ID: 1147612879

View in Genome Browser
Species Human (GRCh38)
Location 17:41811987-41812009
Sequence CGGGCGGGCGGCGCGCCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 8, 3: 48, 4: 425}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147612857_1147612879 27 Left 1147612857 17:41811937-41811959 CCGGAGCTGAGCTGGCTGCCCCG 0: 1
1: 0
2: 3
3: 27
4: 374
Right 1147612879 17:41811987-41812009 CGGGCGGGCGGCGCGCCCGCTGG 0: 1
1: 0
2: 8
3: 48
4: 425
1147612865_1147612879 8 Left 1147612865 17:41811956-41811978 CCCGCGGACGGAAGGGGACAGGG 0: 1
1: 0
2: 1
3: 9
4: 178
Right 1147612879 17:41811987-41812009 CGGGCGGGCGGCGCGCCCGCTGG 0: 1
1: 0
2: 8
3: 48
4: 425
1147612867_1147612879 7 Left 1147612867 17:41811957-41811979 CCGCGGACGGAAGGGGACAGGGC 0: 1
1: 0
2: 1
3: 8
4: 139
Right 1147612879 17:41811987-41812009 CGGGCGGGCGGCGCGCCCGCTGG 0: 1
1: 0
2: 8
3: 48
4: 425
1147612863_1147612879 9 Left 1147612863 17:41811955-41811977 CCCCGCGGACGGAAGGGGACAGG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1147612879 17:41811987-41812009 CGGGCGGGCGGCGCGCCCGCTGG 0: 1
1: 0
2: 8
3: 48
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147612879 Original CRISPR CGGGCGGGCGGCGCGCCCGC TGG Exonic
900126773 1:1072235-1072257 CCGGCGGGCGGCACGGCCGTGGG + Exonic
900191711 1:1354926-1354948 CGGGCGAGCGCCGCGCCTACGGG - Exonic
900255066 1:1693563-1693585 GGGGCCGCAGGCGCGCCCGCGGG - Intronic
900263809 1:1746829-1746851 GGGGCCGCAGGCGCGCCCGCGGG - Intergenic
900414646 1:2529436-2529458 TCGTCGGGCCGCGCGCCCGCAGG + Exonic
901242644 1:7704269-7704291 CGGGCGCGGGGCGGCCCCGCGGG + Intronic
901381637 1:8878481-8878503 GAGGGAGGCGGCGCGCCCGCAGG - Intronic
901433893 1:9234745-9234767 CGGGCCGGGGGCGCGCGCGGCGG - Intergenic
901660361 1:10795112-10795134 CGGACGGGCGGAGCGGCGGCCGG - Intronic
901930793 1:12595395-12595417 CGGGCGCGGGGCGGGGCCGCGGG + Intronic
902079907 1:13813789-13813811 CGGGGAGGAGGCGCGCCCCCTGG + Intronic
902214294 1:14924595-14924617 GGGGCGGGCGGCGCGGACACAGG + Intronic
902315765 1:15617409-15617431 CGGGCGGCCGGCGCGCTTGGCGG + Intergenic
902600921 1:17539783-17539805 CGGGCGGGCGGCGCGGCCATTGG + Intergenic
904181321 1:28668804-28668826 CGGGCGGGCGGCGAGCGGCCAGG - Exonic
904236728 1:29121717-29121739 CGGGCGGGGAGCGCGGGCGCCGG + Exonic
904775043 1:32901317-32901339 CGCGCGGGCGACGGGCCAGCGGG - Exonic
906508003 1:46394286-46394308 CGGGCGGGCTGCGCGTGCGGCGG + Exonic
907010665 1:50960005-50960027 CGGGCGGCCGGGGCGCCTGAAGG - Exonic
908195465 1:61742668-61742690 CGGGCGGGCGGGGAGAGCGCGGG - Intronic
909075681 1:71047848-71047870 CGAGGGGGCGGGGCGCCCGTGGG + Intergenic
910251207 1:85200952-85200974 CGGGCGCGCGGCGGGGCGGCAGG - Exonic
914255335 1:145957791-145957813 GGGGCAGGCGGGGGGCCCGCAGG + Exonic
915214126 1:154328848-154328870 CGGGTGGGGCGCGCGCCCGACGG + Intronic
915588719 1:156859062-156859084 CTGGGGGGCCGCGCGCCCGGAGG - Intronic
915722171 1:157993562-157993584 CGGGCGGGGGGCGGGCTCCCGGG + Intronic
916961438 1:169893685-169893707 CGGGCGCGCGCCCCGCTCGCGGG - Intronic
918064278 1:181089125-181089147 CCGGCGGGTGGCCCGGCCGCCGG - Exonic
919724698 1:200874002-200874024 CAGGCGGCCGGTGCGCCCGCAGG - Exonic
919847419 1:201650510-201650532 CCGGCAGGCTGCCCGCCCGCTGG + Intronic
920184581 1:204152062-204152084 CGGGCCGGGGGCGTTCCCGCGGG - Intergenic
921206998 1:212858016-212858038 TGGGCGGGAGGCGGCCCCGCGGG - Intergenic
921217574 1:212950766-212950788 CAGGCGGGCGGCGCGCAGGAAGG - Intronic
921599289 1:217089726-217089748 CAGGCCGGCCCCGCGCCCGCGGG - Intronic
922586428 1:226737603-226737625 CGGGCTGGGGGCACGACCGCGGG + Exonic
922851163 1:228735333-228735355 CAGGCGCGCGGCGCGCAGGCGGG + Exonic
923299746 1:232630168-232630190 CGGGCGGGGGGCGGTGCCGCTGG - Intergenic
923631163 1:235650116-235650138 CGGGCGGGGGGCGCGGGCCCGGG - Intronic
923674119 1:236065245-236065267 CTGCCCCGCGGCGCGCCCGCTGG - Intergenic
1062843786 10:689693-689715 GAGGCGGGCGGCGGGCGCGCAGG + Intronic
1063664887 10:8055207-8055229 CGGGCGGGCGGCGCGAGGGGAGG + Intronic
1066464407 10:35640354-35640376 GGCGCGGGCGGCGCGGCGGCGGG - Exonic
1069521386 10:69124296-69124318 AGGGCGGGAGGCGAGCGCGCTGG - Intronic
1070079173 10:73168415-73168437 GGGGCGGGCGGCGGGCGCTCTGG + Intronic
1070610092 10:77926869-77926891 GGGGCGGGCGGCGCGCGCGGAGG - Intergenic
1070768508 10:79069576-79069598 AGGGCTGGAGGCGCGCCGGCAGG - Intronic
