ID: 1147623162

View in Genome Browser
Species Human (GRCh38)
Location 17:41881684-41881706
Sequence GAGAATTGCTTGAACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551389
Summary {0: 20147, 1: 62565, 2: 132669, 3: 180845, 4: 155163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623162_1147623171 30 Left 1147623162 17:41881684-41881706 CCTCCCAGGTTCAAGCAATTCTC 0: 20147
1: 62565
2: 132669
3: 180845
4: 155163
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623162_1147623166 2 Left 1147623162 17:41881684-41881706 CCTCCCAGGTTCAAGCAATTCTC 0: 20147
1: 62565
2: 132669
3: 180845
4: 155163
Right 1147623166 17:41881709-41881731 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623162 Original CRISPR GAGAATTGCTTGAACCTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr