ID: 1147623170

View in Genome Browser
Species Human (GRCh38)
Location 17:41881720-41881742
Sequence GGCATATAATGCCAGCTACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113464
Summary {0: 1, 1: 5, 2: 237, 3: 10428, 4: 102793}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623170_1147623177 13 Left 1147623170 17:41881720-41881742 CCGAGTAGCTGGCATTATATGCC 0: 1
1: 5
2: 237
3: 10428
4: 102793
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623170_1147623171 -6 Left 1147623170 17:41881720-41881742 CCGAGTAGCTGGCATTATATGCC 0: 1
1: 5
2: 237
3: 10428
4: 102793
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623170 Original CRISPR GGCATATAATGCCAGCTACT CGG (reversed) Intronic
Too many off-targets to display for this crispr