ID: 1147623168

View in Genome Browser
Species Human (GRCh38)
Location 17:41881716-41881738
Sequence TATAATGCCAGCTACTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569034
Summary {0: 22, 1: 4198, 2: 66352, 3: 238283, 4: 260179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623168_1147623171 -2 Left 1147623168 17:41881716-41881738 CCTCCCGAGTAGCTGGCATTATA 0: 22
1: 4198
2: 66352
3: 238283
4: 260179
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623168_1147623177 17 Left 1147623168 17:41881716-41881738 CCTCCCGAGTAGCTGGCATTATA 0: 22
1: 4198
2: 66352
3: 238283
4: 260179
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623168 Original CRISPR TATAATGCCAGCTACTCGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr