ID: 1147623172

View in Genome Browser
Species Human (GRCh38)
Location 17:41881741-41881763
Sequence GTAGCCAGACGTGGTGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1952
Summary {0: 1, 1: 4, 2: 56, 3: 431, 4: 1460}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623172_1147623180 30 Left 1147623172 17:41881741-41881763 CCCCTGCCACCACGTCTGGCTAC 0: 1
1: 4
2: 56
3: 431
4: 1460
Right 1147623180 17:41881794-41881816 TGTGCAAGCAGAGCTCACCCTGG 0: 1
1: 0
2: 0
3: 11
4: 163
1147623172_1147623177 -8 Left 1147623172 17:41881741-41881763 CCCCTGCCACCACGTCTGGCTAC 0: 1
1: 4
2: 56
3: 431
4: 1460
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623172 Original CRISPR GTAGCCAGACGTGGTGGCAG GGG (reversed) Intronic
900017769 1:165137-165159 TTAGGCAGGCGTGGTGGCAGAGG + Intergenic
900048028 1:523733-523755 TTAGGCAGGCGTGGTGGCAGAGG + Intergenic
900070246 1:765593-765615 TTAGGCAGGCGTGGTGGCAGAGG + Intergenic
900192570 1:1357658-1357680 TTAGCCGGACGGGGTGGTAGTGG + Intronic
900236256 1:1592696-1592718 TTAGCCAGGCGTGGTGGCGCAGG + Intergenic
900509630 1:3052460-3052482 GTGGGAAGAGGTGGTGGCAGTGG + Intergenic
900611657 1:3546889-3546911 GCTGCCAGGCGGGGTGGCAGTGG + Intronic
900611671 1:3546924-3546946 GCTGCCAGGCGGGGTGGCAGTGG + Intronic
900865701 1:5267292-5267314 GTAGCCAGAGGTGGTCTCCGTGG + Intergenic
901148153 1:7082154-7082176 CTAGCCAGCCGTGGTGGCTCAGG + Intronic
901240310 1:7689113-7689135 GTAGCCAGGTGTGGTGGCACAGG + Intronic
901240357 1:7689425-7689447 TTAGCCAGGTGTGGTGGCACAGG + Intronic
901286065 1:8079839-8079861 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
901348994 1:8575508-8575530 TTAGCCAGGTGTGGTGGCACAGG - Intronic
901378378 1:8856003-8856025 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
901518536 1:9765731-9765753 TTAGCCGGGCGTGGTGGCGGCGG + Intronic
901562168 1:10081207-10081229 TTAGCCAGGCATGGTGGCACAGG - Intronic
901580535 1:10239093-10239115 TTAGCCAGGTGTGGTGGCACAGG - Intronic
901602397 1:10432232-10432254 TTAGCTGGGCGTGGTGGCAGGGG - Intronic
901648655 1:10729959-10729981 TTAGCCAGTTGTGGTGGCACAGG - Intronic
901648912 1:10732176-10732198 TTAGCCAGGTGTGGTGGCACAGG + Intronic
901688254 1:10956620-10956642 TTAGCCGGGCGTGGTGGCGGGGG - Intronic
901691024 1:10973577-10973599 GCACCTAGAAGTGGTGGCAGTGG + Intronic
901728243 1:11259356-11259378 ATTGCTAGATGTGGTGGCAGCGG + Exonic
901792866 1:11663800-11663822 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
901814964 1:11788677-11788699 CCTGGCAGACGTGGTGGCAGCGG + Exonic
901990323 1:13107573-13107595 TTAAGCAGACATGGTGGCAGAGG + Intergenic
902046851 1:13531008-13531030 ATAGCCGGGCTTGGTGGCAGGGG + Intergenic
902118781 1:14143862-14143884 ATAGCCAGGCATGGTGGCACAGG - Intergenic
902273060 1:15318485-15318507 TTAGCCAGATGTGGTGGCGGAGG + Intronic
902274933 1:15332570-15332592 TTAGCCAGGCATGGTGGCACAGG + Intronic
902330448 1:15728679-15728701 GAAGCCATACCTGGTGGAAGAGG + Exonic
902334210 1:15745745-15745767 TTAGCCAGGTGTGGTGGCAGGGG + Intronic
902350860 1:15853331-15853353 TTAGCCAGGCATGGTGGCACGGG - Intronic
902351560 1:15859514-15859536 TTAGCCGGGCGTGGTGGCGGGGG - Intronic
902402715 1:16166907-16166929 TTAGCCAGGCGTGGTGGCGCAGG - Intergenic
902506248 1:16940368-16940390 TTAGCCCGGCATGGTGGCAGGGG - Intronic
902634384 1:17725702-17725724 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
902642148 1:17773960-17773982 GTAGCCAGAGGTGGTGGGGTGGG + Intronic
902865050 1:19272552-19272574 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
902934774 1:19757142-19757164 TTAGCCAGGCGTGGTGGCGGGGG + Intronic
903257149 1:22110432-22110454 TTAGCCAGGCATGGTGGCACAGG - Intergenic
903599358 1:24523942-24523964 TTGGCCAGGCGTGGTGGCACAGG + Intronic
903643136 1:24873914-24873936 TTAGCCAGGTGTGGTGGCAGAGG + Intergenic
903693443 1:25190834-25190856 TTAGCCAGTCGTGGTGGCACAGG - Intergenic
903770718 1:25762571-25762593 TTGGCCAGGCGTGGTGGCACAGG - Intronic
903770829 1:25763340-25763362 TTAGCCAGGAGTGGTGGCACAGG + Intronic
903913175 1:26743683-26743705 ATAGGCAGGTGTGGTGGCAGGGG + Intronic
904061225 1:27712339-27712361 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
904140347 1:28348153-28348175 TTAGCCAGGCGTGGTGGTGGCGG + Intergenic
904158918 1:28507751-28507773 TTAGCCTGGCGTGGTGGCGGGGG - Intronic
904178387 1:28647725-28647747 TTAGCCGGGCATGGTGGCAGGGG + Intergenic
904219174 1:28950980-28951002 TTAGCCAGGCGTAGTGGCACAGG - Intronic
904219999 1:28959361-28959383 TTAGCCAGGCGTAGTGGCACAGG - Intronic
904240427 1:29141054-29141076 TTAGCCAAATGTGGTGGCACAGG - Intergenic
904497774 1:30896814-30896836 TTAGCCAGGCATGGTGGCATGGG + Intronic
904507806 1:30972931-30972953 TTAGCCAGGCGTGGTGGTGGGGG + Intronic
904513897 1:31037930-31037952 TTAGCCAGGCGTGGTGGCAGGGG + Intronic
904520170 1:31089026-31089048 TTAGCCGGACATGGTGGCAAGGG - Intergenic
904554950 1:31355026-31355048 TTAGCCAGGCGTGGTGGCGAGGG + Intronic
904666346 1:32124651-32124673 TTAGCCAGGCATGGTGGCGGGGG - Intronic
905035666 1:34916840-34916862 TTAGCCAGACGTGGCGGCACGGG - Intronic
905036287 1:34920051-34920073 GAAGCCAGATGTGGTGGGGGTGG - Intronic
905040391 1:34951975-34951997 TTAGCCAGGCATGGTGGCATGGG - Intergenic
905057085 1:35105282-35105304 TTAGCCAGGCGTGGTGGTGGCGG - Intronic
905170265 1:36105800-36105822 TTAGCCAGACTTGGTGGCGCGGG + Intronic
905421389 1:37847847-37847869 TTAGCCAGGTGTGGTGGCTGAGG + Intronic
905540998 1:38760401-38760423 TTAGCCAGGCGTGGTGGCATGGG - Intergenic
905705277 1:40051720-40051742 TTAGCCAGGCACGGTGGCAGGGG - Intronic
