ID: 1147608127

View in Genome Browser
Species Human (GRCh38)
Location 17:41785753-41785775
Sequence CAGCCACAGCTACTGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147608122_1147608127 -5 Left 1147608122 17:41785735-41785757 CCCCTACCAACACTCTGGCAGCC 0: 1
1: 0
2: 0
3: 14
4: 208
Right 1147608127 17:41785753-41785775 CAGCCACAGCTACTGGAAACTGG 0: 1
1: 0
2: 1
3: 15
4: 199
1147608124_1147608127 -7 Left 1147608124 17:41785737-41785759 CCTACCAACACTCTGGCAGCCAC 0: 1
1: 0
2: 1
3: 26
4: 234
Right 1147608127 17:41785753-41785775 CAGCCACAGCTACTGGAAACTGG 0: 1
1: 0
2: 1
3: 15
4: 199
1147608123_1147608127 -6 Left 1147608123 17:41785736-41785758 CCCTACCAACACTCTGGCAGCCA 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1147608127 17:41785753-41785775 CAGCCACAGCTACTGGAAACTGG 0: 1
1: 0
2: 1
3: 15
4: 199
1147608120_1147608127 1 Left 1147608120 17:41785729-41785751 CCTGTTCCCCTACCAACACTCTG 0: 1
1: 0
2: 3
3: 15
4: 208
Right 1147608127 17:41785753-41785775 CAGCCACAGCTACTGGAAACTGG 0: 1
1: 0
2: 1
3: 15
4: 199
1147608117_1147608127 30 Left 1147608117 17:41785700-41785722 CCAACAATAAGAGGTTAGAGAAG 0: 1
1: 0
2: 0
3: 14
4: 188
Right 1147608127 17:41785753-41785775 CAGCCACAGCTACTGGAAACTGG 0: 1
1: 0
2: 1
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147608127 Original CRISPR CAGCCACAGCTACTGGAAAC TGG Intronic
900099521 1:955536-955558 CACACACAGCTCCAGGAAACAGG + Intronic
904405102 1:30283363-30283385 GAACCACAGCTACAGCAAACAGG + Intergenic
905176651 1:36140347-36140369 CAGCCAGAACTACTGCAAAATGG + Intronic
906510333 1:46406932-46406954 CAGCCTCAGCTGCTGGCACCAGG + Intronic
906880328 1:49582543-49582565 CAGCCACTGGTGCTGGAACCAGG - Intronic
908917403 1:69145387-69145409 CAGACACAGCTTTTGCAAACAGG - Intergenic
911101829 1:94101536-94101558 CAGCACCAGCTCCTGGAAGCAGG - Intronic
912467928 1:109886707-109886729 CAGTCCCAGGTTCTGGAAACTGG + Intergenic
913227576 1:116713556-116713578 GAGCCACAGCTGCTGACAACAGG + Intergenic
915494520 1:156272221-156272243 CAGCCACAGCTAGAGGAAGGAGG + Intronic
915791951 1:158681694-158681716 CAGCCACAGACACTGGGAGCAGG + Intronic
916677962 1:167080097-167080119 GAGCCACAGCTACTGGGAGGAGG - Intronic
919993676 1:202728077-202728099 CATCCACTGCTACTGCAACCTGG + Exonic
921945484 1:220883344-220883366 CATCCACAGCTGGTGGAAAACGG - Intronic
924159411 1:241215570-241215592 CAGCCAGAGCAGCTGGAAACTGG - Intronic
1070717276 10:78731909-78731931 GAGCCACAGGTTCTGGAAATGGG - Intergenic
1071768901 10:88702526-88702548 AGGCCACAGCTACTGGGAAAAGG - Intergenic
1072306830 10:94115799-94115821 AAGCCACAGTCACTGGGAACAGG - Intronic
1074390611 10:113054488-113054510 CAGACACAGCCACTAAAAACAGG - Intronic
1076411442 10:130254481-130254503 CAGCCACAGCCACCGGCAGCTGG - Intergenic
