ID: 1147623169

View in Genome Browser
Species Human (GRCh38)
Location 17:41881719-41881741
Sequence GCATATAATGCCAGCTACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346054
Summary {0: 1, 1: 88, 2: 8468, 3: 102120, 4: 235377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623169_1147623171 -5 Left 1147623169 17:41881719-41881741 CCCGAGTAGCTGGCATTATATGC 0: 1
1: 88
2: 8468
3: 102120
4: 235377
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623169_1147623177 14 Left 1147623169 17:41881719-41881741 CCCGAGTAGCTGGCATTATATGC 0: 1
1: 88
2: 8468
3: 102120
4: 235377
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623169 Original CRISPR GCATATAATGCCAGCTACTC GGG (reversed) Intronic
Too many off-targets to display for this crispr