ID: 1147620024

View in Genome Browser
Species Human (GRCh38)
Location 17:41860068-41860090
Sequence ATGTTCTCTTAAAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147620024_1147620028 29 Left 1147620024 17:41860068-41860090 CCTTCACTCTTTTAAGAGAACAT 0: 1
1: 0
2: 1
3: 21
4: 299
Right 1147620028 17:41860120-41860142 TAGAGTGGTATGGGATATAGTGG 0: 1
1: 0
2: 0
3: 16
4: 319
1147620024_1147620026 19 Left 1147620024 17:41860068-41860090 CCTTCACTCTTTTAAGAGAACAT 0: 1
1: 0
2: 1
3: 21
4: 299
Right 1147620026 17:41860110-41860132 AAAGACAAAGTAGAGTGGTATGG 0: 1
1: 0
2: 0
3: 21
4: 320
1147620024_1147620025 14 Left 1147620024 17:41860068-41860090 CCTTCACTCTTTTAAGAGAACAT 0: 1
1: 0
2: 1
3: 21
4: 299
Right 1147620025 17:41860105-41860127 AAAGCAAAGACAAAGTAGAGTGG 0: 1
1: 0
2: 2
3: 83
4: 883
1147620024_1147620027 20 Left 1147620024 17:41860068-41860090 CCTTCACTCTTTTAAGAGAACAT 0: 1
1: 0
2: 1
3: 21
4: 299
Right 1147620027 17:41860111-41860133 AAGACAAAGTAGAGTGGTATGGG 0: 1
1: 0
2: 1
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147620024 Original CRISPR ATGTTCTCTTAAAAGAGTGA AGG (reversed) Intronic
904096812 1:27985430-27985452 ATGGTGTCTTGAAAGAATGAAGG - Intronic
904504879 1:30943605-30943627 TTATTCTCTTAAAAGACTTAAGG - Intronic
906007372 1:42487550-42487572 GTGAGCTCTTAAAAGAGTCAAGG + Intronic
906232514 1:44176910-44176932 ATGTTTTCTTAAAAGTCTAAAGG - Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907386620 1:54129644-54129666 ATTTTCTCTTTTCAGAGTGAGGG - Intergenic
908188720 1:61678244-61678266 ATAGAGTCTTAAAAGAGTGAAGG + Intergenic
908343809 1:63210779-63210801 ATTTTCTTTTAAAAGAGAGGAGG + Intergenic
908933801 1:69348775-69348797 ATTATCTCTTAAAAAAGTAAAGG - Intergenic
909310613 1:74142666-74142688 ATGCTTGCTTAAAAGAGTCAGGG + Intronic
909769556 1:79403645-79403667 ATATTATTTTAAAAGACTGAGGG - Intergenic
910840529 1:91556838-91556860 ATTTTATCTTAAAGGAGTTAGGG + Intergenic
910866672 1:91794501-91794523 ATGTTTTTTTAAAAAAGTGGAGG - Intronic
911013936 1:93311782-93311804 ATGTTTTCTTAGAAGACTCATGG + Intergenic
913012722 1:114700464-114700486 ATGTTCTGTTAGAGGAGAGAGGG + Intergenic
913016454 1:114741377-114741399 AAGTTATCTTTCAAGAGTGAAGG + Intronic
913389101 1:118290672-118290694 GTGTTCTCTTAAAAGCATCATGG - Intergenic
913535936 1:119772358-119772380 ATGTCAGCTTAAAAGAGAGAAGG - Intergenic
918378307 1:183931033-183931055 ATGTTTTCTTAAGAGTTTGAAGG + Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918643520 1:186874187-186874209 ATCTTCTGTTAAAAGAGGAAAGG - Intronic
919268198 1:195302393-195302415 ATTTACTCTCAAAAGAGTCATGG - Intergenic
920529080 1:206688560-206688582 ATACTCTCTTAAAAGGGGGAGGG - Intronic
920705953 1:208250775-208250797 ATGTTCTCTTTAAGGGGTGGGGG - Intergenic
