ID: 1147623164

View in Genome Browser
Species Human (GRCh38)
Location 17:41881688-41881710
Sequence GCAGGAGAATTGCTTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425396
Summary {0: 30902, 1: 81215, 2: 152545, 3: 104312, 4: 56422}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623164_1147623171 26 Left 1147623164 17:41881688-41881710 CCAGGTTCAAGCAATTCTCCTGC 0: 30902
1: 81215
2: 152545
3: 104312
4: 56422
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623164_1147623166 -2 Left 1147623164 17:41881688-41881710 CCAGGTTCAAGCAATTCTCCTGC 0: 30902
1: 81215
2: 152545
3: 104312
4: 56422
Right 1147623166 17:41881709-41881731 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623164 Original CRISPR GCAGGAGAATTGCTTGAACC TGG (reversed) Intronic
Too many off-targets to display for this crispr