905718912 1:40178979-40179001 TTAGCCGGGCGTGGTGGCACAGG - Intronic
905761228 1:40559452-40559474 TTAGCCAGGTGTGGTGGCACGGG - Intergenic
906160177 1:43642327-43642349 TTAGCCAGGTGTGGTGGCATGGG - Intergenic
906317196 1:44794057-44794079 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
906386740 1:45376360-45376382 TTAGCCAGACGTGGTGGCGGGGG - Intronic
906418442 1:45641667-45641689 TTAGCCGGGCGTGGTGGCATAGG + Intronic
906547167 1:46627963-46627985 TTAGCCAGGCATGGTGACAGGGG - Intergenic
907147114 1:52245009-52245031 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
907164498 1:52398408-52398430 TTAGCCAGGCGTGGTGGCACAGG - Intronic
907191322 1:52651381-52651403 TTAGCCAGGCGTGATGGCAGGGG - Intronic
908005551 1:59724014-59724036 TTAGCCAGGCATGGTGGCAGGGG + Intronic
908106125 1:60844007-60844029 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
908241652 1:62193849-62193871 CTAGCCAGGCGTGGTGGCATGGG + Intergenic
908291825 1:62675254-62675276 TTAGCCAGATGTGGTGGCGTGGG + Intronic
908791862 1:67790760-67790782 TTAGCCAGACGTGGTGGTGGCGG - Intronic
908808816 1:67958435-67958457 AAAGCCAGACGTGGTTGGAGGGG - Intergenic
908936853 1:69386086-69386108 TTAGCCGGGCATGGTGGCAGGGG + Intergenic
909112371 1:71495328-71495350 TTAGCCAGGCATGGTGGCACAGG + Intronic
909132782 1:71759754-71759776 GTAGCCAGACATGGTGGCACAGG - Intronic
909225370 1:73013973-73013995 GTTGCCAGAGGTGGTGGATGGGG - Intergenic
909291120 1:73885140-73885162 TTAGCCAGTCATGGTGGCTGGGG - Intergenic
909406655 1:75297570-75297592 ATGGCCAGGTGTGGTGGCAGTGG - Intronic
909491972 1:76236089-76236111 TTAGCCAGGCATGGTGGCTGAGG - Intronic
910041821 1:82861378-82861400 TTAGCCAGGTGTGGTGGCGGGGG + Intergenic
910302440 1:85721637-85721659 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
910447097 1:87309776-87309798 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
910589260 1:88912094-88912116 TTAGCCAGGCATGGTGGCACAGG - Intergenic
910707539 1:90146108-90146130 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
910823127 1:91373220-91373242 GCAACCAGAGGTGGTGGCAAAGG + Intronic
910980184 1:92952471-92952493 CTAGCCAGGTGTGGTGGCACAGG + Intronic
911045634 1:93625062-93625084 TTAGCCAGGCATGGTGGCGGGGG + Intronic
911187500 1:94918345-94918367 TTAGCCAGACATGGTGGCATAGG + Intronic
911192416 1:94960984-94961006 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
911295878 1:96114269-96114291 ATAGCTGGGCGTGGTGGCAGGGG - Intergenic
911325155 1:96462584-96462606 GTAGCCAGGCATAGTGGCACAGG - Intergenic
911608360 1:99933641-99933663 TTAGCCAGGCTTGGTGGCACAGG + Intergenic
911739247 1:101369325-101369347 ATAGCCAGGCGTGGTGGCACAGG - Intergenic
911747845 1:101459746-101459768 TTAGCCAGGCATGGTGGCAGAGG - Intergenic
912326579 1:108769244-108769266 GTAGGCAGAGGTGGAGGAAGCGG + Intronic
912476826 1:109943498-109943520 TTAGCCAGGCATGGTGGCGGGGG - Intergenic
912832876 1:112969235-112969257 TTAGCCAGGCGTGGTGGCACAGG + Intergenic
913016550 1:114742433-114742455 TTAGCCAGGCATGGTGGCATGGG + Intronic
913071461 1:115302766-115302788 GGAGCCAGGCCTGGTGGCTGCGG - Intronic
913144283 1:115974410-115974432 TTAGCCGGACGTGGTGGCACAGG - Intergenic
913167404 1:116200791-116200813 CTACCCAGGCGTGGTGGCACGGG - Intergenic
913345373 1:117803986-117804008 TTAGCCAGATGTGGTGGCACAGG + Intergenic
913468219 1:119164734-119164756 TTAGCCAGAGGTGGTGGCATGGG + Intergenic
913478807 1:119265072-119265094 TTAGCCGGGCGTGGTGGTAGGGG - Intergenic
914262557 1:146011341-146011363 TTAGCCAGACGTGGTGGTGTGGG - Intergenic
914568566 1:148892139-148892161 TTAGCCAGGTGTGGTAGCAGGGG - Intronic
914787302 1:150845753-150845775 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
914796502 1:150924566-150924588 CTAGCCGGGTGTGGTGGCAGGGG + Intergenic
914871358 1:151477598-151477620 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
914931662 1:151939738-151939760 TTAGCCAGGCATGGTGGCACAGG - Intergenic
914979949 1:152405680-152405702 TTAGCCAGGTGTGGTGGCAAGGG + Intergenic
914997449 1:152557468-152557490 GGAGCCAGAAGTTATGGCAGTGG - Intronic
915051260 1:153075194-153075216 TTAGCCAGGCGTGATTGCAGGGG + Intergenic
915169036 1:153964791-153964813 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
915223297 1:154392115-154392137 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
915368636 1:155329806-155329828 TTAGCCAGGCGTGGTGGTGGTGG + Intronic
915375868 1:155395081-155395103 TTAGCTGGACGTGGTGGCACAGG - Intronic
915497511 1:156292319-156292341 GTGCCCACACGTGGTGGCTGGGG + Exonic
915535690 1:156534059-156534081 GTACTCAGACATGGTGGCTGTGG - Exonic
915556924 1:156665860-156665882 GGAGACAGTGGTGGTGGCAGTGG - Intergenic
915632052 1:157160153-157160175 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
916076632 1:161203741-161203763 TTAGCCAGTTGTGGTGGCACAGG - Intronic
916217979 1:162414495-162414517 TTAGCTGGGCGTGGTGGCAGGGG - Intergenic
916392507 1:164345911-164345933 ATAGCCAGGTGTGGTGGCAGGGG + Intergenic
916407632 1:164513245-164513267 TTAGCCAGGTGTGGTGGCTGTGG - Intergenic
917082886 1:171274000-171274022 TTAGCCAGCCATGGTGGCATGGG + Intronic
917089295 1:171336748-171336770 TTAGCCAGGTGTGGTGGCATGGG - Intronic
917148644 1:171921068-171921090 CCAGCCAGACGTGGTGGCGTGGG - Intronic
917231311 1:172840856-172840878 TTAGCTGGGCGTGGTGGCAGGGG - Intergenic
917874510 1:179273959-179273981 TTAGCCAGGTGTGGAGGCAGGGG + Intergenic
918034416 1:180853213-180853235 GAAGCCAGGCGCAGTGGCAGTGG - Intronic
918372306 1:183873303-183873325 GTAGCCAATGGTGGTGGCAAGGG - Intronic