920774021 1:208918241-208918263 ATGTTGTCTCAACAGACTGAAGG - Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1064463684 10:15558699-15558721 ATTTTCTCCTAAAGGAGTGCAGG - Intronic
1067143139 10:43672936-43672958 ATGTTCTGTTAAAAGAAGTATGG + Intergenic
1068635694 10:59345725-59345747 ATTTTATCTTGGAAGAGTGAAGG + Intronic
1068907242 10:62340401-62340423 GTGTTCTCTTATAATAGGGAGGG - Intergenic
1070951481 10:80434910-80434932 ATGTCCTCTAAGAAGAGGGAGGG + Exonic
1071231061 10:83586353-83586375 GTGCTCTCTTGAAAGAGTAAAGG - Intergenic
1072145018 10:92627813-92627835 ATCTTCTCAGAAAAGACTGAGGG - Intronic
1072176407 10:92926835-92926857 ATATTTTTTTAAATGAGTGATGG + Intronic
1072963062 10:99947621-99947643 ATGTTCTCTTACACAGGTGATGG + Intronic
1073565095 10:104528132-104528154 GTCTTCTATTAAAAAAGTGAGGG - Intergenic
1073757628 10:106597735-106597757 ATGTTCTCTCAAAAGACTGGGGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079236424 11:18693967-18693989 ATGTTCTGATAACAGTGTGAGGG - Intronic
1079349864 11:19683354-19683376 GTGTTTTCTTAAAAGAGAAAAGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1085837386 11:79971620-79971642 AAGTTTTCTAAAAAGAGTAAAGG - Intergenic
1085955832 11:81393541-81393563 ATATTCTCATGAAAGAATGAGGG + Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087278982 11:96188977-96188999 TTGTTCAGTTAAAAGAGTAATGG - Intronic
1087897500 11:103602982-103603004 AAGTAATCTTAGAAGAGTGAAGG - Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088157558 11:106827037-106827059 ATGGTCTCTTGGAAAAGTGAAGG + Intronic
1090094781 11:123731765-123731787 ATCTTTGCTTAGAAGAGTGATGG + Intronic
1090104580 11:123838786-123838808 AAGCTCTCTAAAAAGAGTGTAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090519995 11:127468692-127468714 ATTTTTTCTTGAAAGAATGATGG - Intergenic
1091083384 11:132694632-132694654 AGGTTCTCTTAGAAGAAAGAAGG - Intronic
1093071822 12:14713860-14713882 ATTTGCTCTTAAAAGAAGGATGG + Intergenic
1093635444 12:21461110-21461132 ATGGTCTCTTGGAAAAGTGAAGG - Exonic
1093708301 12:22299895-22299917 ATGTTTTCTTAAAGGTCTGAAGG + Intronic
1094150231 12:27274700-27274722 ATGTTATCTTGAAAGACAGAGGG + Intronic
1095267102 12:40173476-40173498 ATCAACTCTTAAAAGATTGAAGG + Intergenic
1095374772 12:41513445-41513467 TTGTTCTCTTTAAAAAATGATGG + Intronic
1095996504 12:48091053-48091075 ATGTTCTAATGATAGAGTGATGG + Intronic
1096645433 12:53031624-53031646 ATTTTATCTTACAAAAGTGACGG + Intronic
1096902092 12:54894206-54894228 ATTGTCTCTTAAATAAGTGAAGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097458959 12:59835952-59835974 ATGTTCACCTACAATAGTGAGGG + Intergenic
1098791025 12:74822136-74822158 ATTTTCTTTTAAAAAAGTGATGG + Intergenic
1099109966 12:78546551-78546573 ATTTGCTCTTAATATAGTGAAGG + Intergenic
1099938427 12:89156124-89156146 ATTTTCTTTTTAAAGAGTGCTGG - Intergenic
1100898069 12:99206991-99207013 ATGGACTCTTAGAAGAATGATGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101599263 12:106194624-106194646 AAGCTCTCTTAACAGAGTTAAGG + Intergenic
1103418883 12:120763813-120763835 TTTTTTTCTTAAAGGAGTGAGGG + Exonic
1104371044 12:128224246-128224268 TTGTTCTCTTCAAGGAGGGAAGG - Intergenic
1104603581 12:130170727-130170749 ATGTTTTATTAAGAGTGTGAAGG + Intergenic
1105471262 13:20697072-20697094 ATGTACAATTAAAAGAGTAATGG + Intergenic
1106211291 13:27649676-27649698 ATTTTCTCTTAAAAAAGAGAGGG + Intronic
1106351831 13:28937907-28937929 CTCTTCTTTTAAAGGAGTGAGGG - Intronic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1106740856 13:32639386-32639408 TTGTTCTGGTAAAACAGTGACGG - Intronic
1107137846 13:36964141-36964163 ATATTATCTTTAGAGAGTGAGGG + Intronic
1110050158 13:70886918-70886940 ATGTCCTTTTAATAGAATGAAGG - Intergenic
1110216745 13:73032240-73032262 CTTTTTTTTTAAAAGAGTGATGG + Intergenic
1111086049 13:83375942-83375964 ATGTTTTCTTATAATAATGAGGG + Intergenic
1111696975 13:91637322-91637344 CTCTTCCCCTAAAAGAGTGAGGG + Intronic
1111744229 13:92245731-92245753 ATTTTCTCTTAAAATAATGTTGG + Intronic
1114347080 14:21807735-21807757 ATTTTCTTTTAAAAGGTTGAGGG + Intergenic
1114902291 14:27078336-27078358 GTAATCTCTTAATAGAGTGAAGG - Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115614519 14:35081463-35081485 ATGATCTTTTAAAAAAGTTAAGG + Exonic
1118485312 14:66209096-66209118 CTGGTCTCTTATAATAGTGATGG + Intergenic
1120838265 14:89060485-89060507 ATGTATTCTTAGAAGAGGGAGGG - Intergenic
1121134355 14:91481637-91481659 ATGTTTTCTTCAAAGACCGAAGG + Exonic
1125089539 15:35774181-35774203 ATGTTCTCTTTAAAAAGTGGTGG + Intergenic
1126640861 15:50825368-50825390 ATGCTCTCCTTAAAGACTGAAGG - Intergenic
1127600164 15:60527683-60527705 TTGTTCTCTTGAAAGAATCAGGG - Intronic
1129441512 15:75584306-75584328 TTGTCCTGTTAAAACAGTGATGG - Intergenic
1130523239 15:84680826-84680848 ATTTTGCCTTAAAAGAGTAAAGG + Exonic
1138250210 16:55496398-55496420 ATGCTGTCTTAAAAGATTGTGGG + Intronic
1138833762 16:60408439-60408461 AGATTCTCTTTGAAGAGTGAGGG + Intergenic
1140225156 16:73071069-73071091 AGGTGTTTTTAAAAGAGTGAGGG - Intergenic
1141355545 16:83342448-83342470 ATGGTCTCTAAAAACAGTGAAGG - Intronic
1141455751 16:84140755-84140777 CTGTTTTGTTAAAAGAGTCAGGG - Intronic
1144122693 17:12171296-12171318 AAGTTATCTTTTAAGAGTGAGGG - Intergenic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1147293943 17:39466001-39466023 ATGTTCTCTTAAGAGAGTAGAGG + Intronic
1147529104 17:41257081-41257103 ATGTTCTCACATAAGAGTGGGGG - Intergenic
1147620024 17:41860068-41860090 ATGTTCTCTTAAAAGAGTGAAGG - Intronic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1150172748 17:63017033-63017055 ATGTTTTCTTCTAAGAGTTATGG + Intronic
1150889181 17:69126109-69126131 ATGTTGTCTTCAAATAATGATGG - Intronic
1153080522 18:1218313-1218335 ATGTTCACAGAAAAGAGAGATGG - Intergenic
1153105978 18:1527414-1527436 ATGTTTTCTTAGAGTAGTGATGG + Intergenic
1154406877 18:14100419-14100441 ATATGTTCTTGAAAGAGTGAAGG + Intronic
1155191982 18:23438291-23438313 ATGTTCACTTAAAAGAGGGAAGG + Intergenic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1155952606 18:31929518-31929540 ATGTTTTTTTAAAAGAGACAAGG - Intronic
1156713299 18:39975071-39975093 ATGTTCTCTGAATAGATTCAGGG - Intergenic
1159628656 18:70724089-70724111 ATGGTGACTTAAAAGAGTGTGGG - Intergenic
1160353432 18:78205383-78205405 ATGTTCTCTAAGAAGATGGAAGG + Intergenic
1165584929 19:36906266-36906288 AGGTACTATTAAAAGAGTAAAGG + Intronic
1168373745 19:55858364-55858386 ACTTTCTCTTACAAGATTGAAGG - Exonic
925827845 2:7867534-7867556 AAGTTTTCTTTGAAGAGTGAAGG - Intergenic
925949121 2:8894534-8894556 GTGTTCTCTGAAATGAGTCATGG - Intronic
926258818 2:11237320-11237342 ATGTTCTCTGAACACACTGAAGG + Intronic
926286724 2:11494494-11494516 TTGTTCTCGTAAGAGACTGATGG + Intergenic
926420841 2:12696593-12696615 AAGTTCTAATAAAAGATTGAAGG + Intergenic
927352949 2:22140070-22140092 ATTTTCTCTGAAAACAATGATGG + Intergenic
928446158 2:31335268-31335290 ATATTCTCTTCAAAGAGGAAGGG + Exonic
928505001 2:31942039-31942061 ATTTTTTCTGAGAAGAGTGAAGG - Intronic
928908517 2:36394182-36394204 ATTTCCTCTTAAAACTGTGAAGG + Intronic
929197822 2:39204734-39204756 AAGTTCTTTTAGAAAAGTGAAGG - Intronic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
930502553 2:52240227-52240249 ATGTTCTATGAAAACAGTGTAGG + Intergenic
931061427 2:58533813-58533835 ATGTGCTTTTGACAGAGTGATGG + Intergenic
931480233 2:62632344-62632366 ATGTTATTTTAAAAGATTAAGGG - Intergenic
932017971 2:68052272-68052294 ATTTTCTCTGAAAAGAGACAAGG + Intronic
936282713 2:111156568-111156590 ATGTTCTCCCAAAAGTCTGAGGG - Intronic
939456368 2:142442209-142442231 ATTTTCTCTTAAAGGAGAAAAGG + Intergenic
939842254 2:147203836-147203858 ATGTTCTGTCAAAAGAGAGGAGG - Intergenic
940732278 2:157406478-157406500 ATGTTCTCTTAAATTTGTTAAGG + Intergenic
943868461 2:192959773-192959795 CTGTTTTCTTAAAATAGAGATGG + Intergenic
944077667 2:195750514-195750536 AAGTTTTCTTAAAGGAGTTATGG - Intronic
944311659 2:198240340-198240362 ATTTTCCCTCAAAAGAGTGAGGG + Intronic
945134870 2:206616292-206616314 ATGTTGACTTAAAAGAGGGCTGG + Intronic
946715253 2:222547678-222547700 ATGTTCTCTTTAAATGGTGCTGG - Intronic
947746484 2:232510454-232510476 ATTTTCTCTTAAATGAGACAGGG - Intergenic
947785228 2:232812254-232812276 AAGTTTTAGTAAAAGAGTGAAGG + Intronic
948241542 2:236441197-236441219 ATGTTCATTTAAATGAGTGATGG + Intronic
948760703 2:240189106-240189128 ATGATTTCTTAAAAGAGAAATGG + Intergenic
1169389827 20:5180779-5180801 GGGTTCTCTTATAAAAGTGATGG - Intronic
1171751724 20:29057921-29057943 ACGTTCACTCCAAAGAGTGAGGG + Intergenic
1171790604 20:29519946-29519968 AAGTTCACTCCAAAGAGTGAGGG - Intergenic
1171857103 20:30356889-30356911 AAGTTCACTCCAAAGAGTGAGGG + Intergenic
1172295862 20:33810937-33810959 AAGTTGTCTTAAAAGCGTGAAGG - Intergenic
1172532865 20:35645615-35645637 AAGTTGTCTTAAAAGCTTGAAGG + Intronic
1173393047 20:42652304-42652326 AGGTTCTGTTAAATGAATGAAGG - Intronic
1173857486 20:46259813-46259835 ATGGTGTATAAAAAGAGTGATGG + Intronic
1175321040 20:58088582-58088604 TTTTTCTGTTAAAGGAGTGATGG + Intergenic
1175734189 20:61373917-61373939 CTGTTCTCTTCAGAAAGTGATGG + Intronic
1177027900 21:15944136-15944158 AAGTTTTCTGAAAAGAGAGAAGG - Intergenic
1177127522 21:17214414-17214436 ATTTTGTCTTAAAAATGTGAGGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1181326280 22:22050044-22050066 AGGTACTCTTAAAAAAGTGTAGG + Intergenic
1182898564 22:33878855-33878877 ATATGGTTTTAAAAGAGTGAGGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
953528581 3:43716585-43716607 AGGTTCTCTGCCAAGAGTGAGGG + Intronic
955794226 3:62618770-62618792 ATGTTCTATTAAAAGCCTGAAGG - Intronic
956216628 3:66856145-66856167 ATATTCTCTGTAAAGAGTCATGG - Intergenic
956377522 3:68631571-68631593 ATGTTTTGCTAAGAGAGTGAGGG - Intergenic
957721356 3:84004309-84004331 ATCTTCTCTTGAAAGATTGTTGG - Intergenic
958650728 3:96932347-96932369 ATTTTCTCCCAAAAGAGTAAAGG - Intronic
959389168 3:105752540-105752562 ATGTTATCTTATAAGAGGGACGG - Intronic
960007139 3:112791689-112791711 AATTTCTCTTAGAAGAGTGTTGG - Intronic
960426943 3:117520431-117520453 ATTTTCTCTTTAAGGAGGGAAGG - Intergenic
960876531 3:122301063-122301085 AAGTTTTCTTGACAGAGTGATGG - Intergenic
961952746 3:130767292-130767314 ATGTTATATTAACAGAATGAAGG + Intergenic
962028663 3:131575278-131575300 TTGTTCTGTTAAAGGAGAGAAGG + Intronic
962490563 3:135889819-135889841 CATTTCTCTTAGAAGAGTGAGGG - Intergenic
963095873 3:141539467-141539489 AAGTCCCCTTAAAATAGTGAGGG + Intronic
963223281 3:142834155-142834177 GTGTGGTTTTAAAAGAGTGATGG - Intronic
963465752 3:145679301-145679323 ATTTTCTCTTAGAACATTGAAGG - Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966694042 3:182771084-182771106 ATGATCTCTCACAAGAGGGATGG + Intergenic
967619184 3:191611632-191611654 ATGTTCTCTTCAAAGAATGCAGG - Intergenic
968043330 3:195607359-195607381 ATGTTTTCTTAAAAGTCTAAAGG + Intergenic
969419674 4:7085032-7085054 AGGTTCTCTTATAAAAGGGAGGG - Intergenic
971630296 4:28983872-28983894 ATGTTCACTTATAAAGGTGAAGG + Intergenic
971969378 4:33601892-33601914 AAGTTCTCTGAAAAGAGTTTGGG - Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
974162648 4:58159910-58159932 ATGTTGTTTTAAAACAGTAAAGG + Intergenic
975464753 4:74696836-74696858 GTGATCTCTTCAAAGAGTGTAGG - Intergenic
977284973 4:95092404-95092426 TTGTTCTCTTAAAACTATGATGG + Intronic
977603285 4:98957003-98957025 ATGATCTTTTAAAAAAGTTAAGG + Intergenic
977970172 4:103203720-103203742 ATGTTCTAATAAAAAAGAGATGG + Intergenic
978721961 4:111920920-111920942 ATGTTCCAATAACAGAGTGATGG - Intergenic
980038891 4:127916248-127916270 ATTTTCTCTTAAAAGAATACTGG - Intergenic
980922460 4:139100649-139100671 ATGTTTTTTTTAAAGAGTTATGG - Intronic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981662400 4:147183416-147183438 ATTTTCTATTAAAGGAGGGAGGG - Intergenic
982062731 4:151621007-151621029 ATGTTCTCTTAGGATAGTGCAGG - Intronic
982530136 4:156530574-156530596 ATGTTATCTTAAAAGGAAGAGGG + Intergenic
982552238 4:156817620-156817642 CTTTTTTCTTAAAAGAGAGAGGG - Intronic
985100733 4:186455876-186455898 ATGTTCTAAGAAAAGAGAGAGGG - Intronic
987523497 5:19018113-19018135 AAGCTCACATAAAAGAGTGATGG + Intergenic
988213275 5:28236697-28236719 ATATTCTGTTAAAAAAGTAAAGG + Intergenic
988266938 5:28963441-28963463 ATCTTTTCTCATAAGAGTGATGG - Intergenic
988785796 5:34564543-34564565 ATTTTCTCTAAGCAGAGTGATGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989513706 5:42317884-42317906 ATGTTAACTAAAAAGAGAGAAGG - Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990017408 5:51081906-51081928 ATTTTCTCTAAAAATAGTGTTGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991389935 5:66131833-66131855 ATTTTCTATTCAAAGATTGAGGG + Intergenic
992660776 5:78958574-78958596 ATATTCTTTTATAAAAGTGATGG - Intronic
994145562 5:96391158-96391180 ATGTTCTCCTAAAAGACTTGCGG - Exonic
995079552 5:108032739-108032761 ATTTTCTCTCACAATAGTGAAGG - Intronic
995621404 5:114029992-114030014 ATTTTGTGTTAAAAGAGAGATGG + Intergenic
996409506 5:123143005-123143027 AGGTTCTCTTCAAAGGTTGATGG - Intronic
996621681 5:125512501-125512523 ATGGGCTTTTAAATGAGTGATGG - Intergenic
998805966 5:145918201-145918223 AAGTTCTGTTAAAGGAGTTAGGG - Intergenic
1000950569 5:167477013-167477035 ATGTTCCATAAAAAAAGTGATGG + Intronic
1001072533 5:168599461-168599483 CTGTTCTCTTAAATCAGGGATGG + Intergenic
1002030709 5:176427735-176427757 ATGTTTTCTTAAAGGTGTAAAGG - Intergenic
1003705631 6:8525498-8525520 ATAGTTTCTTAAAAGAGTGAAGG + Intergenic
1003862652 6:10336606-10336628 ATGCTCCCTTGAAAGACTGAAGG - Intergenic
1003925734 6:10876208-10876230 TAGTTCTTTTAATAGAGTGAAGG - Intronic
1008255139 6:49289722-49289744 ATGCTCTCTTGAAAGAGGGAAGG - Intergenic
1009650929 6:66477482-66477504 ACGTCCTCTTGAAAAAGTGACGG - Intergenic
1010578258 6:77561259-77561281 CTATTATCTTAAAAGACTGAGGG - Intergenic
1011025550 6:82865352-82865374 ATGTTCTGTTAGAAAAATGAAGG - Intergenic
1011285909 6:85722645-85722667 ATTTTGTCTTAAAATAGGGATGG - Intergenic
1011617239 6:89208390-89208412 ATGTTCTCTAAAATGTGTGATGG + Intronic
1012420989 6:99064883-99064905 ATCTTCTTTTAAATTAGTGAAGG - Intergenic
1012700834 6:102454509-102454531 AGCTTCTCTTAAAAGAATGGTGG + Intergenic
1013755529 6:113457229-113457251 TTGTTTTCTTAAAAGAAGGATGG + Intergenic
1013859319 6:114615745-114615767 ATGCTATTTTTAAAGAGTGATGG + Intergenic
1014179111 6:118365532-118365554 ATGCTCTCTGCAAAGATTGAGGG + Intergenic
1016594332 6:145782420-145782442 AAGTAATTTTAAAAGAGTGAAGG + Intergenic
1016708450 6:147141569-147141591 ATTTTCTTTTAAAAGTGTGAAGG + Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1021099357 7:16570993-16571015 CTGTTCTCTTCAAAAAGTCATGG - Intronic
1023097769 7:36680031-36680053 ATGTAGTCTTAAAAGAAAGAAGG - Intronic
1027753173 7:82177698-82177720 ATGGTCTCTTGATGGAGTGAAGG - Intronic
1028647653 7:93116310-93116332 AGGTTCTCATATAAGAGTGTGGG + Intronic
1029128712 7:98313502-98313524 ATCTTCTCTTCCCAGAGTGAGGG - Intronic
1029801172 7:102949010-102949032 ATGTTATCTTAAAATATTTAAGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030067707 7:105673134-105673156 ATTTTATCTTCAGAGAGTGAGGG - Intronic
1030292145 7:107883476-107883498 TTTTTTTCTTAAAGGAGTGAGGG + Intergenic
1030531501 7:110716750-110716772 GTGAACTCTGAAAAGAGTGAAGG + Intronic
1031305387 7:120119664-120119686 ATGTCCTTCTAAAAGAATGAAGG - Intergenic
1031312935 7:120221617-120221639 GTTTTCTCTTTAAAGTGTGAAGG - Intergenic
1031526636 7:122829369-122829391 ATGTTTCCTTCAAAGTGTGAAGG - Intronic
1031818384 7:126469353-126469375 CAGTTTTCATAAAAGAGTGAGGG - Intronic
1031895153 7:127339918-127339940 ATGGTCTATTCAAAGACTGAAGG + Intergenic
1032382660 7:131501292-131501314 ATGTTCACTTAAAGCAGTGCAGG + Intronic
1035062984 7:156082708-156082730 CTGTTAACTTAGAAGAGTGAAGG + Intergenic
1037196613 8:16198572-16198594 ATGTTCTATTAAAGGAGTCCGGG - Intronic
1037491513 8:19400889-19400911 ATGTTACATTGAAAGAGTGATGG - Intergenic
1039586756 8:38713415-38713437 ATGAACTCTTAACAGAGTGCAGG - Intergenic
1039593015 8:38766474-38766496 ATGTTCTCATAAAAACCTGACGG + Intronic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1041127893 8:54663828-54663850 TTGTCCTCTTAAAAAATTGAAGG - Intergenic
1042310937 8:67378995-67379017 ATGTTATCTTAAAAGATAGGTGG + Intergenic
1043784025 8:84374140-84374162 ATGTCATCTGCAAAGAGTGATGG + Intronic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1044738787 8:95304638-95304660 ATTTTCTCTGAAGAGAGTTATGG - Intergenic
1045457116 8:102391685-102391707 ATGTTTTCTTATAAAAGGGAGGG + Intronic
1045721628 8:105118199-105118221 CTGTTCTTTTATCAGAGTGAAGG - Intronic
1045836569 8:106528310-106528332 ATATTCTCTTAAAATTGTGATGG + Intronic
1045900426 8:107272867-107272889 ATGTATTCTTAAAAAAGGGAAGG - Intronic
1047448549 8:124941868-124941890 ATGGTGCCATAAAAGAGTGAAGG - Intergenic
1050214795 9:3310449-3310471 ATCTTTTGTTAAAAGAGTAAAGG + Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050723991 9:8625300-8625322 ATGTGCTCATAAAAACGTGATGG - Intronic
1050982178 9:12034670-12034692 ATCTTCTCCAAAAACAGTGATGG + Intergenic
1053550158 9:39069239-39069261 ATGTTTTCTCAAAGCAGTGAAGG + Intergenic
1053723201 9:40970410-40970432 AAGTTCACTTCAAAGAGTGAGGG + Intergenic
