ID: 1147623163

View in Genome Browser
Species Human (GRCh38)
Location 17:41881687-41881709
Sequence CAGGAGAATTGCTTGAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 612359
Summary {0: 18481, 1: 76818, 2: 153804, 3: 212009, 4: 151247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623163_1147623166 -1 Left 1147623163 17:41881687-41881709 CCCAGGTTCAAGCAATTCTCCTG 0: 18481
1: 76818
2: 153804
3: 212009
4: 151247
Right 1147623166 17:41881709-41881731 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1147623163_1147623171 27 Left 1147623163 17:41881687-41881709 CCCAGGTTCAAGCAATTCTCCTG 0: 18481
1: 76818
2: 153804
3: 212009
4: 151247
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623163 Original CRISPR CAGGAGAATTGCTTGAACCT GGG (reversed) Intronic
Too many off-targets to display for this crispr