1076841929 10:133050062-133050084 GAGCCCCAGCTCCAGGAAACCGG + Intergenic
1078876471 11:15403583-15403605 CAGCCACAGGCACTGGAATTGGG - Intergenic
1079093134 11:17494539-17494561 CAGCCACAGCCACAGCACACAGG + Intronic
1083894492 11:65613400-65613422 CAGCCGCAGCTCCTGGAAGCTGG + Exonic
1084287326 11:68140724-68140746 CAGCCATAGCCACTGGGAAGAGG + Intergenic
1085460258 11:76689219-76689241 CAGCCAGAGCTACGGGAGCCTGG + Intergenic
1085593745 11:77789810-77789832 CAGACACACATTCTGGAAACAGG + Intronic
1085782685 11:79423712-79423734 AATCCTCAGCTCCTGGAAACAGG - Intronic
1086901411 11:92372005-92372027 CAGGCAGAGCAACTGAAAACAGG - Intronic
1087039065 11:93781182-93781204 AAGCCAGAACTACTGGAAAGGGG - Intronic
1089587090 11:119516832-119516854 CAGCCACAGGTCCTGGATAAAGG - Intergenic
1091198442 11:133751599-133751621 CAGCCACAGCTAAAGGATCCTGG + Intergenic
1091654227 12:2333570-2333592 CATCCACTGCTACTGGAAGGAGG - Intronic
1092494660 12:8980693-8980715 CAGCCACACCCTCTGGAACCAGG - Intronic
1093971040 12:25376263-25376285 CAGCCATAGCTCCTGGACTCCGG + Intergenic
1094802227 12:34049429-34049451 AAGCCACATCTATTGGAAAAGGG + Intergenic
1096067866 12:48755457-48755479 ATGCCACAGCTACTGGGAAAGGG - Intergenic
1102030213 12:109736006-109736028 CAGTCACTGCCACTGGCAACAGG - Intronic
1104108413 12:125684735-125684757 CATCCCCACGTACTGGAAACAGG - Intergenic
1104835496 12:131787303-131787325 CGTCCACAGCTACTGGAAGCCGG - Intronic
1106901626 13:34359988-34360010 CTGCCACAGTTACAGGACACTGG - Intergenic
1108506065 13:51113509-51113531 CAGCCTCAGCTATAAGAAACGGG + Intergenic
1110107575 13:71696942-71696964 CAGCAACAGCAAGTGGAGACAGG - Intronic
1111475392 13:88739437-88739459 AAGCAACAACTACTGGAATCAGG - Intergenic
1115750233 14:36482253-36482275 CAGCCACATCTACTGTAAACTGG + Intronic
1118532034 14:66717719-66717741 AAGCCACAGCCATTGGAAAAGGG - Intronic
1118773345 14:68957102-68957124 CATCCACAGCCCCTGGAAATTGG + Intronic
1118977935 14:70693444-70693466 CAGCCATGGCTACTGGAGTCAGG - Intergenic
1119258092 14:73217186-73217208 CAGCAACAGCCAGTGGAGACTGG + Exonic
1120297761 14:82665345-82665367 CAGCCAGAGCTAGTAGAAACTGG + Intergenic
1120818837 14:88893034-88893056 CAGCCACAGCTGATGGGACCAGG + Intergenic
1120887551 14:89463656-89463678 CAGCCTCAGCCACTGGAGCCTGG + Intronic
1120963800 14:90149664-90149686 CAGCCACAGCAACAGGCAAACGG - Intronic
1121832102 14:97061424-97061446 CAACCACAGCCACAGGGAACTGG + Intergenic
1122289646 14:100673443-100673465 CAGCCAAAGCCCCTGGTAACAGG + Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127638669 15:60894721-60894743 CAGCATCAGCTCCTGGGAACGGG - Intronic
1127659641 15:61088394-61088416 AAGCCACAGCTGCAAGAAACGGG + Intronic
1128532563 15:68464637-68464659 CCGGGACAGCTACTGGAATCAGG - Intergenic
1130047828 15:80459967-80459989 CAGCCACAGTCACTGCAAAGTGG - Intronic
1130828295 15:87572490-87572512 CAGCCTCTGCTACGGGACACTGG + Intergenic
1132155525 15:99492973-99492995 CAGCCTCAGCTACAGGCCACGGG - Intergenic
1132316398 15:100893475-100893497 CAGCCAAAGCTGCTGGAAGCTGG - Intronic
1132835458 16:1950767-1950789 TTGCCACAGCTCCTGGAAGCTGG + Intronic
1132888125 16:2191335-2191357 CAGTCCCAGCCACTGGACACAGG + Intronic
1132926616 16:2433016-2433038 CGGCCACAGCTCCTGGAAGCTGG - Exonic
1133662991 16:7937053-7937075 CATTCACAGTGACTGGAAACAGG + Intergenic
1134062242 16:11206188-11206210 TAGCCACAGTAACAGGAAACAGG - Intergenic
1134270597 16:12729803-12729825 CAGCCACAGAATTTGGAAACTGG + Intronic
1134344781 16:13379620-13379642 TAGGCACAGGGACTGGAAACAGG - Intergenic
1137350522 16:47710357-47710379 GAGCCAAGGCTACTGTAAACGGG - Intergenic
1138002757 16:53299034-53299056 CAGCCTCAGCACCTGGAACCAGG + Intronic
1139087189 16:63601485-63601507 GACCCAAAGCTATTGGAAACTGG - Intergenic
1141979562 16:87541447-87541469 CAGCCAGCCCTGCTGGAAACGGG - Intergenic
1143551710 17:7634414-7634436 CAGCCACAGAGGCAGGAAACTGG - Intergenic
1145311232 17:21702186-21702208 CAGCCACAGCCCCTGGCACCAGG - Intronic
1146121568 17:30200404-30200426 CACCCAAAGATACTGGAAAATGG - Intronic
1146250661 17:31340525-31340547 CAGCCACAGCTACCCAAAAGAGG - Exonic
1147608127 17:41785753-41785775 CAGCCACAGCTACTGGAAACTGG + Intronic
1147649758 17:42055195-42055217 CAGCGGCAGCTCCTGAAAACAGG + Intronic
1150714582 17:67560710-67560732 CAGCTAGAGCAAGTGGAAACGGG - Intronic
1151390352 17:73782886-73782908 CACCCACAGCCTCTGGAAGCAGG + Intergenic
1152386570 17:79978252-79978274 GAGCCAGAGCTGCTGGGAACTGG + Intronic
1152762290 17:82115113-82115135 CAGCCCCAGCTGGTGGAATCAGG - Intronic
1152818425 17:82423135-82423157 CAGCAACAGATGATGGAAACAGG - Intronic
1153439128 18:5097926-5097948 CAGACACACTTATTGGAAACAGG - Intergenic
1153560481 18:6367606-6367628 CTGCTACAGCTACTGGTAAAGGG - Exonic
1153876093 18:9372463-9372485 CAACCACAGATAATTGAAACTGG + Intronic
1157141947 18:45117645-45117667 CAGCCACAGGAACTGAAAATGGG - Intergenic
1157629994 18:49085887-49085909 GAGCCACTGCTCCTGGCAACTGG + Intronic
1157922288 18:51725742-51725764 GTGCCAAAGCTACAGGAAACAGG + Intergenic
1160569076 18:79804263-79804285 CAGCCACAGCCGCTGGACCCTGG + Intergenic
1161636864 19:5394689-5394711 CAGCCACGGCTGCTGGAAGAAGG + Intergenic
1163618270 19:18342288-18342310 CAGTCCCTGCTCCTGGAAACTGG + Intronic
1163943482 19:20515638-20515660 CAGCTAAAGTTACTGGGAACAGG - Intergenic
1165344584 19:35236594-35236616 CGGCCAGAACTACTGGAGACTGG + Intergenic
1166880050 19:45923516-45923538 CAGCCACCGCATCTGGAGACAGG + Intergenic
1167232002 19:48290737-48290759 CAGCCTCAGCGACTGGAGGCGGG - Intergenic
1167410827 19:49342723-49342745 CACCCACAGTGACTGGAGACTGG + Intronic
1168048510 19:53811120-53811142 CAGCAGCAGCTTCTGGACACAGG - Exonic
925087227 2:1117647-1117669 CAGCAACAGCTCCCTGAAACTGG + Intronic
931799980 2:65748811-65748833 CAGGAACTTCTACTGGAAACTGG + Intergenic
932571011 2:72938421-72938443 CAGGGGCAGCTACTGGAACCTGG + Intergenic
936024686 2:109022153-109022175 CAGCCACTGCCCCTGGATACAGG - Intergenic
938773438 2:134520782-134520804 CACCCAAAGCTACTGGAAAGGGG + Intronic
940200641 2:151146387-151146409 CAGTCACAGCTGCTGGTACCTGG + Intergenic
942645713 2:178108488-178108510 TATCCACAGCTACTGGACAGCGG - Intergenic
944516342 2:200515443-200515465 GAGACACAGCTACTTGAGACTGG - Intronic
948298804 2:236886432-236886454 CAGCCACAGTCAGTGCAAACAGG - Intergenic
1168913461 20:1467957-1467979 CAGCCCCAGCCAATGGGAACAGG + Intronic
1172819154 20:37717152-37717174 CAGCCACTCCTATTGGAAAAGGG + Intronic
1177195525 21:17900574-17900596 CTGCCACCTCCACTGGAAACAGG - Intergenic
1178439107 21:32584226-32584248 CAGCCCCAGCTCCTGGGCACGGG + Exonic
1178735043 21:35141552-35141574 CAGCCACCGCTCCTGGCCACAGG + Intronic
1180560942 22:16613818-16613840 CAGCCACACCTCCTGCATACAGG + Intergenic
1181169219 22:20998842-20998864 GAGCCACATCTTGTGGAAACTGG - Exonic
1183067021 22:35370330-35370352 CAAGCTCAGCCACTGGAAACGGG + Intergenic
1183741579 22:39671386-39671408 CAGCCATAGGTAGTGGAACCAGG + Intronic
1184224119 22:43119322-43119344 CAGCTGCAGATACAGGAAACTGG - Intronic
949747290 3:7309808-7309830 CAGCCACCCCTCCAGGAAACTGG - Intronic
950705267 3:14775549-14775571 CAGCAACAGCTACAGCAAAATGG + Intergenic
951166269 3:19487730-19487752 CAGCTAAAGTTACTGGGAACAGG - Intronic
951554269 3:23904962-23904984 CAACCACAGCTACGGCAAAATGG + Intronic
952143221 3:30502321-30502343 CACCCACAGCTGCTGGTAAGAGG + Intergenic
954665409 3:52248772-52248794 CAGCCACAGCTACCAGCAAGAGG - Intronic
955532040 3:59883740-59883762 CAGCCATATGAACTGGAAACTGG + Intronic
958770599 3:98421537-98421559 CAGCCAGAGGTACTGGAAAAAGG + Intergenic
961360753 3:126365722-126365744 CAGTCACAGCTCAGGGAAACTGG - Intergenic
962847941 3:139287438-139287460 CAGCAGCAGCACCTGGAAACTGG - Intronic
963234623 3:142945013-142945035 GAGCCACAGCTCCTGGAGAAGGG + Intergenic
964522688 3:157585048-157585070 CAGCTAAAGTTACTGGGAACAGG - Intronic
968750991 4:2388982-2389004 CAGCCACAGCTACTGGCAGTGGG - Intronic
969363948 4:6683069-6683091 CACCCACAGCTCCAGGAAAGGGG + Intergenic
970190054 4:13507347-13507369 CAGCCACAGGAACTTGAAAAAGG - Intergenic
970498223 4:16649844-16649866 AAGTCAGAGCTACTCGAAACAGG + Intronic
973993141 4:56431989-56432011 CAGCCAGAACTACTAAAAACGGG + Intronic
978282705 4:107036522-107036544 CACCCACAACTACTGGAAAAGGG + Intronic
984198134 4:176684654-176684676 CTCTCACCGCTACTGGAAACTGG - Intronic
985100276 4:186451644-186451666 CTGCAACAGCAACAGGAAACTGG + Intronic
987391424 5:17379516-17379538 CAGCAACAGCTAATGTAAAGTGG - Intergenic
987690054 5:21254422-21254444 CTGCCACAGGGGCTGGAAACAGG + Intergenic
990350352 5:54909533-54909555 CAGCCTCATCTCCTAGAAACTGG + Intergenic
991214313 5:64144660-64144682 CAGCCACAGCTCCTGGCAGATGG - Intergenic
991629125 5:68636414-68636436 CAACCATAGCTACTGGAAAATGG + Intergenic
993568057 5:89499900-89499922 CATCCACAGCTACTGTATTCTGG + Intergenic
993589413 5:89776333-89776355 CATTTACAGCTACTGAAAACCGG + Intergenic
994303989 5:98180343-98180365 CAGCCAGAGGTACTAGAAAAAGG + Intergenic
994380924 5:99070157-99070179 CAGCAACAGATAATGGAAGCAGG + Intergenic
994568297 5:101482480-101482502 AAGCCACATCTACAGGAAAAGGG - Intergenic
998262528 5:140642304-140642326 CAGACACAGCTCCTGAGAACAGG - Exonic
998812658 5:145982040-145982062 CAGCCACTGCCACTTAAAACAGG - Intronic
999610088 5:153359839-153359861 CACCCTCAGTGACTGGAAACAGG - Intergenic
999906620 5:156148282-156148304 CAAACACAGCACCTGGAAACTGG + Intronic
1001119685 5:168969751-168969773 CAGCCCCAGCTCCTGGAGAGCGG + Intronic
1001222048 5:169909064-169909086 CAGCAGCAGCTACTGAAAGCAGG - Intronic
1001682104 5:173565684-173565706 CAGCCACACCTGCTGGGAAGTGG + Intergenic
1001933292 5:175687847-175687869 CAGCCACAGGAAATGGACACAGG - Intergenic
1005044388 6:21628312-21628334 CAGCCACAGTGACAGGAAAGGGG - Intergenic
1006171913 6:32097939-32097961 CAGCCACAGCCAGTGGAAGGGGG + Intronic
1010165027 6:72905590-72905612 AAGCCACATCCACTGGAAAAGGG - Intronic
1010902402 6:81443010-81443032 CACCCACAGCTACTGCAACGGGG - Intergenic
1011903275 6:92327802-92327824 CAGTCAAAGCTACTTGAAACAGG - Intergenic
1012228912 6:96737465-96737487 CTGCCACTGCTATGGGAAACTGG + Intergenic
1012611980 6:101228929-101228951 CAGCTAAAGCTACTTGGAACGGG - Intergenic
1017457923 6:154619406-154619428 CAACCACAGTTACTGAAACCTGG + Intergenic
1018795053 6:167179336-167179358 CAGCCACGGCCCCTGGAGACCGG - Intronic
1018821265 6:167375726-167375748 CAGCCACGGCCCCTGGAGACCGG + Intronic
1018971132 6:168530210-168530232 CAGCCACAGCGGAGGGAAACGGG + Intronic
1019155990 6:170039327-170039349 CAGCCACGGCCACAGGCAACTGG - Intergenic
1019433139 7:1008603-1008625 CAGCCTCAGCTCCGAGAAACAGG + Intronic
1019997509 7:4734343-4734365 GAGCCACAGCCAGGGGAAACGGG - Intronic
1021139407 7:17005520-17005542 CAGCGACAGCTACAGGGAAGGGG - Intergenic
1021552688 7:21888437-21888459 CAGGCACAGTTATTAGAAACTGG - Intronic
1022654001 7:32302071-32302093 CAGGCACAGCTACTGAACAATGG - Intergenic
1023035613 7:36128933-36128955 CAGCCACAGCTTCTGGAACAAGG + Intergenic
1024081410 7:45859175-45859197 CACTCACAGCTTCTGGAGACTGG - Intergenic
1024317680 7:48036205-48036227 CAGCTGCAGCTCCTGGCAACTGG + Exonic