918757043 1:188352114-188352136 GTAGCCAAGCCTGGTGGCATGGG + Intergenic
918829047 1:189367508-189367530 AAAGCCGGGCGTGGTGGCAGGGG + Intergenic
918953339 1:191171228-191171250 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
919324331 1:196087061-196087083 ATAGCCAGGCGTGGTGGCATGGG + Intergenic
919701887 1:200639285-200639307 TTAGCCAGGCGTGGTGGCACAGG - Intronic
919702924 1:200649987-200650009 TTAGCCAGGCGTGGTGGCACAGG - Intronic
919705924 1:200675542-200675564 GTAGCCTGAATTAGTGGCAGTGG + Intergenic
919734570 1:200937843-200937865 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
919863017 1:201755292-201755314 TTAGCCAGGCATGGTGGCACAGG + Intronic
919868492 1:201802156-201802178 TTAGCCGGGCGTGGTGGCAGGGG + Intronic
919975930 1:202612512-202612534 TTAGCCAGTTGTGGTGGCATGGG - Intronic
920116471 1:203625178-203625200 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
920428256 1:205896336-205896358 GTAGCCAGACATGGTGGCACAGG - Intergenic
920736301 1:208535910-208535932 TTAGCCAGGCATGGTGGCAGGGG + Intergenic
921208754 1:212874152-212874174 TTAGCCAGGCATGGTTGCAGGGG - Intronic
921350492 1:214229835-214229857 GCAGCCAGCCCTGGTGGCGGGGG + Intergenic
921687457 1:218106169-218106191 TTAGCCAGGCCTGGTGGCAGGGG - Intergenic
921705215 1:218314843-218314865 TTAGCCAGGCGTGGTGGTAGGGG + Intronic
921868610 1:220112703-220112725 TTAGCCAGATGTGGTGGCACAGG - Intronic
922105610 1:222511005-222511027 TTAGGCAGGCGTGGTGGCAGAGG + Intergenic
922175227 1:223192196-223192218 TTAGCCAGGTGTGGTGGCAGAGG - Intergenic
922230019 1:223677696-223677718 TTAGCCAGGCATGGTGGCATGGG - Intergenic
922265952 1:223983631-223983653 TTAGGCAGGCGTGGTGGCAGAGG + Intergenic
922366394 1:224868481-224868503 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
922486294 1:225975758-225975780 TTAGCCGGGCGTGGTGGCGGCGG + Intergenic
923058479 1:230448322-230448344 TTAGCCAGACATGGTGGCGCAGG - Intergenic
923272187 1:232366523-232366545 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
923579691 1:235196704-235196726 TTAGCCAGACGTGGTGGTGGGGG + Intronic
923632279 1:235659249-235659271 TTAGGCAGGCGTGGTGGCACGGG - Intergenic
923761246 1:236847031-236847053 TTAGCCAGTTGTGGTGGCAAAGG - Intronic
923786069 1:237070715-237070737 GTAGCCAGGCATGCTGGCTGGGG + Intronic
923880659 1:238100596-238100618 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
923958147 1:239045620-239045642 TTAGCTGGATGTGGTGGCAGGGG + Intergenic
923971183 1:239204940-239204962 TTAGCCAGGCATGGTGGCACAGG + Intergenic
924050197 1:240072900-240072922 TTAGCCAGATGTGTTGGCACAGG + Intronic
924080950 1:240397641-240397663 TTAGCCAGGCGTGGTGGTAGGGG + Intronic
924129103 1:240887373-240887395 TGAGCCGGGCGTGGTGGCAGGGG - Intronic
924131372 1:240912002-240912024 TTAGCCAGGCGAAGTGGCAGGGG + Intronic
924321951 1:242859500-242859522 TTAGCCAGGCGTGGTGGTGGGGG + Intergenic
924347791 1:243088577-243088599 TTAGGCAGGCGTGGTGGCAGAGG + Intergenic
924521820 1:244812275-244812297 GGAGCCAGGTGTGGTGGCACAGG + Intergenic
924569087 1:245221551-245221573 TTAGCCGGACGTGGTGGTAGGGG - Intronic
924583153 1:245339122-245339144 TTAGCCAGGCGTGGTGGCACAGG - Intronic
924589972 1:245394474-245394496 TTAACCAGGCGTGGTGGCACAGG + Intronic
924725429 1:246665224-246665246 ATAGCCAGGCATGGTGGCACAGG + Intronic
924747257 1:246847644-246847666 TTAGCCAGACCTGGTGGCATAGG - Intronic
924755355 1:246935883-246935905 TTAGCCAGGAGTGGTGGCACAGG - Intergenic
924927350 1:248696048-248696070 GTTGTCAGAGGTGGTGGGAGTGG - Intergenic
1062766792 10:72271-72293 GCAGCCAGGCGTGGTGGCTCAGG + Intergenic
1062814161 10:487428-487450 GGAGGCAGCCGTGGAGGCAGAGG - Intronic
1062938558 10:1405481-1405503 TTAGCCAGAGGTGATGGTAGGGG + Intronic
1063058977 10:2530964-2530986 TTAGCCGGTCGTGGTGGCAGGGG + Intergenic
1063184247 10:3636292-3636314 CTAGCTAGGCGTGGTGGCGGTGG - Intergenic
1063361689 10:5464423-5464445 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1063486693 10:6426880-6426902 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
1063612282 10:7572922-7572944 TTAGCCAGGCATGGTGGCAGGGG - Intronic
1063705211 10:8423743-8423765 TTAGCCAGGCGTGGTGTCACAGG + Intergenic
1064049792 10:12050014-12050036 GTAGCCAGACGTGGTGGCACAGG + Intergenic
1064342644 10:14500652-14500674 TTAGCCAGATGTGGTGGCACCGG - Intergenic
1064446298 10:15396757-15396779 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
1064559970 10:16586236-16586258 TTAGCCAGATGTGGTGGCACAGG - Intergenic
1064586449 10:16844120-16844142 TTAGCCAGATGTGGTGGCGCAGG + Intronic
1064730978 10:18330813-18330835 TCAGCCAGGCGTGGTGGCGGGGG - Intronic
1064769714 10:18711133-18711155 TTAGCCAGGCGTGGTGGCACGGG - Intergenic
1064823922 10:19373367-19373389 GTAGCCAGATGTGGTGGTGGCGG + Intronic
1065070706 10:22021269-22021291 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1065200403 10:23307718-23307740 GGAGGCAGAGGTGGAGGCAGAGG - Intronic
1065466282 10:26026846-26026868 TTAGCCAGGCATGGTGGCATGGG - Intronic
1065515369 10:26519126-26519148 TTAGCCAGACATGGTGGGGGTGG + Intronic
1065541102 10:26768389-26768411 TTAGCCAGGCGTGGTGGCTCAGG + Intronic
1065851597 10:29794620-29794642 CTAGCCAGGCGTGGTGGCGCAGG + Intergenic
1065924534 10:30424047-30424069 TTAGCCGGGTGTGGTGGCAGGGG - Intergenic
1065924956 10:30427113-30427135 TTAGCCAGGCGTGGTGGCACAGG + Intergenic
1066621069 10:37350646-37350668 TTAGCCGGGTGTGGTGGCAGGGG - Intronic
1066728567 10:38416315-38416337 TTAGGCAGGCATGGTGGCAGAGG - Intergenic
1067080603 10:43210325-43210347 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1067245668 10:44540348-44540370 TTAGCCGGGCGTGGTGACAGGGG - Intergenic
1067941060 10:50657951-50657973 TTAGCCAGGCATGGTGGCCGTGG + Intergenic
1068824480 10:61419159-61419181 GAAGCCTCAGGTGGTGGCAGTGG + Intronic
1069007363 10:63333407-63333429 TTAGCCAGCCATGGTGGCTGTGG + Intronic
1069381948 10:67850411-67850433 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1069385450 10:67879854-67879876 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1069449681 10:68506296-68506318 TTAGCCAGGCATGGTGGCATAGG + Intronic
1069454152 10:68540553-68540575 TTAGCCGGGCGTGGTGGCATGGG - Intergenic
1069463812 10:68620045-68620067 TTAGCCAGGCGTGGTGGCAGGGG + Intronic
1069476975 10:68743310-68743332 TTAGCCAGGCATGGTGGCTGAGG - Intronic
1069510062 10:69035516-69035538 TTAGCCAGACATGTTGGCACAGG + Intergenic
1069720514 10:70546802-70546824 TTAGCCAGGCGTGGTGGCATGGG + Intronic
1069976086 10:72214520-72214542 TTAGCCGGGGGTGGTGGCAGGGG - Intronic
1070010522 10:72469617-72469639 GTTGCCATACTAGGTGGCAGTGG + Intronic
1070123953 10:73605209-73605231 TTAGCCAGGCATGGTGGCGGGGG - Intronic
1070186528 10:74068469-74068491 TTAGCCAGGCATGGTGGCAGGGG - Intronic
1070233317 10:74595521-74595543 TTAGCCGGATGTGGTGGCGGGGG - Intronic
1070431495 10:76343962-76343984 TTAGCCAGGCGTGGTGGCACGGG - Intronic
1070476654 10:76835763-76835785 ATAGCCAGGCATGGTGGCGGGGG + Intergenic
1070643639 10:78186483-78186505 GTAGCCAGTTGTTGTGGTAGTGG - Intergenic
1070652344 10:78246495-78246517 TTAGCCAGGCATGGTGGCAGGGG + Intergenic
1070663567 10:78327936-78327958 GGTGCCAGTGGTGGTGGCAGAGG + Intergenic
1070862274 10:79682823-79682845 TTAGCCAGGCATGGTGGCCGTGG + Intergenic
1070898098 10:80002941-80002963 TTAGCCAGGTGTGGTGGCAGGGG + Intergenic
1071019237 10:81032461-81032483 TTAGCCAGGCCTGGTGGCATGGG + Intergenic
1071084992 10:81859735-81859757 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
1071909921 10:90220037-90220059 GCAGCCAGAAGTAGTGGCATTGG - Intergenic
1072217263 10:93297957-93297979 TTAGCCAGGCGTGGTGGTAGGGG - Intergenic
1072347017 10:94518004-94518026 TTAGCCAGGTGTGGTGGCATAGG + Intronic
1072640136 10:97205487-97205509 GTAGCCAGATGGGCTGGCACTGG - Intronic
1072679151 10:97493422-97493444 TTAGCCAGGTGTGGTGGCACGGG + Intronic
1072699065 10:97626902-97626924 TTAGCTGGGCGTGGTGGCAGGGG - Intronic
1072714304 10:97739210-97739232 TTAGCCAGGCATGGTGGCTGAGG - Intronic
1072867720 10:99081781-99081803 TTAGCCAGGCATGGTGGCGGGGG - Intronic
1072916982 10:99543420-99543442 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1073090445 10:100933823-100933845 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1073145524 10:101278587-101278609 TTAGCCAGGCGTGGTGGCACAGG + Intergenic
1073287529 10:102397707-102397729 GGTGCCAGGCCTGGTGGCAGAGG + Intronic
1073329234 10:102660098-102660120 TTAGCCAGGCGTGGTGCCACGGG + Intergenic
1073376224 10:103037407-103037429 GTAGCCAGACATGGTGGTCATGG - Intronic
1073409063 10:103324611-103324633 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1073768257 10:106707333-106707355 ATAGCCAGGTGTGGTGGCAAGGG - Intronic
1074139220 10:110657161-110657183 TTAGCCAGGCGTGGTGGCATGGG - Intronic
1074393505 10:113077835-113077857 CAAGCCAGGCGTGGTGGCATGGG - Intronic
1074484103 10:113855612-113855634 CTAGCCAGGCGTGGTGGCGCGGG - Intronic
1074509525 10:114099864-114099886 TTAGCCAGACATGGTGGCATAGG + Intergenic
1074526482 10:114267576-114267598 TTAGCCAGGTGTGGTGGCGGGGG - Intronic
1075120649 10:119662192-119662214 ATAGCCAGGCATGGTGGCGGGGG - Intronic
1075131393 10:119742843-119742865 TTAGCCCGGCGTGGTGGCACAGG + Intronic
1075388198 10:122072964-122072986 TTAGCCAGGCGTGGTGGCGCGGG + Intronic
1075394728 10:122118859-122118881 CTAGACAGATCTGGTGGCAGAGG + Intronic
1075825103 10:125349298-125349320 TTAGCCAGGTGTGGTGGCTGTGG - Intergenic
1077242426 11:1517595-1517617 GGAGCCAGAGGTGGGGGTAGCGG - Intergenic
1077417070 11:2429118-2429140 GTAGCTGGTAGTGGTGGCAGTGG + Intergenic
1077611098 11:3643368-3643390 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
1077875401 11:6300813-6300835 TTAGCCAGGCATGGTGGCACTGG + Intergenic
1077975022 11:7238975-7238997 GCACCCAGAAGTGGTGGGAGTGG + Intronic
1078041462 11:7867521-7867543 TTAGCTGGGCGTGGTGGCAGGGG - Intergenic
1078132969 11:8628464-8628486 TTAGCCAGGCATGGTGGCATGGG + Intronic
1078217267 11:9322001-9322023 TTAGCCAGGCGTGGTGGCACGGG - Intergenic
1078255697 11:9656793-9656815 GGGGCCAGACGTGGTGGCTCAGG - Intergenic
1078271013 11:9794516-9794538 TTAGCCAGGCATGGTGGCACAGG + Intronic
1078340977 11:10497717-10497739 GTAGCTGGAGGTGGGGGCAGGGG + Intronic
1078623233 11:12928426-12928448 TTAGCCAGGCATGGTGGCACAGG - Intronic
1078631872 11:13010452-13010474 GGAGCCAGAAGAGGTGGCGGCGG + Intergenic
1078755111 11:14201543-14201565 ATAGCCAGGTGTGGTGGCAGAGG - Intronic
1079588325 11:22152491-22152513 ATAGCCGGGCGTGGTGGCGGGGG - Intergenic
1079702519 11:23566641-23566663 TTAGCCAGGCGTGGTGGCGAGGG - Intergenic
1079878499 11:25891877-25891899 CTAGCCAGGCGTGGTGGCGGAGG - Intergenic
1080506762 11:32922629-32922651 TTAGCCAGGCATGGTGGCACAGG - Intronic
1080509183 11:32950239-32950261 TTAGCCAGGTGTGATGGCAGGGG - Intronic
1080522529 11:33079951-33079973 TTAGCCAGGCGTGGTGGCATAGG + Intronic
1080669738 11:34365141-34365163 TTAGCCAGGCGTGGTGGTGGGGG + Intergenic
1080795169 11:35556776-35556798 TTAGCCAGATGTGGTGACACGGG + Intergenic
1081658259 11:44872071-44872093 TTAGCCAGGCGTGGTGGTGGTGG - Intronic
1081808841 11:45904187-45904209 GCAGACAGATGTGGTGGCTGGGG - Intronic
