ID: 1147623171

View in Genome Browser
Species Human (GRCh38)
Location 17:41881737-41881759
Sequence TATGCCCCTGCCACCACGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13081
Summary {0: 1, 1: 0, 2: 24, 3: 979, 4: 12077}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623162_1147623171 30 Left 1147623162 17:41881684-41881706 CCTCCCAGGTTCAAGCAATTCTC 0: 20147
1: 62565
2: 132669
3: 180845
4: 155163
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623164_1147623171 26 Left 1147623164 17:41881688-41881710 CCAGGTTCAAGCAATTCTCCTGC 0: 30902
1: 81215
2: 152545
3: 104312
4: 56422
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623163_1147623171 27 Left 1147623163 17:41881687-41881709 CCCAGGTTCAAGCAATTCTCCTG 0: 18481
1: 76818
2: 153804
3: 212009
4: 151247
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623170_1147623171 -6 Left 1147623170 17:41881720-41881742 CCGAGTAGCTGGCATTATATGCC 0: 1
1: 5
2: 237
3: 10428
4: 102793
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623168_1147623171 -2 Left 1147623168 17:41881716-41881738 CCTCCCGAGTAGCTGGCATTATA 0: 22
1: 4198
2: 66352
3: 238283
4: 260179
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623165_1147623171 8 Left 1147623165 17:41881706-41881728 CCTGCCTCAGCCTCCCGAGTAGC 0: 87862
1: 235715
2: 200111
3: 128617
4: 141401
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623169_1147623171 -5 Left 1147623169 17:41881719-41881741 CCCGAGTAGCTGGCATTATATGC 0: 1
1: 88
2: 8468
3: 102120
4: 235377
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077
1147623167_1147623171 4 Left 1147623167 17:41881710-41881732 CCTCAGCCTCCCGAGTAGCTGGC 0: 677
1: 105064
2: 291600
3: 225942
4: 124342
Right 1147623171 17:41881737-41881759 TATGCCCCTGCCACCACGTCTGG 0: 1
1: 0
2: 24
3: 979
4: 12077

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623171 Original CRISPR TATGCCCCTGCCACCACGTC TGG Intronic
Too many off-targets to display for this crispr