1071527302 10:86366133-86366155 CGGCCGCGCCGCGCTCCCGCTGG - Intronic
1072562330 10:96587216-96587238 CGGGCGGGCGCCGAGCAGGCTGG + Intronic
1072591429 10:96832096-96832118 CCGGCGGGCGGCGCGCGGGGCGG + Intergenic
1073043275 10:100621587-100621609 CGGGGCGGCGGGGCGGCCGCCGG + Intergenic
1073460185 10:103661532-103661554 GGGGAGGGCGGCGAGCCAGCGGG + Intronic
1073465639 10:103693244-103693266 CGGGCTGGCAGGGGGCCCGCGGG - Intronic
1074065303 10:110007982-110008004 CGGGCTGGCGGCTCGCGCTCTGG - Exonic
1074546072 10:114403565-114403587 GGGGAGGGGGGAGCGCCCGCAGG + Intronic
1075801822 10:125159323-125159345 CGGGCGGGCCGGGCTCCCGGCGG + Intronic
1075999825 10:126905684-126905706 CGGGGCGGCGGCGCGGGCGCGGG - Intronic
1076374016 10:129971767-129971789 CCGTCGGGCGGCGCGCGGGCGGG - Intergenic
1076792867 10:132786078-132786100 CGGGCGGGCGGCTCCGGCGCGGG + Intergenic
1076884493 10:133255546-133255568 AGGGTGGGCGGCGGGACCGCGGG - Intergenic
1077103593 11:832711-832733 TGGGCGGGAGGCGGGCCCGGAGG - Intergenic
1077107993 11:850143-850165 CGCGCGGGCGGCGGGGACGCCGG + Intronic
1077231729 11:1460801-1460823 CGGACGGGCGGCGCGGCCGCGGG - Exonic
1077322122 11:1947219-1947241 CGGGCGCGCGGCACGGGCGCTGG + Intergenic
1077322132 11:1947249-1947271 GGGGGGGGCGGCGCGGCCTCCGG + Intergenic
1077499309 11:2902082-2902104 CGGGCACGGGGCGAGCCCGCTGG + Intronic
1078266276 11:9758274-9758296 CAGGCGTGCGCCACGCCCGCAGG + Intergenic
1081863557 11:46347625-46347647 CCGGCCGGCGGAGGGCCCGCGGG - Intronic
1082028770 11:47590296-47590318 GGCGCGGGCGGCCCGCGCGCAGG + Exonic
1083571250 11:63763285-63763307 CCAGCGGGGGGCGCGGCCGCGGG + Exonic
1084186639 11:67476183-67476205 CGAGCGGCCGGCCCGCCCGCCGG + Intergenic
1084310447 11:68313215-68313237 CGGGGCGGCCGCGCGGCCGCTGG - Intronic
1084336601 11:68461189-68461211 CGGGCGGGGGGCGAGACTGCGGG - Intronic
1084385810 11:68841989-68842011 CGGCGGGGCGGGGCGTCCGCGGG + Intronic
1084387952 11:68855699-68855721 CGGGCCGGGGGCGGGTCCGCCGG - Intergenic
1084603418 11:70159685-70159707 AGGGCAGGGGACGCGCCCGCTGG + Intronic
1084968148 11:72755142-72755164 CGGCGGGGCGGCGGGCCCACAGG - Exonic
1085197892 11:74683376-74683398 CGGGCGGGCGCCGTGGCCTCAGG + Intergenic
1087014538 11:93542962-93542984 GGGGCGGACCGCGAGCCCGCGGG - Intronic
1089452531 11:118608050-118608072 CGGGCGGCGAGCGCGCGCGCGGG + Intronic
1090199344 11:124843206-124843228 CGGGCGGGCAGCGTTCCCGGGGG + Intergenic
1090780293 11:130001947-130001969 GGGGCGGGGGGCCGGCCCGCAGG - Intronic
1202805140 11_KI270721v1_random:2532-2554 CGGGCGGGCGGCACGGGCGCTGG + Intergenic
1202805150 11_KI270721v1_random:2562-2584 GGGGGGGGCGGCGCGGCCTCCGG + Intergenic
1091616146 12:2052747-2052769 CGCTCGGGCGGCGCTGCCGCGGG + Intronic
1091616193 12:2052902-2052924 CGGGCGGGCGGCGCGGGCAGGGG + Intronic
1091759496 12:3077529-3077551 CGGGCGGGCTGGGCACCCCCAGG + Intronic
1092256243 12:6928080-6928102 GGGGCGGGCGGCGCGGCCCGGGG + Intronic
1093958699 12:25250621-25250643 CGGGTGGGGGGCGCGGGCGCGGG - Intronic
1094199140 12:27779838-27779860 CGGGCGGGCGGAGAGGCTGCGGG + Intergenic
1095261778 12:40106077-40106099 CGGGCGGGAGGCGGGACCGCGGG + Intronic
1095753012 12:45730467-45730489 CGGGCGGGCGGCGCGGGAGCGGG - Intronic
1096116809 12:49059955-49059977 CGGGCGGCCGGGGCGCTGGCCGG - Intergenic
1096178348 12:49537927-49537949 CGGGCGGCAGCCGCGCTCGCTGG + Intergenic
1096435905 12:51591092-51591114 CGGGCAGGGGGCGCGCGCGGAGG + Intronic
1096710474 12:53452155-53452177 CGGGCGGGCGGAGGGCGGGCGGG - Exonic
1096797975 12:54090574-54090596 CGGGCGGGCGGCGGGCAGTCTGG - Intergenic
1097267547 12:57755040-57755062 CGGGCGGGCGGGGCGGGCGCCGG - Intronic
1100329461 12:93570777-93570799 AGGGCGGGCGGTGTGCACGCCGG - Intronic
1102884073 12:116508526-116508548 CGGCGGCGCGGCGGGCCCGCTGG - Intergenic
1103488189 12:121296734-121296756 CGCCCGGGCGGCGGGCGCGCGGG + Intronic
1103547538 12:121712798-121712820 AGGGCGGTCGGCGAGCGCGCGGG + Exonic
1103563259 12:121803629-121803651 CGGGCCGGAGGCGGGCGCGCGGG - Intergenic
1103595477 12:122022329-122022351 CGGGCGGGCGGCGCGCGAGCCGG + Intronic
1103800317 12:123533626-123533648 CGGGCGGCGGGCGCGGGCGCGGG + Exonic
1104842208 12:131830553-131830575 GGGGCGGGCGGCTTCCCCGCGGG + Intronic
1104847082 12:131852048-131852070 CGGGCGGGCGGGGCGCCAGCTGG + Intergenic
1104977918 12:132560414-132560436 CGGGGGTGCGGCGCGGCCGAGGG + Intronic
1105512126 13:21060607-21060629 TGAGCCGGCGGCGCGGCCGCGGG + Intronic
1106109039 13:26760816-26760838 GGCGGGGGCGGCGCGCGCGCGGG - Intergenic
1106517125 13:30465284-30465306 CGGGCGGGCGGCGGGGCGGGCGG - Intronic
1110318614 13:74135594-74135616 CGGGCGGGCGGGGCGCGCGGCGG + Intergenic
1113082330 13:106533230-106533252 CGGGCGGGCAGCGGCGCCGCGGG + Intronic
1113082333 13:106533256-106533278 CGGGCGGGCGAGGCGGTCGCGGG - Intronic
1113446415 13:110371740-110371762 AGGGCGGGCGGCGGGCCGTCTGG + Intronic
1113885835 13:113658007-113658029 CGTGCGGGGGGCGGGCCGGCTGG - Intronic
1114474087 14:22981977-22981999 CGGGTGGGCGGCGGCCCCGCGGG + Exonic
1114558508 14:23576018-23576040 AGGGCGGGCGGCGCTGCGGCCGG + Exonic
1115119972 14:29927549-29927571 GGGGCTGGCGGCGCGGCAGCAGG + Exonic
1115545547 14:34462354-34462376 CCGGCGGCCGGGGCGCGCGCGGG - Exonic
1115851190 14:37591788-37591810 GGGGCTGGCGGCGGGCCCGGGGG + Exonic
1115851836 14:37595392-37595414 GGGGCGGGAGGCGCGGCGGCCGG - Intronic
1117912658 14:60649564-60649586 CAGCCGGGCGGCGCGCTGGCTGG - Intronic
1118285320 14:64465557-64465579 CGAGGTGGCGGCGCGCTCGCGGG - Exonic
1118350950 14:64972202-64972224 CGGGCGGGCGAGGCAGCCGCGGG - Intronic
1119290474 14:73491387-73491409 CGCGCGGGCGGCGCGGAAGCGGG - Exonic
1119469025 14:74882088-74882110 CAGGGGCGCGGCGCGCCGGCCGG + Intronic
1120881316 14:89417085-89417107 AGGACGCGCGGCGCGCCCGGCGG - Intronic
1122077698 14:99246446-99246468 CGGGGGCCAGGCGCGCCCGCAGG + Intronic
1122151987 14:99730487-99730509 CGGCCGGGAGGCGCGCCGGGCGG + Intergenic
1122183402 14:99971723-99971745 GGGGCGGGGGGCGAGCCGGCTGG - Intronic
1122487096 14:102088624-102088646 TGGGCCGGGGGCGCGCCCCCAGG - Intronic
1122873097 14:104650506-104650528 GGGGGGCGCGGCGCGCCCTCTGG - Intergenic
1123004504 14:105314836-105314858 CGGGCGGGCCGGGCGCGCGGAGG - Exonic
1123035518 14:105470272-105470294 GGGGCGGGCGGCGGGCTGGCTGG - Exonic
1123735663 15:23180243-23180265 CGGGCGGGCGGCGCCTTCCCGGG + Intergenic
1124286378 15:28403226-28403248 CGGGCGGGCGGCGCCTTCCCGGG + Intergenic
1124296325 15:28508410-28508432 CGGGCGGGCGGCGCCTTCCCGGG - Intergenic
1125568439 15:40695353-40695375 CGGGCGCGTGCCACGCCCGCGGG + Intronic
1125684979 15:41558844-41558866 CGTGCCGGCGGGGCGCCGGCGGG + Intronic
1126009516 15:44289050-44289072 AGGGCAGGCGGCCAGCCCGCCGG - Exonic
1126649650 15:50908301-50908323 CGGGCGGGTGGCGCGCGCTCCGG + Intergenic
1127103077 15:55587658-55587680 CGCGCGGCCCGGGCGCCCGCTGG - Intronic
1128374451 15:67065485-67065507 GGGGCGGGCAGGGCGCCCGCGGG + Intronic
1128743663 15:70099217-70099239 CGCGCGGCCGGCTCGCGCGCGGG - Intergenic
1129082291 15:73052125-73052147 CGGGTGCGGGGCGCGCGCGCCGG - Intronic
1129424565 15:75454502-75454524 CGGGTAGGCGGGGCGCCGGCGGG - Intronic
1129780157 15:78264661-78264683 CGAGCGGGCGGCGGGGGCGCGGG + Intronic
1130224254 15:82045714-82045736 CGTGCGCGCCGCGCCCCCGCCGG + Exonic
1130261257 15:82355668-82355690 CGGATGGGGGGCGCGCCCGGCGG + Intergenic
1130279978 15:82513350-82513372 CGGATGGGGGGCGCGCCCGGCGG - Intergenic
1130370615 15:83283473-83283495 CGGGCGAGCCACGCGCTCGCAGG + Intronic
1130471353 15:84229536-84229558 CGGATGGGGGGCGCGCCCGGCGG - Intergenic
1130478847 15:84344107-84344129 CGGATGGGGGGCGCGCCCGGCGG - Intergenic
1130492923 15:84444024-84444046 CGGATGGGGGGCGCGCCCGGCGG + Intergenic
1132398121 15:101489213-101489235 CGGGCGGCCGGGGCGCCCTGCGG - Intronic
1132552784 16:560265-560287 CGCGCGGGCGGCGGGGGCGCGGG + Intergenic
1132584606 16:700764-700786 GGCGCGGGTGGCGCGCCGGCCGG - Intronic
1132641857 16:981710-981732 CGGGCGCGGGGCGGGGCCGCGGG + Intergenic
1132683615 16:1153439-1153461 CTGGCCGGCGGCGTCCCCGCGGG - Exonic
1132741342 16:1414776-1414798 CGGGCTGGGGGCGGGGCCGCGGG - Intergenic
1132746586 16:1438785-1438807 CGGGCGGGCGGCGGGCAGGTGGG - Exonic
1132889530 16:2196874-2196896 CGGGCTGGGGACGCGGCCGCCGG + Intergenic
1133156485 16:3880219-3880241 CGGGGGGGCGGCCGGGCCGCCGG - Exonic
1133219919 16:4315647-4315669 CGGGCCGGGGGCGGGGCCGCGGG + Intronic
1133219958 16:4315760-4315782 AGGGAGGGCGGCGCGGCCGCGGG - Intronic
1133311292 16:4848078-4848100 CGGGCGGGCGGCCCGCGCCTCGG - Intronic
1133311293 16:4848082-4848104 GGCGCGGGCCGCCCGCCCGCTGG + Intronic
1133784400 16:8963518-8963540 CGGGCGGGCGGCCGGCGGGCCGG + Intronic
1133784545 16:8963956-8963978 CGGGCGGGCGCCGAGCCGGAGGG + Intronic
1134070116 16:11255598-11255620 CCGGAGGGCGGCGCTCCCGGCGG + Intronic
1136037215 16:27549617-27549639 CGGGCGGGCGCAGGGCCCGGGGG - Intronic
1137267973 16:46884353-46884375 GGGCCGGGCGGCGCGGGCGCCGG + Intergenic
1137328041 16:47461251-47461273 CTGTCGGGAGGCGCGCCTGCCGG - Exonic
1137614804 16:49839737-49839759 TGGGAGGGCGGCGAGCCGGCTGG - Intronic
1139451238 16:67029377-67029399 CGGCCGGCCGGCGCGGCCTCAGG + Exonic
1139602146 16:67993409-67993431 CGGGAGGGCTGGGCGCCCCCTGG - Exonic
1140393296 16:74606796-74606818 CGGGCCGGAGGCCCACCCGCCGG + Exonic
1141608627 16:85169384-85169406 CGGGCGGCCGGCGCGGGCGCGGG - Intergenic
1141620830 16:85235777-85235799 CAGGCGGGCGAGGCGCCGGCCGG + Intergenic
1142009833 16:87708312-87708334 CTGGCGGGTGGCGCGGCTGCTGG - Intronic
1142120152 16:88383119-88383141 CGCCCGGGCCGCCCGCCCGCCGG - Intergenic
1142136344 16:88453553-88453575 CGGGGGCGCGGCGGGGCCGCGGG - Exonic
1142156260 16:88534091-88534113 CGGCCGGTCGGCGCGGCGGCGGG - Exonic
1142518735 17:490287-490309 CGGGCGGGGGGGGCGCCTGGAGG - Intergenic
1143150753 17:4806815-4806837 GGGGCGGGCGCCGAGCCCGAGGG + Intergenic
1143750046 17:9021467-9021489 GGGGCGGGGGGCGGGGCCGCCGG - Intergenic
1144021290 17:11241499-11241521 CCGGTTGGCGGCGCGGCCGCGGG - Exonic
1144340881 17:14309551-14309573 CGGGCGCGCCCCGCCCCCGCCGG + Intronic
1144565142 17:16353488-16353510 CGGGCGGCGGGGGCGCGCGCAGG - Exonic
1144586823 17:16492194-16492216 CGGGCCGGCGGCGAGCGCCCGGG - Intergenic
1145012453 17:19377732-19377754 CGGGTGGGCGGAGCCCTCGCTGG - Exonic
1146255990 17:31391795-31391817 CGGGCAGGCGGCGGGCGCGGCGG + Exonic
1146382591 17:32341940-32341962 CGGGCCGGGGGCGGGGCCGCAGG + Intronic
1147139600 17:38453816-38453838 CGGGCGGCCGGCGGGCCCCGGGG - Intronic
1147184261 17:38705210-38705232 CGGGGGGGCGGCGCGTGAGCGGG + Intergenic
1147612879 17:41811987-41812009 CGGGCGGGCGGCGCGCCCGCTGG + Exonic
1148271789 17:46267159-46267181 CGGGGCGGCGGCGCGGCGGCCGG - Intergenic
1148323698 17:46771689-46771711 CGGGGGCGCGGCCCGGCCGCGGG - Intronic
1148471547 17:47896540-47896562 CGGGAGGGCGGCGCTTCCGGGGG + Intronic
1150239931 17:63622894-63622916 GGGGCGGGCGGCCGGCCGGCCGG - Intronic
1150326656 17:64263258-64263280 CGGGCGGGCGGCAGGGCAGCAGG - Intronic
1150326679 17:64263308-64263330 CGGGCGCGGGGCGGGTCCGCCGG - Intergenic
1150358048 17:64505468-64505490 CGGCCGGGCGGCGTTCCCGCTGG + Intronic
1150561966 17:66302478-66302500 CGCGCGGGCCGGGCGCGCGCGGG - Intergenic
1150643490 17:66964687-66964709 AGTGCGGGCTGCGCGGCCGCCGG - Intergenic
1150675814 17:67245277-67245299 CGGGCGGGAGGCGCGGCCGGAGG - Intronic
1150764596 17:67993395-67993417 CGGGGCGGCGGCGCGGCGGCCGG + Intronic
1152111644 17:78360310-78360332 GGGGCTGGCGCCGCGCCCACCGG - Intergenic
1152162622 17:78678346-78678368 GGGGCGGGCGGCGCTCACGCTGG + Intronic
1152396366 17:80035921-80035943 CGGGCCGGGGGCGGGCCCGGGGG - Intergenic
1152744016 17:82031047-82031069 CGAGGGGGAGACGCGCCCGCGGG - Exonic
1153515140 18:5895364-5895386 AGGGCCGGCGGCGCGGCCGCAGG - Exonic
1153794272 18:8608904-8608926 CGGCCCGGCGGCGCGGCCTCAGG + Intergenic
1153794348 18:8609332-8609354 CGGGCGCGCGGTCCTCCCGCCGG + Intergenic
1154070791 18:11149636-11149658 GGGGCGGGCTCCGCGCGCGCAGG - Intergenic
1154303867 18:13217401-13217423 CGCGCGGGCGCCGAGGCCGCGGG - Intergenic
1154304044 18:13217969-13217991 GGGGCGCGCGGCGGGCCGGCGGG - Intronic
1155392744 18:25352376-25352398 CGGGCGGGCGGCGCGAGGGGCGG - Intergenic
1156275745 18:35581577-35581599 CGGGCAGGCGGCGCGCATGCGGG + Intronic
1157353997 18:46917134-46917156 CGGGCCGGCGGAGGGCACGCGGG - Intronic
1157492794 18:48136148-48136170 CAGGCGGGCGCAGCGGCCGCGGG - Intronic
1157529356 18:48408866-48408888 CGAGCGGGCGCCGCGCCTCCTGG - Intronic
1157529533 18:48409497-48409519 CGAGCCGGCGGCGCGGGCGCGGG - Intronic
1157794275 18:50560111-50560133 CGGGCTGTCGGGGCGACCGCGGG + Exonic
1159946292 18:74446942-74446964 CGGGCAGGCGGGGCCCACGCTGG - Exonic
1159947832 18:74457235-74457257 GGCGCGGGCGGCGGGCGCGCGGG - Exonic
1160100499 18:75916233-75916255 CGCGCGGCTGGCACGCCCGCCGG + Intergenic
1160873154 19:1286060-1286082 CGGGCGGGCGGAGGGCGGGCGGG - Intergenic
1160909429 19:1467967-1467989 CGGGCGGGCGGCGGGGCAGCTGG - Exonic
1160909898 19:1469554-1469576 CGGGCGGCGGGCGCGCGCACAGG - Exonic
1160967774 19:1754101-1754123 GGCGGGGGCGGCGCGGCCGCCGG - Exonic
1160972321 19:1775127-1775149 CGGGCGAGCGGCGGGCGGGCGGG - Intronic
1160991700 19:1862909-1862931 CGGGCCGCCGCCGCGCCGGCCGG - Intronic
1161022187 19:2015661-2015683 CGGGCGTGCGTCGTGCCCGCCGG - Exonic
1161172425 19:2819746-2819768 CGGGCGGGCGGCGTCTCCGCAGG - Intergenic
1161279007 19:3435016-3435038 GGGGCGGGGGGCGCGACGGCGGG - Intronic
1161309400 19:3585676-3585698 CGGGCGCGGGGCGCGGCCGGGGG - Exonic
1161461507 19:4400376-4400398 CGGGCGGGAGGCTCGGCGGCGGG - Exonic
1161494922 19:4581490-4581512 CGGGCGGGAGGCGCGAGGGCGGG + Intergenic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162311998 19:9913448-9913470 CGCGCGGGGGGCGCTCCCGGGGG - Intronic
1162568461 19:11457266-11457288 CGGGCGGGCGGGGAGCAGGCAGG - Intronic
1162776621 19:12983698-12983720 CGGGACGGCGGCGCGCGCGACGG - Intergenic
1162959641 19:14118162-14118184 GGGGCCGGCCGGGCGCCCGCCGG - Intergenic
1163442629 19:17329384-17329406 CGGGCAGGTGGCGAGCCCGTGGG - Intronic
1163666700 19:18606894-18606916 CGGGCGGGCGGCGGGGAGGCCGG - Intronic
1164648144 19:29873760-29873782 CGGGAGAGCGGCGCGGGCGCGGG - Intergenic
1164692682 19:30222742-30222764 CGGGAGGGCCGCGCTCCCGGTGG - Intergenic
1164834555 19:31349282-31349304 GGAGGGGGCGGCGGGCCCGCGGG + Exonic
1164834753 19:31349887-31349909 CGGGGGCGCGGCGCCCCCGCGGG - Intergenic
1165058619 19:33194411-33194433 CGGGCGGGCTGCGCGCCGCGGGG + Intronic
1165349388 19:35268097-35268119 CCGGCCGGCGGCGCGGGCGCGGG - Intergenic
1165886782 19:39084379-39084401 CGGGCAGCCGGCGCCCCCGAGGG + Exonic
1166809659 19:45507739-45507761 CGGGCGGGCGGCTCGCCCACGGG - Exonic
1166894413 19:46015121-46015143 CGGGCGCGCGGCACGCCAGGAGG + Exonic
1167040595 19:47020757-47020779 CGGGCGTGAGGCGGGCGCGCTGG + Intronic
1167466056 19:49651624-49651646 AGGCCGGGCGGCCCGGCCGCCGG - Exonic
1167628190 19:50606190-50606212 GGTGCGCGCGGCGGGCCCGCGGG + Intergenic
1168078491 19:53992930-53992952 CGGGCCGGCGGCGGGCGCACGGG + Exonic
1168246952 19:55117272-55117294 CGGGCGGGCGGCGGCGCGGCGGG + Exonic
1168307358 19:55442757-55442779 AGGGCGGGCAGCGGGCCCGCGGG + Exonic
1168318237 19:55493628-55493650 CAGGCGGCCGGCGCACCCGTGGG - Exonic
925609927 2:5693862-5693884 CTGGGGGGCGGCGCGGCGGCCGG + Exonic
925730594 2:6917507-6917529 CGTGCGGGCTGCGCGGGCGCGGG + Exonic
926090020 2:10043581-10043603 CGGGCGGGCGAGGCGCGTGCCGG + Exonic
926095896 2:10080375-10080397 CGGGCGGGGGTCGCGGCCGGAGG + Exonic
926130828 2:10302523-10302545 GGGGCGGGGGGCGCGGGCGCAGG + Intergenic
927714155 2:25341740-25341762 CGGGCGGGGGGCGCCGCGGCTGG - Intronic
927943302 2:27119020-27119042 CCGGCGGGCGGGGCGGCGGCTGG - Exonic
929604164 2:43224489-43224511 CGGACAGGCGGCGCGGCAGCTGG + Exonic
930046259 2:47175862-47175884 CGGGCGGGCGGCGCGCTGTGTGG - Intronic
930730711 2:54725028-54725050 CGGGGGGGCGGGGGGCGCGCGGG + Exonic
932728258 2:74198598-74198620 CGGGAGGGAAGCGCGCGCGCGGG - Exonic
933531620 2:83518268-83518290 CAGGCAGGCGGGGCGCCAGCTGG - Intergenic
933655102 2:84880731-84880753 CCTGCGGGCTGCGCCCCCGCGGG + Intronic
934846399 2:97663798-97663820 AGGGCGGGCGCCCCGCCCCCGGG - Intronic
935731110 2:106065607-106065629 CGGGTGGGCGCCGCGCCAGAGGG - Intronic
937325609 2:120988234-120988256 AGTGGGGGCGGCGGGCCCGCGGG + Exonic
937368860 2:121284546-121284568 GGGGCGGGCGGCGGGCTCGGAGG - Intronic
938407287 2:131039658-131039680 GGGATGGGTGGCGCGCCCGCTGG - Intronic
942178298 2:173355439-173355461 CGGGCGGGGTGCGCGCCCAAGGG - Intronic
944221757 2:197310535-197310557 CGGGCGGGACGCGCGGGCGCGGG - Intronic
944263001 2:197696258-197696280 CGGACGGGCGGCTGGCCGGCCGG + Intronic
944428072 2:199604127-199604149 CGAGCGGGCGGGGTGCGCGCCGG - Intergenic
946313986 2:218897627-218897649 CGGGCGGGCGGCGCAGGGGCGGG - Intronic
946329907 2:219003097-219003119 CGCGCGGTCTGCGCGGCCGCTGG + Intronic
947860644 2:233354894-233354916 CGGGCGGGGGGCGCGCAGGTGGG + Intronic
948736866 2:240014522-240014544 CTGGTGGGCGGCAGGCCCGCAGG + Intronic
1168814624 20:728246-728268 CAGACGGGCGGGGCGCCGGCCGG + Intergenic
1168904602 20:1393018-1393040 CGGGCGGGCGGCGCGACGGGCGG + Exonic
1169214794 20:3786663-3786685 CCGCCCGGCGACGCGCCCGCCGG - Exonic
1169367229 20:5001375-5001397 CGGGCAGGGGGCGCGGCGGCCGG + Intronic
1170890146 20:20369038-20369060 GGGGGGCGCGGCGCGGCCGCTGG + Exonic
1174287311 20:49482601-49482623 CGGCCGTGACGCGCGCCCGCGGG - Exonic