1082017953 11:47506277-47506299 TTAGCCAGGCGTGGTGGCACAGG + Intronic
1082037577 11:47657874-47657896 TTAGCCAGGTGTGGTGGCAGGGG - Intergenic
1082052842 11:47786933-47786955 TTAGCCAGGCATGGTGGCATGGG - Intronic
1082126982 11:48444692-48444714 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
1082262335 11:50086230-50086252 TTAGCCAGATGTGGTGGTAGAGG + Intergenic
1082560562 11:54615670-54615692 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
1083032454 11:59605526-59605548 TTAGCCAGACATGGTGACTGAGG - Intronic
1083123733 11:60541952-60541974 TTAGCCAGGCATGGTGGCACAGG + Intronic
1083147769 11:60771719-60771741 GGAGCCAGGCGTGGTTTCAGTGG - Intronic
1083176821 11:60955348-60955370 TTAGCCGGGCGTGGTGGCACAGG + Intergenic
1083200091 11:61115796-61115818 GCAGCCAGAGGGGGTGACAGGGG + Intronic
1083357807 11:62080212-62080234 TTAGCCAGGCATGGTGGCACGGG - Intergenic
1083561598 11:63677382-63677404 TTAGCCAGGCATGGTGGCATGGG + Intergenic
1084089569 11:66870993-66871015 GCAGCCTGCCGTGGGGGCAGGGG - Intronic
1084206322 11:67596143-67596165 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1084300995 11:68252362-68252384 TTAGCCAGGCATGGTGGCACGGG - Intergenic
1084344199 11:68533556-68533578 TTAGCCAGGTGTGGTGGCACGGG + Intronic
1084356575 11:68642443-68642465 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
1084370980 11:68743022-68743044 TTAGCCAGGCATGGTGGCACAGG - Intronic
1084379539 11:68802585-68802607 TTAGCCAGGCGTGGTGGCAGGGG + Intronic
1084382035 11:68818709-68818731 TTAGCCAGGTGTGGTGGCATGGG + Intronic
1084382397 11:68821297-68821319 TTAGCCAGTCGTGGTGGTGGGGG - Intronic
1084603150 11:70158518-70158540 CCAGCCAGAGGTGGTGGCTGTGG + Intronic
1084849267 11:71925731-71925753 TTAGCCGGACGTGGTGGCGGGGG + Intronic
1084881707 11:72176434-72176456 ATAGCCAGGTGTGGTGGCATGGG + Intergenic
1084920562 11:72466093-72466115 TTAGCCGGGCGTGGTGGCACAGG + Intergenic
1085167054 11:74412001-74412023 TTAGCCAGGTGTGGTGGCGGGGG - Intergenic
1085210308 11:74770950-74770972 TTAGCCAGACATGGGGGCACTGG - Intronic
1085597541 11:77823065-77823087 TTAGCCGGGCGTGGTGGCGGCGG + Intronic
1085805302 11:79630283-79630305 TTAGCCAGGCGTGGTGACAGAGG + Intergenic
1085927912 11:81044056-81044078 TTAGCCGGGCGTGGTGGTAGTGG + Intergenic
1086284514 11:85230891-85230913 GTATCCTCACGTGGTGGAAGAGG - Intronic
1086748605 11:90462006-90462028 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1086895437 11:92306935-92306957 ATAGCCGGACATGGTGGCACAGG - Intergenic
1087028722 11:93680456-93680478 TTAGCCAGGCGTGGTGGCCTGGG + Intronic
1087692666 11:101339845-101339867 TTAGCCAGGCATGGTGGCACAGG - Intergenic
1087907889 11:103720773-103720795 GAAGGTAGAGGTGGTGGCAGTGG - Intergenic
1088264289 11:107974851-107974873 GTAGCCAGGTGTGGTGGCTCAGG + Intergenic
1088296307 11:108299442-108299464 TTAGCCAGGCGTGGTGGCGCAGG - Intronic
1088346607 11:108834100-108834122 TTAGCCAGGCTTGGTGGCACAGG - Intronic
1088593336 11:111421764-111421786 TTAGCCAGGCATGGTGACAGGGG + Intronic
1088647423 11:111927867-111927889 TTAGCCAGGCATGGTGGCACGGG + Intronic
1088647540 11:111928614-111928636 TTAGCCGGGCGTGGTGGCCGGGG + Intronic
1088681798 11:112249808-112249830 TTAGCCCGGTGTGGTGGCAGGGG + Intronic
1088775071 11:113074776-113074798 TTAGCCAGGCATGGTGGCATGGG - Intronic
1088870221 11:113884398-113884420 GTAGCCAGGTGTGGTGGCGGGGG + Intergenic
1088936575 11:114406881-114406903 TTAGCCGGGCGTGGTGGCACAGG + Intronic
1089181739 11:116588019-116588041 TTAGCCAGGCATGGTGGCATGGG - Intergenic
1089240149 11:117070897-117070919 TTAGCCAGGTGTGGTGGCGGGGG - Intronic
1089453976 11:118615046-118615068 TTAGCCAGGCGTGGTGGCACGGG + Intronic
1089503366 11:118946338-118946360 GTAGCCAGATGTAGTGGCACAGG - Intronic
1089537015 11:119167162-119167184 TCAACCAGACGTGGTGGCATGGG - Intronic
1089568948 11:119389639-119389661 TTAGCCAGGAGTGGTGGCACAGG + Intergenic
1089627575 11:119761433-119761455 GCAGACAGAGGTGGTGGGAGGGG - Intergenic
1089702221 11:120252352-120252374 TTAGCCAGGCGTGGTGGTGGTGG - Intronic
1089811005 11:121131065-121131087 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1089997621 11:122923861-122923883 TTAGCCAGGCGTGGTGACTGGGG - Intronic
1090018426 11:123105961-123105983 TTAGCCAGGCGTGGTGGCGTGGG - Intronic
1090270769 11:125384535-125384557 TAAGCCAGGCGTGGTGGCGGAGG + Intronic
1090380734 11:126325969-126325991 TTAGCCAGGCGTGGTGGCGTGGG + Intronic
1090536305 11:127645702-127645724 TTAGCCAGACGTGGTGGCAGAGG - Intergenic
1090649640 11:128794927-128794949 TTAGCCAGGCATGGTGGCACGGG + Intronic
1091031662 11:132194967-132194989 CTAGCCAGGCGTGGTGGCACAGG - Intronic
1091278988 11:134371307-134371329 GTAGGCAGACGAGGGGCCAGTGG - Intronic
1091713830 12:2762149-2762171 GTAGCTGGAGGTGGTGGGAGGGG + Intergenic
1091736534 12:2926755-2926777 GTAGCCAGGTGTGGTGGTGGTGG + Intronic
1092270939 12:7022803-7022825 TTAGCCAGGCGTGGTGGCACAGG - Intronic
1092356481 12:7799707-7799729 GTAGCCGGGCATGATGGCAGGGG + Intergenic
1092364670 12:7867130-7867152 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1092405031 12:8215279-8215301 TCAGCCAGACATGGTGGCACAGG + Intergenic
1092623041 12:10294543-10294565 TTAGCCAGGCATGGTGGCATGGG - Intergenic
1092740977 12:11629385-11629407 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1092773838 12:11923676-11923698 CTAGCCAGGCGTGGTGGCGCAGG + Intergenic
1092782645 12:12001531-12001553 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
1093046416 12:14450920-14450942 TTAGCCAGACGTGGTGGTGCAGG - Intronic
