACAGCTAGG - Intronic
1029574298 7:101392841-101392863 GGTCTGGGCTTGCCACGGGTGGG + Intronic
1031393870 7:121248312-121248334 GTTCAGGGAGCCCCACAGCTTGG + Intronic
1032781864 7:135170394-135170416 CCTCTGGGCCTCCCACAGGTCGG - Intronic
1033119747 7:138657183-138657205 GGTCTGGCTGTCTCCCAGGTTGG + Intronic
1034417929 7:150974981-150975003 GGGCTGGGAGTCCCGGAGGCTGG - Intronic
1035270782 7:157718846-157718868 GGTCTGAGGGCCCCAGAGGTCGG - Intronic
1035271077 7:157720344-157720366 GGTCTGAGGGCCCCAGAGGTCGG - Intronic
1035315898 7:157997503-157997525 GGGCTGGAAGGGCCACAGGTGGG + Intronic
1036598009 8:10231449-10231471 TGTCAGGGAGCCCCCCAGGTGGG + Intronic
1036986259 8:13534472-13534494 GTTCTGGAAGTCCCACAGCGTGG + Intergenic
1040456364 8:47602215-47602237 GCTCTGTGGGTCCCACAGGATGG + Intronic
1042267329 8:66922842-66922864 GGTTTGGGAGTCTGAAAGGTAGG - Intergenic
1052276904 9:26686982-26687004 GGTCTGAAAGTCCCACTGGAGGG - Intergenic
1056546875 9:87620642-87620664 GGACTGGGAGTAGGACAGGTAGG + Intronic
1057188211 9:93070774-93070796 GGACTAGGAGCCCCACAGGCTGG + Intronic
1057216428 9:93231301-93231323 GGTCTGGGAATCCAACGAGTGGG - Intronic
1057472521 9:95370332-95370354 GGAGTGGGACTCCCACAGCTTGG + Intergenic
1057696274 9:97324934-97324956 AGACAGGGGGTCCCACAGGTGGG + Intronic
1061184038 9:129041755-129041777 GGCCTGGGAGCCCCTCAGATGGG - Intronic
1061262382 9:129487453-129487475 GGACTGGGAGAGCCACAGGAAGG + Intergenic
1061679921 9:132237931-132237953 GGACTAGGTGGCCCACAGGTGGG + Intronic
1062071141 9:134555630-134555652 GGAATGGGAGACCCACAGGAGGG + Intergenic
1062321972 9:135994490-135994512 GGACTGGGAGTCCCACCCATGGG - Intergenic
1062597679 9:137306459-137306481 GGGCAGGGGGTCCCAGAGGTGGG - Intergenic
1185842703 X:3407969-3407991 AGTCTGGAAGTCCCAGAGGAAGG + Intergenic
1190070242 X:47273500-47273522 GGTCTGGGAGACCCTCATGGAGG + Intergenic
1190235732 X:48613989-48614011 GCTCTGAGAGTCACACAGGCTGG - Intergenic
1190708408 X:53048916-53048938 GGCCTGGGAGAGCCCCAGGTTGG - Intergenic
1193341715 X:80355928-80355950 GTACTGGGAGTTCCACAGATAGG - Intronic
1195904052 X:109826791-109826813 TGTCTGGGAATCCCACAATTAGG - Intergenic
1196509535 X:116491551-116491573 GGTCCAGCAATCCCACAGGTGGG - Intergenic
1200064285 X:153497246-153497268 GGCCTGGGAGCCCCACTGGTGGG + Intronic
1200120075 X:153786042-153786064 GGACTGGGATTGCCACAGGAGGG + Intronic
1200126209 X:153816175-153816197 GGCCTGGGAGCCCCACTGGTGGG - Intronic
1200215392 X:154365963-154365985 AGTCTGGGCCTCCCACAGGAGGG - Intronic
1200779298 Y:7199780-7199802 GGTCTGGTAGTCCCAAGGCTGGG - Intergenic
1201489319 Y:14524267-14524289 GGTCTGCCAGTCCCTAAGGTAGG + Intronic