ID: 1147623165

View in Genome Browser
Species Human (GRCh38)
Location 17:41881706-41881728
Sequence GCTACTCGGGAGGCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793706
Summary {0: 87862, 1: 235715, 2: 200111, 3: 128617, 4: 141401}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623165_1147623171 8 Left 1147623165 17:41881706-41881728 CCTGCCTCAGCCTCCCGAGTAGC 0: 87862
1: 235715
2: 200111
3: 128617
4: 141401
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623165_1147623177 27 Left 1147623165 17:41881706-41881728 CCTGCCTCAGCCTCCCGAGTAGC 0: 87862
1: 235715
2: 200111
3: 128617
4: 141401
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623165 Original CRISPR GCTACTCGGGAGGCTGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr