ID: 1147623167

View in Genome Browser
Species Human (GRCh38)
Location 17:41881710-41881732
Sequence GCCAGCTACTCGGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 747625
Summary {0: 677, 1: 105064, 2: 291600, 3: 225942, 4: 124342}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623167_1147623177 23 Left 1147623167 17:41881710-41881732 CCTCAGCCTCCCGAGTAGCTGGC 0: 677
1: 105064
2: 291600
3: 225942
4: 124342
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623167_1147623171 4 Left 1147623167 17:41881710-41881732 CCTCAGCCTCCCGAGTAGCTGGC 0: 677
1: 105064
2: 291600
3: 225942
4: 124342
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623167 Original CRISPR GCCAGCTACTCGGGAGGCTG AGG (reversed) Intronic
Too many off-targets to display for this crispr