1026100337 7:67378918-67378940 CAGCCACACCTACAGAAAAGTGG - Intergenic
1028617342 7:92783336-92783358 CAGCAACAGCTAGTGGGAAAGGG - Intronic
1031965690 7:128026753-128026775 CAGCCTCAGCTCCTGGGACCTGG - Intronic
1033269591 7:139918708-139918730 CAGCTTCAGCTGCTGGAAAGGGG - Intronic
1033487046 7:141801276-141801298 CAGCAACATATACTGCAAACAGG + Intergenic
1034137684 7:148786620-148786642 AATACACAGCTACTGGAAATGGG - Intronic
1034933137 7:155179893-155179915 TAGTCACAGCTACAGGAGACTGG + Intergenic
1035384238 7:158459649-158459671 CAGCCACAGCGGCTGGACAGGGG - Intronic
1037433061 8:18834476-18834498 CATCCACAGCCCCTGGCAACAGG + Intronic
1038227553 8:25670819-25670841 CAGCAACATCTACAGGAAAGGGG - Intergenic
1038447042 8:27611501-27611523 CAGCCTCAGCTTCTGGGAAAGGG - Intronic
1042088686 8:65134386-65134408 AAGCCACATCCACTGGAAAAGGG + Intergenic
1046664882 8:116990068-116990090 CAGCCTCAGGAATTGGAAACTGG - Intronic
1047292625 8:123542788-123542810 TAGTCTCAGCTACTGGAGACTGG - Intergenic
1047499806 8:125431965-125431987 GAGACACAGCTCCTAGAAACAGG + Intronic
1049391129 8:142372268-142372290 CAGCCTCAGCTCCTGGGACCTGG + Intronic
1049773984 8:144396314-144396336 CAGCCAGTGCTGCTGGGAACCGG + Intronic
1053008071 9:34617261-34617283 CAGCCAGAGCTAGGGGAGACAGG - Intronic
1053202686 9:36163493-36163515 CAGCCACAGCTGCCAGGAACAGG - Exonic
1053297663 9:36926467-36926489 CAGCAAGAGCTATTGGAAAAAGG + Intronic
1056763495 9:89430520-89430542 CAGCCACAGTTACTGGGGAGGGG + Intronic
1057340701 9:94198678-94198700 CAGCCACAGGCACAGGAACCGGG - Intergenic
1058770750 9:108228777-108228799 AAGCCACATCTACAGGAAAATGG + Intergenic
1060226188 9:121792505-121792527 CAGCCACACCTCCTGCATACAGG + Intergenic
1060693464 9:125685748-125685770 CATCCACATATACTAGAAACTGG - Intronic
1061084230 9:128389955-128389977 CCACCACAGCTGCTGGAAAAGGG - Exonic
1061641506 9:131961048-131961070 CTGCCACAGCTCAGGGAAACTGG + Intronic
1062034133 9:134375318-134375340 CAGCCACAGCCATCGGAACCAGG - Intronic
1062272782 9:135717473-135717495 CAGGCAAAGCTGCTGGGAACCGG - Intronic
1062463132 9:136670155-136670177 CATCCACATCTGCAGGAAACGGG - Exonic
1186156010 X:6727684-6727706 CAGCCACACCCACTGGCCACAGG - Intergenic
1187017045 X:15339902-15339924 CAGCAACAGCAACTGGGAGCTGG + Intergenic
1191654014 X:63576382-63576404 GAGGCACAAGTACTGGAAACTGG + Intergenic
1193253318 X:79319022-79319044 AAGCCACATCCACTGGAAAAGGG - Intergenic
1196025951 X:111041563-111041585 CAGCTACAGCTTCTGAAAAAAGG - Intronic
1197163334 X:123347974-123347996 CAGCCACAGCTACTTGAGGGTGG - Intronic
1198266839 X:135017355-135017377 CAGACTCAGATACTGGAAACTGG + Intergenic
1200299442 X:154957959-154957981 CACCCCCAGCTCCTGGAAAAGGG - Intronic
1201629380 Y:16052807-16052829 CAGCCATAGCTACAAGAAACAGG + Intergenic