ID: 1147623167 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:41881710-41881732 |
| Sequence | GCCAGCTACTCGGGAGGCTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 747625 | |||
| Summary | {0: 677, 1: 105064, 2: 291600, 3: 225942, 4: 124342} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1147623167_1147623177 | 23 | Left | 1147623167 | 17:41881710-41881732 | CCTCAGCCTCCCGAGTAGCTGGC | 0: 677 1: 105064 2: 291600 3: 225942 4: 124342 |
||
| Right | 1147623177 | 17:41881756-41881778 | CTGGCTACACAGATCTACCAAGG | 0: 1 1: 0 2: 0 3: 8 4: 96 |
||||
| 1147623167_1147623171 | 4 | Left | 1147623167 | 17:41881710-41881732 | CCTCAGCCTCCCGAGTAGCTGGC | 0: 677 1: 105064 2: 291600 3: 225942 4: 124342 |
||
| Right | 1147623171 | 17:41881737-41881759 | TATGCCCCTGCCACCACGTCTGG | 0: 1 1: 0 2: 24 3: 979 4: 12077 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1147623167 | Original CRISPR | GCCAGCTACTCGGGAGGCTG AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||