ID: 1147623165 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:41881706-41881728 |
| Sequence | GCTACTCGGGAGGCTGAGGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 793706 | |||
| Summary | {0: 87862, 1: 235715, 2: 200111, 3: 128617, 4: 141401} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1147623165_1147623171 | 8 | Left | 1147623165 | 17:41881706-41881728 | CCTGCCTCAGCCTCCCGAGTAGC | 0: 87862 1: 235715 2: 200111 3: 128617 4: 141401 |
||
| Right | 1147623171 | 17:41881737-41881759 | TATGCCCCTGCCACCACGTCTGG | 0: 1 1: 0 2: 24 3: 979 4: 12077 |
||||
| 1147623165_1147623177 | 27 | Left | 1147623165 | 17:41881706-41881728 | CCTGCCTCAGCCTCCCGAGTAGC | 0: 87862 1: 235715 2: 200111 3: 128617 4: 141401 |
||
| Right | 1147623177 | 17:41881756-41881778 | CTGGCTACACAGATCTACCAAGG | 0: 1 1: 0 2: 0 3: 8 4: 96 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1147623165 | Original CRISPR | GCTACTCGGGAGGCTGAGGC AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||