1093076986 12:14769329-14769351 TTAGCCAGGCGTGGTGGCGCAGG + Intronic
1093291606 12:17331775-17331797 GTACCCATAAGTGGTGGCACTGG - Intergenic
1093346752 12:18046314-18046336 ATAGCCGGGCGTGGTGGCGGGGG + Intergenic
1093374709 12:18410356-18410378 TTAGCCAGGCATGGTGGCACAGG + Intronic
1093436104 12:19137180-19137202 TTAGCCAGGCGTGGTGGTGGTGG - Intronic
1093471240 12:19504381-19504403 TTAGCCAGGCGTGGTGGGGGGGG - Intronic
1093868997 12:24263379-24263401 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1094043960 12:26146674-26146696 TTAGCCAGGTGTGGTGGCATAGG + Intronic
1094085749 12:26589638-26589660 TTAGTCAGGCGTGGTGGCGGGGG + Intronic
1094108188 12:26834601-26834623 TTAGCCGGACGTGGTGGCACAGG + Intergenic
1094180729 12:27590320-27590342 TTAGCCAGGTATGGTGGCAGGGG - Intronic
1094531087 12:31275733-31275755 ATAGCCAGGCATGGTGGCACAGG + Intergenic
1094624805 12:32113530-32113552 TTAGCCAGGCATGGTGGCATGGG - Intronic
1094747819 12:33366297-33366319 GCAGCCAGATGTGGTGGCTTAGG - Intergenic
1094765111 12:33585470-33585492 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1094799147 12:34010028-34010050 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1095111897 12:38304147-38304169 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1095888891 12:47217253-47217275 TTAGCCAGGCATGGTGGCACAGG + Intronic
1096033746 12:48445022-48445044 TTAGCCAGGCGTGGTGGCTTGGG + Intergenic
1096067945 12:48756022-48756044 TTAGCCAGGTGTGGTGGCAGGGG - Intergenic
1096132647 12:49172620-49172642 TTAGCCAGGCGTGGTAGCACAGG - Intergenic
1096311698 12:50526780-50526802 GTAGCCAAGCGTGGTGGCACAGG - Intronic
1096376005 12:51111288-51111310 TTAGCCGGGCGTGGTGGCACGGG - Intronic
1096682035 12:53262322-53262344 ATAGCCGGGCGTGGTGGCGGGGG - Intergenic
1096818483 12:54216407-54216429 GGAGTCAGACGTGGTGGCAGAGG - Intergenic
1097004304 12:55904112-55904134 TTAGCCGGATGTGGTGGCAGGGG - Intronic
1097131377 12:56813158-56813180 TTAGCCAGACGTTGTGGTGGGGG - Intergenic
1097202756 12:57293487-57293509 GTAACCAGACGGGATGGCTGGGG + Intronic
1097238789 12:57558921-57558943 ATAGCCAGGTGTGGTGGCATGGG - Intronic
1097373034 12:58807361-58807383 TTAGCCAGGCTTGGTGGCGGGGG + Intronic
1097499735 12:60387807-60387829 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
1097761596 12:63472101-63472123 TTAGCCAGGCGTGGTGGCACAGG + Intergenic
1097831010 12:64223913-64223935 TTAGCCAGGTGTGGTGGCACTGG - Intergenic
1097833670 12:64251824-64251846 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1097877499 12:64657156-64657178 TTAGCCAGACGTGGTGGCGTGGG - Intronic
1098089816 12:66889312-66889334 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
1098336752 12:69412504-69412526 TTAGCTCGGCGTGGTGGCAGGGG + Intergenic
1098356932 12:69620951-69620973 GTAGCTAGAGGTGGTTTCAGAGG + Intergenic
1099089159 12:78282722-78282744 TTAGCCAGGCATGGTGGCAGGGG + Intergenic
1099460695 12:82917746-82917768 TTAGCCGGGCCTGGTGGCAGGGG - Intronic
1099650051 12:85415319-85415341 TCAGCCAGGCGTGGTGGCACAGG + Intergenic
1100147170 12:91692242-91692264 TTAGCCGGGCGTGGTGGCACGGG - Intergenic
1100221200 12:92506200-92506222 GTACCCAGAAGTGGGGGTAGGGG + Intergenic
1100549723 12:95635945-95635967 TTAGCCGGGCATGGTGGCAGGGG - Intergenic
1100754151 12:97731762-97731784 TTAGCCAGGCGTGGTGGTGGGGG + Intergenic
1101377873 12:104186591-104186613 TTAGCCAGGCGTGGTGGCGCAGG + Intergenic
1101538583 12:105643326-105643348 TTAGCCAGGCGTGGTGGCGCGGG - Intergenic
1101951056 12:109175560-109175582 TTAGCCAGGCATGGTGGCATGGG - Intronic
1102048999 12:109848636-109848658 TTAGCCGGACATGGTGGCGGGGG + Intergenic
1102062270 12:109941969-109941991 TTAGCCAAGCGTGGTGGCACGGG - Intronic
1102089120 12:110172146-110172168 CTGGCCAGACGTGGTGGCTCAGG + Intronic
1102139242 12:110601126-110601148 ATAGCCAGGCATGGTGGCACAGG - Intergenic
1102156777 12:110736360-110736382 GCAGCCAGATGTGGTGGCTTGGG + Intronic
1102186351 12:110951051-110951073 CTTCCCAGACGGGGTGGCAGCGG + Intergenic
1102296029 12:111737327-111737349 TTAGCCAGGCGTGGTGGCGCAGG - Intronic
1102368908 12:112364580-112364602 TTAGCCAGCCGTGGTGGCATGGG + Intronic
1102369849 12:112373384-112373406 ATAGCCAGGTGTGGTGGCACGGG + Intronic
1102372909 12:112397571-112397593 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1102739869 12:115197640-115197662 TTAGCCGGCCGTGGTGGCAGTGG + Intergenic
1102813936 12:115847209-115847231 TTAGCCAGATGTGGTGGCACAGG - Intergenic
1102833879 12:116034857-116034879 TTAGCCAGGCGTGGTGGCACAGG + Intronic
1103048586 12:117759960-117759982 TTAGCCAGGCGTGGTGGCACAGG + Intronic
1103055348 12:117815826-117815848 TTAGCCAGGCATGGTGGCATAGG + Intronic
1103294578 12:119875595-119875617 TTAGCCAGGCATGGTGGCACAGG + Intronic
1103346452 12:120254025-120254047 TTAGCCAAGCGTGGTGGCACGGG - Intronic
1103366093 12:120384499-120384521 TTAGCCAGATGTGCTAGCAGGGG - Intergenic
1103375738 12:120454553-120454575 TTAGCCAGGCGTGGTGGCGGGGG - Intronic
1103393915 12:120593358-120593380 GTAGCCGGGCATGGTGGCAGGGG - Intergenic
1103405554 12:120672483-120672505 TTAGCCAGGCGTGGTAGCACAGG + Intergenic
1103487115 12:121290541-121290563 TTAGCCAGGCGTGGTGGCGCAGG + Intronic
1103548711 12:121720562-121720584 TTAGCCAGGCATGGTGGCACAGG + Intronic
1103600938 12:122054232-122054254 TTAGCCGGGCGTGGTGGCGGCGG - Intronic
1103609316 12:122112495-122112517 ATAGCCGGACGTGGTGGTGGCGG + Intronic
1103655395 12:122466511-122466533 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1103665333 12:122559720-122559742 TTAGCCAGGTGTGGTGGCAGCGG - Intronic
1103712231 12:122921267-122921289 TTAGCCAGGCATGGTGGCACAGG + Intronic
1103797654 12:123515885-123515907 TTAGCCAGGCGTGGTGGCACAGG + Intronic
1103955354 12:124573399-124573421 TTAGCCAGGTGTGGTGGCACGGG - Intergenic
1104024329 12:125014911-125014933 TTAGCCAGGTGTGGTGGCATGGG - Intronic
1104129111 12:125875586-125875608 TTTGCCAGGCGTGGTGGCACAGG - Intergenic
1104370305 12:128218446-128218468 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1104419609 12:128624395-128624417 TTAGCTGGACGTGGTGGCGGGGG + Intronic
1104529554 12:129556296-129556318 GTTGGCAGGGGTGGTGGCAGAGG - Intronic
1104707158 12:130955933-130955955 TTAGCCAGGCGTGGTGGCATGGG - Intronic
1104960829 12:132488023-132488045 TTAGTCAGACATGGTGGCATAGG + Intergenic
1105236831 13:18564418-18564440 TTAGCCAGGCGAGGTGGCGGCGG - Intergenic
1105445016 13:20446256-20446278 TTAGCCAGGCATGGTGGCACAGG - Intronic
1105453559 13:20520955-20520977 TTAGCCAGGCGTGGTGGCAGGGG + Intronic
1105493013 13:20905764-20905786 TTAGCCAGGCGAGGTGGCACAGG + Intergenic
1105683641 13:22754213-22754235 TTAGCCAGGTATGGTGGCAGGGG - Intergenic
1105694752 13:22876699-22876721 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1105891591 13:24686155-24686177 GGGGCCAGACGTGGTGGCTCAGG + Intronic
1106050096 13:26181456-26181478 GTAGCAAGAGGTGATGTCAGGGG + Intronic
1106194877 13:27484510-27484532 GCAGCCAGGCGTGGTGGCTCAGG + Intergenic
1106252564 13:27993817-27993839 TTAGCCAGATGTGGTGGCTGAGG + Intergenic
1106722695 13:32452206-32452228 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1106838823 13:33664771-33664793 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1107532990 13:41302174-41302196 TTAGCCAGACATGGTGGTGGTGG - Intergenic
1107739979 13:43439346-43439368 TTAGCCAGGCGTGGTGGCTGAGG - Intronic
1107945105 13:45411084-45411106 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1108033720 13:46265008-46265030 TTAGCCAGGCGTGGTGGTGGTGG + Intronic
1108401202 13:50046307-50046329 TTAGCCAGGCATGGTGGCCGGGG - Intergenic
1108498478 13:51047047-51047069 GAAGCCAAACATGATGGCAGTGG + Intergenic
1108594839 13:51940496-51940518 GTAGCTGGGCGTGGTGGCGGGGG + Intronic
1108623140 13:52203336-52203358 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1109029626 13:57176370-57176392 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
1109100218 13:58174496-58174518 TTAGCCAGGGGTGGTGGCACAGG + Intergenic
1109291282 13:60478449-60478471 TTAGCCACATGTGGTGGCACGGG - Intronic
1109378857 13:61531508-61531530 TTAGCCGGGCATGGTGGCAGGGG + Intergenic
1109495374 13:63164104-63164126 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1109790469 13:67240980-67241002 TTAGCCGGGCGTGGTGGCTGGGG + Intergenic
1110200265 13:72841625-72841647 TTAGCCAGGCGTGGTGGCACAGG + Intronic
1110310865 13:74047448-74047470 TTAGCCAGGCGTGGTGGCGGGGG + Intronic
1110326398 13:74221151-74221173 TTAGCCGGGCGTGGTGGCGGCGG - Intergenic
1110423778 13:75342049-75342071 TTAGCCAGCCATGGTGGCGGGGG + Intronic
1110447202 13:75599113-75599135 ATAGCCAGGCATGGTGGCACAGG - Intronic
1110621219 13:77598106-77598128 TTAGCCACACGTGGTGGCACAGG - Intronic
1110701421 13:78553124-78553146 TTAGCCAGGCGTGGTGGCACGGG + Intergenic
1110896715 13:80762126-80762148 TTAGCCAGATGTGGTGGCACAGG - Intergenic
1111055017 13:82938022-82938044 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1111191883 13:84819679-84819701 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
1111280501 13:86016870-86016892 TTAGCCGGTCGTGGTGGCGGGGG - Intergenic
1111355699 13:87099105-87099127 TTAGCCAGGCGTGGTGGCGCAGG + Intergenic
1111597107 13:90426539-90426561 TTAGCCAGGTGTGGTGGCATGGG - Intergenic
1111648113 13:91057507-91057529 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1112114469 13:96337211-96337233 TTAGCCGGGCATGGTGGCAGGGG - Intronic
1112132684 13:96541180-96541202 TTAGCCAGGTGGGGTGGCAGCGG - Intronic
1112172975 13:96993363-96993385 TTAGCCAGACGTGGTGGAACGGG - Intronic
1112279374 13:98049362-98049384 TTAGCCAGGCGTGGTGGCGCAGG - Intergenic
1112345825 13:98588350-98588372 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1112511830 13:100016508-100016530 TTAGCCAGGTGTGGTGGCATGGG + Intergenic
1112701519 13:102015052-102015074 TTAGCCAGGCGTTGTGGCACAGG - Intronic
1112783851 13:102930284-102930306 TTAGCCGGGCATGGTGGCAGGGG - Intergenic
1112972481 13:105277404-105277426 GTAGCCAGATATGGTGGCCTGGG + Intergenic
1113033799 13:106025815-106025837 TTAGCCAGGTGTGGTGGCATGGG + Intergenic
1113239479 13:108320463-108320485 TTAGCTGGGCGTGGTGGCAGGGG + Intergenic
1113563266 13:111301093-111301115 TTAGCCAGGCGTGGTGGCACAGG - Intronic
1113831713 13:113300669-113300691 TTAGCCAGGCGTAGTGGCACAGG + Intronic
1114147902 14:19999338-19999360 ATAGCCAGGAGTGGTGGCATGGG + Intergenic
1114218707 14:20677720-20677742 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
1114249951 14:20950753-20950775 TTAGCCAGGCGTGGTGGCACGGG - Intergenic
1114294229 14:21314874-21314896 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
1114303956 14:21403950-21403972 TTAGCCAGGTGTGGTGGCGGAGG + Intronic
1114316784 14:21516836-21516858 TTAGCTGGGCGTGGTGGCAGTGG - Intergenic
1114352166 14:21864815-21864837 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
1114458144 14:22870404-22870426 TTAGCCGGGCATGGTGGCAGCGG + Intergenic
1114538066 14:23435661-23435683 GGAGCCAGACCTGGTCTCAGGGG + Exonic
1114940102 14:27598462-27598484 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1115242064 14:31259588-31259610 TTAGCCAGACATGGTGGCATGGG + Intergenic