1175108838 20:56631554-56631576 CGGGCGCGGTGAGCGCCCGCAGG + Exonic
1175429499 20:58891615-58891637 CGGGCGGGCGGGCCGGGCGCGGG - Intronic
1175847528 20:62066292-62066314 CGGGCGGGCGCCGTGCGCGGTGG + Intergenic
1175975519 20:62708668-62708690 TGGGCGCGCCGCGCGGCCGCCGG + Intergenic
1175975628 20:62709064-62709086 CGACTGGACGGCGCGCCCGCTGG + Exonic
1175997154 20:62817014-62817036 GGGGCGGGCGGCGCGCGGGCGGG - Intronic
1176068878 20:63215911-63215933 CGCGGGGCCGGGGCGCCCGCCGG + Exonic
1176125275 20:63472270-63472292 CGCGCGGGCGGCGCGGGCGCCGG - Exonic
1176156927 20:63626760-63626782 CAGGCGGGCGGCGCGGGCGGTGG - Intronic
1176156985 20:63626923-63626945 CGGGGGGGCCGCGGGCTCGCCGG + Intronic
1176162165 20:63653464-63653486 CGGGCGGGAGGCGGGCGCGGCGG + Intergenic
1176178582 20:63739643-63739665 CCGGCCGGCCGCGCTCCCGCCGG - Intronic
1176194520 20:63831121-63831143 AGGGCGGGCGCCGCGGCCGCCGG + Intronic
1176194573 20:63831301-63831323 CGGGCGGGGCGCGCGCGCGCGGG - Intergenic
1176234888 20:64049561-64049583 CGGGCGGGCGGCGGGCACTGGGG + Exonic
1176550421 21:8218655-8218677 GGGGGGGGCGGCCCGCCGGCGGG - Intergenic
1176569349 21:8401693-8401715 GGGGGGGGCGGCCCGCCGGCGGG - Intergenic
1176577263 21:8445925-8445947 GGGGGGGGCGGCCCGCCGGCGGG - Intergenic
1177188065 21:17819437-17819459 GGGGAGGGTGGCGCGGCCGCGGG + Intergenic
1179511962 21:41879214-41879236 GGGGCCGGCGGGGCGCACGCCGG + Intronic
1179784060 21:43719708-43719730 CGGGCGGGCGGTGCGGCTCCCGG + Intronic
1179925501 21:44531915-44531937 TGGGCGGGAGGCGAGCCCGAAGG - Intronic
1180614775 22:17120234-17120256 CGCGCCGCCGGCGCCCCCGCGGG + Exonic
1180649872 22:17369296-17369318 GGGGCGGGGCGCGCGCCCCCGGG - Intronic
1180791486 22:18577713-18577735 CGGGCGGGGGCCGGGGCCGCGGG - Intergenic
1181017642 22:20080392-20080414 GGGGCGCGAGGGGCGCCCGCGGG + Intronic
1181230253 22:21417598-21417620 CGGGCGGGGGCCGGGGCCGCGGG + Intronic
1181248397 22:21517265-21517287 CGGGCGGGGGCCGGGGCCGCGGG - Intergenic
1181457916 22:23070242-23070264 GGGGGGTGCCGCGCGCCCGCCGG - Intronic
1181811167 22:25404828-25404850 CGGGCCGGCCGCGCGGCCGCTGG + Intronic
1181831634 22:25564886-25564908 GGGGCGCGCGGCGCGCGCGCGGG + Exonic
1182532266 22:30969476-30969498 CGGGCGCGCGCCGCGGCGGCCGG - Intergenic
1182903881 22:33920542-33920564 CGGGCGGGCGGCGCAGGCCCTGG - Intronic
1183708429 22:39488899-39488921 CGGGCGGGCGGCCTTCCCTCGGG - Exonic
1184035204 22:41914849-41914871 CGGGCGGAGGACGCGCCCACCGG - Intergenic
1184164800 22:42720840-42720862 CGGGCGGGCGGCGCGGCGGCCGG + Intronic
1185259537 22:49853866-49853888 GCGGCGGGCGGCGGGGCCGCGGG + Exonic
1185409581 22:50674768-50674790 CGGGCGCCGGGCGCGCCCGGCGG - Intergenic
1203255316 22_KI270733v1_random:134993-135015 GGGGGGGGCGGCCCGCCGGCGGG - Intergenic
949709862 3:6861156-6861178 CGCGAGCGCGGCGCGCCGGCCGG + Exonic
950583499 3:13878187-13878209 CGGGAGGGCGGCCCGCGGGCGGG + Intronic
950583508 3:13878202-13878224 CGGGCGGGCGGGGCGGCCAGGGG + Intronic
951217656 3:20040305-20040327 CGGGCGAGCGGCGCGCTAGGGGG + Exonic
953385283 3:42502668-42502690 CTGGCGGGCGGCGCACCAGGCGG - Exonic
953657034 3:44862154-44862176 CGGGCGGGCGGGGCGCCGCTGGG + Intronic
953848625 3:46448822-46448844 GGGGCGGGCGGTGGGCCCGGTGG - Intronic
954004188 3:47578752-47578774 CCGGCGGGAGGCGCGGCGGCCGG - Exonic
954093271 3:48301735-48301757 CTGGCGGGCATCGCCCCCGCCGG - Intergenic
954401263 3:50321106-50321128 CGGGCGGCCGGCGCCGCCGTGGG - Exonic
954468858 3:50674915-50674937 CGGGCGTCCTGCGAGCCCGCTGG + Intergenic
954468944 3:50675223-50675245 CGCCCGGTCGCCGCGCCCGCGGG + Exonic
954882594 3:53846031-53846053 CGGCCGGGCGGCGCTGCTGCGGG + Intronic
954912769 3:54122626-54122648 CGGGCGGTGGGCGAGCGCGCGGG - Intronic
956178911 3:66500278-66500300 CGGCCGCGCAGGGCGCCCGCGGG + Exonic
956675044 3:71725333-71725355 CCGGCGGGGGGCGCGGCGGCCGG + Exonic
960120782 3:113947645-113947667 CCTGCGGGCGGCGCGCCGGTGGG - Intergenic
965590594 3:170357516-170357538 CGCGCGCGCGGCGCCGCCGCTGG + Intergenic
968293499 3:197556060-197556082 TGGGCGGGAGGAGCGCCAGCCGG - Intronic
968454266 4:689150-689172 CGGGCGGCCGGCGGGACCGGCGG - Exonic
968513482 4:1005312-1005334 GGGGCGGGGGGTGAGCCCGCTGG + Intergenic
968651941 4:1763604-1763626 CGGGCGGGCGGGGCGCCGGGAGG + Intergenic
968674726 4:1871367-1871389 CGGGCGGGAGGCGCGGGGGCGGG + Intergenic
968698110 4:2042442-2042464 CGGGCCCGCGCCGAGCCCGCCGG + Exonic
968701276 4:2059328-2059350 CGGGCGGCCGGGGCGCGCGCAGG - Intergenic
968701331 4:2059484-2059506 CGGCCGGGCGGCGCGGCAGCGGG - Intergenic
968879857 4:3293230-3293252 CGGGCGGGCGGCGACCCCGAGGG - Intronic
969032756 4:4227283-4227305 CGGGCGGGGGCCGGGCGCGCGGG - Intergenic
969379111 4:6782810-6782832 CTGCCGGGCGGCGCGGCGGCCGG - Exonic
970202855 4:13627448-13627470 GGGGCGGGCGGCGCGGGTGCGGG - Exonic
970399404 4:15703224-15703246 CGGGCGGGGCGCGCGCGCGGTGG + Exonic
972817142 4:42657013-42657035 CGTGCGGGGGCCGCGCCCGGCGG - Exonic
973317764 4:48779787-48779809 CGGGCGCGCGGCGCTGCCGGCGG + Intronic
973954444 4:56049219-56049241 CGGGCGGGCGGCGGACTCGGCGG - Intergenic
977257642 4:94758254-94758276 AGGGCGGGCTGCGCGGCCGTGGG + Intronic
977536528 4:98261291-98261313 CGGGCGGGCGGCGGAGGCGCGGG - Intergenic
981044421 4:140252722-140252744 CGGGAAGGGGGCTCGCCCGCCGG + Intergenic
983577058 4:169271169-169271191 CGGGAGGCCGGCGCGGCGGCGGG - Intergenic
983940192 4:173529317-173529339 CGGCGGGGCTGCGCGCACGCTGG - Exonic
985512778 5:321670-321692 GGGGCGGGCGGCTCGCGTGCCGG + Intronic
985525621 5:400026-400048 CGGGCGGGCGTCGGGGCAGCTGG - Intronic
985593593 5:777858-777880 CGGAAGGGCGCCGCCCCCGCCGG - Intergenic
986330497 5:6713590-6713612 AGGGCGGGCGGCGGGGCCGAGGG - Intergenic
988722448 5:33892167-33892189 CGGGCGGGCTGCGAGGCCGCGGG - Exonic
992530120 5:77645266-77645288 CGGGCGGCGGGCGCGGCCGAGGG - Intergenic
995048156 5:107672395-107672417 CGGGCGGGCGGCGCGAGCGCGGG + Intergenic
997292362 5:132747281-132747303 CGGGTGGGCGGCGCGCACCCAGG - Intergenic
999300346 5:150486522-150486544 CGGGCGGGCGCCGGGCGGGCGGG + Intronic
1000071411 5:157743976-157743998 CGGGCTCGGGGCGCGGCCGCGGG + Exonic
1002133599 5:177095585-177095607 CTGGGGGGCGCCGGGCCCGCAGG - Exonic
1002424768 5:179168422-179168444 CGGGCAGGCCGCTCGCCCCCTGG + Intronic
1002524276 5:179806741-179806763 GGGGCGGCCGGCGCGCTCCCTGG - Intronic
1003087143 6:3068966-3068988 CGGGCGGTGGGCGGGGCCGCGGG + Intronic
1004044617 6:12012216-12012238 CGGGCGGGGGCCGCAGCCGCCGG - Intronic
1004203883 6:13574281-13574303 CGGGAGGCGGGCGCGCCGGCTGG - Intergenic
1004614961 6:17281086-17281108 CGGGCGGGGGGCGCGGCGGCGGG - Intergenic
1004627928 6:17393939-17393961 CGGGCGCGGGGCGCGGGCGCGGG + Intronic
1007383542 6:41505250-41505272 GGGGCGGGCGGCCCGCGCGGTGG + Intergenic
1007390188 6:41546353-41546375 CGAGCGGGCGGCGCGCGGGCGGG - Intergenic
1007444539 6:41895076-41895098 CGGGCGGGAGGAGCGGCGGCAGG - Intronic
1007451309 6:41941767-41941789 CGCGCGGGCGGCGGGCGGGCTGG - Exonic
1008545075 6:52577001-52577023 AGAGCGGGCGGCGGGCCGGCGGG - Intergenic
1008952108 6:57172499-57172521 AGGGCAGGCGCGGCGCCCGCGGG - Exonic
1009396974 6:63211515-63211537 CGGGCGGGCAGCGCGACGGGCGG - Exonic
1009905608 6:69867241-69867263 CTGGGGGGCGGCGCGGGCGCGGG + Intronic
1012625030 6:101393982-101394004 CGTGCGCTCGGGGCGCCCGCTGG + Intergenic
1013230562 6:108158010-108158032 CGGGGGGGCGGCGCGGCCGCGGG - Intronic
1013359578 6:109382085-109382107 CGGGCGGGCGGGCCGCGCTCGGG - Intronic
1014045255 6:116877235-116877257 CGGCCGAGCGGCGCGCGCGGAGG + Intronic
1014098182 6:117482597-117482619 CGGGCGGGAGACGCCCCCGCAGG + Intronic
1014931591 6:127343107-127343129 CGGGCCGGCTGTGCGCCGGCCGG - Intronic
1015366366 6:132401528-132401550 CGGGCGCGCGGCCGGCCCGAGGG - Exonic
1016340895 6:143060768-143060790 GGGGCGGGGCGCGCGCCCCCGGG - Intronic
1017206461 6:151808368-151808390 CCGACGGGCGGCGCGGGCGCGGG - Intronic
1018652894 6:166006130-166006152 CGGGCGGGCGGGGGGCCCGGGGG - Intergenic
1018876510 6:167826822-167826844 CGGGGCGGCGGCGCGCACGGCGG + Intergenic
1019562111 7:1664455-1664477 AGGGCGGGCGGCCGTCCCGCGGG + Intergenic
1020796801 7:12686834-12686856 CGCCCGGGCGGCGCGCGGGCAGG + Intronic
1021313230 7:19117396-19117418 CGGGCCGGCGCCGCGCGCGGGGG - Exonic
1021998332 7:26201613-26201635 GGGCCGCGCGCCGCGCCCGCTGG - Intronic
1022097107 7:27147971-27147993 CGGGCGGGCGGCGGGCGGGCGGG - Intronic
1022105356 7:27192733-27192755 CGGGCGGACGGCGCGGCCGCTGG + Intergenic
1022715124 7:32891812-32891834 CGGGCGGGCGGCGCGGCTCCCGG - Exonic
1023863829 7:44229526-44229548 CAGGTGGGTGGTGCGCCCGCAGG + Intronic
1024472150 7:49775388-49775410 CGGGCGGGGAGCGCGGCCGAGGG - Exonic
1026010040 7:66629214-66629236 CGGGCGGGCGGCGGGCCGCGGGG + Intronic
1026892782 7:73992168-73992190 CGGGCTGGCAGAGGGCCCGCTGG + Intergenic
1027232958 7:76282661-76282683 CTGGCGGGCCGCGCGCGCGGGGG - Exonic
1029449590 7:100633380-100633402 CGGGCGGGGGGCGCGCGGGGAGG - Intronic
1029449592 7:100633384-100633406 CGCGCGGGCGGGGGGCGCGCGGG - Intronic
1031051852 7:116953369-116953391 CGCGCGGGCCGCGGGCGCGCCGG - Exonic
1032087310 7:128890953-128890975 CGGGCGGGCAGGGCAGCCGCTGG + Exonic
1032159850 7:129502225-129502247 GGCGCGGGCGGCGCTCCCACTGG - Intergenic
1034468907 7:151245544-151245566 CGGGCGGGCTCCATGCCCGCGGG + Exonic
1034800480 7:154052651-154052673 CGCGCGGGAGGAGCGGCCGCCGG + Intronic
1034911715 7:155003098-155003120 CGGGCGCTCGGCGCGGGCGCGGG - Intergenic
1035537987 8:406990-407012 CAGGTGGCCGGCGCGCCCGTTGG + Exonic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1037825298 8:22156813-22156835 CGGGCGGCGGGGGCGCGCGCGGG + Exonic
1037826866 8:22165027-22165049 GGGCCGGGCCGCGCGCCAGCCGG - Exonic
1039467951 8:37797213-37797235 GGGCCGGGCTGCGCGCCGGCCGG - Intronic
1039527805 8:38231872-38231894 CGGGCGGGCGGCTGGACCGAGGG + Intronic
1039964595 8:42274775-42274797 GGGGGGGGGGGCGCGCCGGCGGG - Intronic
1042903021 8:73746938-73746960 GGGGCGCGCGGCGCGAGCGCGGG - Intronic
1045098935 8:98825869-98825891 CTGGCGGCCGGCGCGGCCGGGGG - Intronic
1045111551 8:98942071-98942093 GGGGCGGGCGGCGAGCCTGGCGG + Intronic
1046103968 8:109644947-109644969 CGGGCGGGTGGGGCGCGCCCAGG - Intronic
1047292449 8:123541680-123541702 GGGGCCGGCACCGCGCCCGCCGG + Intergenic
1047499182 8:125429402-125429424 CGGGCGGGCGGCAGGCGCGGGGG + Intergenic
1049442134 8:142614391-142614413 CGGGCCGGCGGCGGGGCCGGCGG + Exonic
1049457330 8:142700385-142700407 CGGGTGGGAGGCGCGCGCCCCGG + Exonic
1049585500 8:143430788-143430810 CGGGAGGGGCGCGCGCCCCCGGG + Intergenic
1049659917 8:143815377-143815399 CGGGTGGGCGGCGCGGGCTCCGG + Exonic
1049708172 8:144052250-144052272 GTGGCGGGCGGCGCGGGCGCGGG - Exonic
1052824840 9:33167219-33167241 CTGGCGGGCGGCCCGCGGGCGGG - Exonic
1053149168 9:35732100-35732122 CGGCGGGGCGGCGGGCCGGCGGG - Exonic
1053157566 9:35791571-35791593 GGGGCGGGCGGCCTGCCCGGGGG + Intergenic
1053697399 9:40650738-40650760 CGGGCGGGGGCCGCGGCGGCGGG + Intergenic
1054308704 9:63450184-63450206 CGGGCGGGGGCCGCGGCGGCGGG + Intergenic
1055321638 9:75088371-75088393 AGCGCGGGCGGCGCGCACGGCGG - Intergenic
1055466505 9:76571790-76571812 CGGCGGGGCGGCCCGCCGGCGGG - Intergenic
1057186334 9:93059195-93059217 CGGGCGGGTGGCGCGGGGGCGGG + Intronic
1059176710 9:112175087-112175109 CGGGCGGCCGGCGGGGCCCCCGG - Intronic
1059405835 9:114098085-114098107 AGCGCCGGCGGCGCCCCCGCGGG - Intronic
1060484952 9:124041032-124041054 CGGGCTGGGGGCGCCCCCGCAGG - Intergenic
1060555288 9:124504772-124504794 CGGGCGGGCGGCGCTGCGCCCGG - Intronic
1060700555 9:125746815-125746837 CCGGCGGGCCGCGCGCCGGGCGG - Intergenic
1060811782 9:126614399-126614421 CGGCCGGGCTGCTCGCCCGCCGG - Intergenic
1061108763 9:128552427-128552449 CGGTCGGGCGGCGAGCCGGCGGG + Intergenic
1061208506 9:129177610-129177632 GCGGCGGCCGGAGCGCCCGCGGG - Exonic
1062022740 9:134326871-134326893 CGGGCGGGCGGCGGGGCCGGGGG + Intronic
1062084682 9:134642477-134642499 GGGGGCGGCGGCGCGCCCGCGGG - Intronic
1062364723 9:136203209-136203231 CGGCCGGGGGGCGGGGCCGCGGG + Intronic
1062472477 9:136712552-136712574 CATGCGGGCCGCGCGCCCCCGGG - Exonic
1203471714 Un_GL000220v1:118130-118152 GGGGGGGGCGGCCCGCCGGCGGG - Intergenic
1185736545 X:2500640-2500662 GGGGGGGGCGGCGTGCGCGCTGG - Intronic
1185747459 X:2584172-2584194 CGGGAGGGCGGGGGGCGCGCGGG + Intergenic
1187419476 X:19122317-19122339 CCGGAGGGCGGCGGGCCAGCGGG - Intronic
1187698171 X:21941131-21941153 CGGAAGGGCGGCGCGGCCGGCGG - Intronic
1189010725 X:37043567-37043589 AGGGCGGGCAGCGCGGGCGCTGG + Intergenic
1189035678 X:37491988-37492010 AGGGCGGGCAGCGCGGGCGCTGG - Intronic
1189324946 X:40106349-40106371 CGGGCGGGGGGCGCGGGCTCGGG + Intronic
1190319637 X:49172453-49172475 CGGGCTGGCAGCGCGCCCAGGGG + Intronic
1196819569 X:119692459-119692481 CGGGCGGGCGGCGGCGGCGCCGG - Intronic
1197873543 X:131082378-131082400 CGGGAGGGCGGTGCGGGCGCGGG + Intronic
1199086244 X:143633797-143633819 CGGGCGGGCGGCGAGGAGGCTGG + Intronic
1199760122 X:150898712-150898734 CGCGCGCGCGGCGCGGCCCCGGG + Intronic
1200310336 X:155071309-155071331 CGGGCGCGCGGCTGGCGCGCGGG - Exonic
1201076786 Y:10195499-10195521 CGGGCAGGCGACGCGTGCGCCGG + Intergenic