1054342764 9:63881583-63881605 AAGTTCACTCCAAAGAGTGAGGG - Intergenic
1055085001 9:72304963-72304985 TTCTTCTCTTAAAAGAGAGTGGG - Intergenic
1055639745 9:78310467-78310489 AAGTTCTCTTAAAGGAGCGTAGG + Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056077849 9:83059864-83059886 ATTTTCTCTTAGAAAATTGAGGG - Intronic
1056079935 9:83081651-83081673 ATGTTCTATTCTAAAAGTGATGG - Intergenic
1056399939 9:86216784-86216806 ATGCTATTTTAAAAGAGAGAAGG + Intergenic
1057467313 9:95326858-95326880 ATGTTTTCTTAAAGGTGTAAGGG - Intergenic
1057504791 9:95625377-95625399 ATGTCATCTTAAAACTGTGAGGG + Intergenic
1057927119 9:99162573-99162595 ATGTTCTGTGAAAACAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1058479220 9:105373792-105373814 AGGTTCTCTTGAAGGTGTGAGGG - Intronic
1058551504 9:106120208-106120230 ATGATCTCTTGAACAAGTGAAGG + Intergenic
1059532661 9:115050597-115050619 AAGTTCTCTTAAAAACGAGAGGG + Intronic
1060161053 9:121364805-121364827 ATGTTGTTTTAAAAGGGTAAAGG - Intronic
1185747682 X:2584912-2584934 ATATTCTCATCAAAGAATGAAGG + Intergenic
1186180604 X:6969238-6969260 ATCTGCTCTTAAAATAGTCATGG + Intergenic
1186881236 X:13868462-13868484 ATGTTCTATTAGCAGAGTTATGG - Intronic
1188423513 X:30017781-30017803 AAGTTCTCCAAAAAGAATGATGG + Intergenic
1188528968 X:31116651-31116673 TTGTACTCTTAAAAATGTGAAGG + Intronic
1189800667 X:44689322-44689344 TTTTTCTCTTCAAAGATTGAAGG - Intergenic
1190468977 X:50756954-50756976 ATGGTATCTTTAAAGTGTGAAGG + Intronic
1190823117 X:53993054-53993076 ATGTTCCCTTAAAAAAGAGGGGG + Intronic
1192542261 X:71984073-71984095 GGGTTCTCTTATAAAAGTGAGGG - Intergenic
1192625616 X:72724740-72724762 ATGTTCTCTTAATAGAGGTCTGG - Intergenic
1192888850 X:75366616-75366638 ATGTTCTCTTATAAAAAGGAGGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1193512784 X:82426243-82426265 ATTTTCACTTATAAGTGTGAGGG - Intergenic
1194382215 X:93208214-93208236 ATGTTCTCTTTAAATGGTGCTGG + Intergenic
1194564113 X:95461855-95461877 ATATTTTCTTAGAAGAGTCATGG + Intergenic
1195137258 X:101921366-101921388 ATGCTGTCTTAAAATATTGAAGG - Intronic
1196366297 X:114927970-114927992 ATTTTGTCTTAAAATAATGAAGG - Intergenic
1196772933 X:119313368-119313390 ATGTTTTCTTAAAAGTCTAAAGG + Intergenic
1196967936 X:121078558-121078580 ATGCACTTTTAAAATAGTGAAGG + Intergenic
1198497885 X:137212060-137212082 ATATTCTCTTAATAAAATGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198577264 X:138024268-138024290 ATGTTCTGATAAAAGAGGCAAGG - Intergenic
1198844463 X:140895581-140895603 GTGTTCTCTTATAAAAGGGAGGG - Intergenic
1199181534 X:144861205-144861227 ATTTTCTCTGAAAACTGTGAAGG + Intergenic
1200384517 X:155876687-155876709 ATCTTCTCTTAAAATTTTGATGG - Intergenic
1201681581 Y:16650920-16650942 ATGTTCTTTTATAATAGTAAAGG + Intergenic
1201721555 Y:17103914-17103936 ATCTGTTCTTAAAAGGGTGATGG + Intergenic