1115359175 14:32482274-32482296 GTAGCCAGAAATGTTGGCAGTGG - Intronic
1115438152 14:33400763-33400785 GTAGGGGGGCGTGGTGGCAGTGG + Intronic
1115593016 14:34882388-34882410 TTAGCCAGGCGTGGTGGCGTAGG + Intergenic
1115757914 14:36548197-36548219 CAAGCCAGAGGAGGTGGCAGTGG + Intergenic
1116010264 14:39343289-39343311 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1116076105 14:40112879-40112901 TTAGTCGGGCGTGGTGGCAGGGG + Intergenic
1116127549 14:40807621-40807643 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1116168203 14:41361635-41361657 TTAGCCAGGTGTGGTGGCAGGGG + Intergenic
1116340449 14:43716316-43716338 GAAGCCAGAAGTAGAGGCAGGGG + Intergenic
1116429270 14:44827155-44827177 TTAGGTGGACGTGGTGGCAGGGG + Intergenic
1116804560 14:49480131-49480153 TTAGCCAGGCATGGTGGCATGGG + Intergenic
1116964758 14:51002266-51002288 TCAGCCAGCCGTGGTGGCAGGGG - Intronic
1117010863 14:51469085-51469107 TTAGCCGGGCGTGGTGGCAGGGG - Intergenic
1117120346 14:52561324-52561346 GAAGCCAGGCGTGGTGGCACAGG + Intronic
1117276125 14:54195563-54195585 TTAGCCGAGCGTGGTGGCAGGGG + Intergenic
1117876532 14:60256270-60256292 TTAGCCAGGCGTGGTGGCACGGG + Intronic
1117883007 14:60329923-60329945 TTAGCCAGGCGTGGTAGCAGAGG - Intergenic
1117950813 14:61081183-61081205 TTAGCCAGACCTGGAAGCAGGGG + Intronic
1118403063 14:65396990-65397012 TTAGCCAGGCCTGGTGGCATGGG - Intergenic
1118750316 14:68802700-68802722 TTAGCTGGGCGTGGTGGCAGGGG + Intergenic
1118826861 14:69391499-69391521 GTAGCCAGGCATGGTGGCGCAGG + Intronic
1119005146 14:70919025-70919047 GTAGCTAGTTGTGGTGGCACAGG - Intronic
1119020332 14:71105686-71105708 ATAGCCGGGCGTGGTGGCAGGGG - Intronic
1119021556 14:71120409-71120431 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1119147423 14:72329880-72329902 GTAGCCAGAGGTGGGGAGAGGGG - Intronic
1119412288 14:74440365-74440387 TTAGCCGGGCGTGGTTGCAGGGG + Intergenic
1119497793 14:75095741-75095763 CTAGCCAGGTGTGGTGGCACTGG + Intronic
1119624622 14:76161887-76161909 TTAGCCAGGCGTGGTAGCACAGG + Intronic
1119695784 14:76712449-76712471 GTAGCCAGGCGTGGTGGTGCAGG + Intergenic
1119791963 14:77359052-77359074 TTAGCCAGGTGTGGTGGCATGGG - Intronic
1119838462 14:77772121-77772143 ATAGCCAGGCATGGTGGCATGGG - Intergenic
1120168807 14:81228558-81228580 ATAGCTGGCCGTGGTGGCAGAGG + Intergenic
1120214203 14:81664365-81664387 TTAGCCAGGCATGGTGGCGGCGG - Intergenic
1120238390 14:81919267-81919289 GAAGGCAGACGTGATGACAGAGG - Intergenic
1120293403 14:82606793-82606815 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
1120308182 14:82797169-82797191 GAAGCCAGGCATGTTGGCAGCGG + Intergenic
1120513312 14:85441151-85441173 TTAGCCAGGCGTGGTGGCCGTGG - Intergenic
1120568650 14:86090891-86090913 TTAGCTGGATGTGGTGGCAGGGG - Intergenic
1120601651 14:86517568-86517590 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
1120936262 14:89898509-89898531 TTAGCCACACATGGTGGCATGGG - Intronic
1120943978 14:89976681-89976703 TTAGCCAGGTGTGGTGGCAGTGG - Intronic
1121082305 14:91118230-91118252 TTAGCCAGGCGTGGTGGGGGTGG - Intronic
1121203503 14:92140765-92140787 TTTGCCAGACGTGGTGGTACAGG + Intronic
1121297087 14:92836918-92836940 TTAGCCAGGCGTGGTGGTAGTGG + Intronic
1121358515 14:93234352-93234374 TTAGCCTGGTGTGGTGGCAGGGG - Intergenic
1121520977 14:94586096-94586118 GTAGCCAGATGGGGAGGCATGGG + Intronic
1121609290 14:95264957-95264979 TTAGCCAGGTGTGGTTGCAGTGG + Intronic
1121768428 14:96508020-96508042 TTAGCTGGACGTGGTGGCACGGG - Intronic
1121895382 14:97642078-97642100 TTAGCCGGGCGTGGTGGCATGGG + Intergenic
1122261588 14:100526347-100526369 GTAGCTGGTTGTGGTGGCAGTGG - Intronic
1122285179 14:100647067-100647089 GTATCCTCACGTGGTGGGAGTGG - Intergenic
1122553902 14:102566189-102566211 TTAGCCAGGCTTGGTGGCACAGG - Intergenic
1122592240 14:102862250-102862272 ATAGCCAGACATGATGGCACTGG + Intronic
1122742281 14:103879160-103879182 TTAGCCAGGCGTGGTGGTGGGGG + Intergenic
1123118824 14:105907696-105907718 ATTGCCAGACCTGGAGGCAGGGG - Intergenic
1123484032 15:20668357-20668379 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
1123679963 15:22755962-22755984 TTAGCCAGGCGTGGTGGCAAGGG - Intergenic
1123708237 15:22966205-22966227 TTAGCCAGGCGTGGTGGCGTGGG + Intronic
1123737711 15:23201486-23201508 TTAGCCAGGCGTGGTGACCGGGG - Intergenic
1123779399 15:23610786-23610808 GAAGCTAGATCTGGTGGCAGAGG + Intronic
1123886409 15:24732028-24732050 GTATCCAGTCCTGGTGGCAGTGG - Intergenic
1123974712 15:25542227-25542249 TTAGCCAGGTGTGATGGCAGGGG + Intergenic
1124131829 15:26996794-26996816 TTAGCTGGGCGTGGTGGCAGGGG - Intronic
1124176338 15:27428026-27428048 TTAGCCAGGCATGGTGGCATGGG - Intronic
1124288919 15:28430154-28430176 TTAGCCAGGCGTGGTGACCGGGG - Intergenic
1124294304 15:28487157-28487179 TTAGCCAGGCGTGGTGACCGGGG + Intergenic
1124332176 15:28830407-28830429 TTAGCCAGGCGTGGTGGCATGGG - Intergenic
1124491578 15:30160843-30160865 TTAGCCAGTTGTGGTGGCATGGG - Intergenic
1124527131 15:30466695-30466717 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
1124751959 15:32377463-32377485 TTAGCCAGTTGTGGTGGCATGGG + Intergenic
1124771522 15:32540988-32541010 TTAGCCAGGCGTGGTGGCAGGGG - Intergenic
1124922317 15:34038922-34038944 GTAGCCAGAGGCGGCGGCGGAGG - Exonic
1125008391 15:34843361-34843383 TTAGCCAGATGTGGTGGCACAGG + Intergenic
1125309482 15:38363004-38363026 TTAGCCGGGCGCGGTGGCAGGGG - Intergenic
1125353931 15:38796802-38796824 GTAGCCAGATGTTGAGGTAGGGG - Intergenic
1125659989 15:41386262-41386284 GTAGCCAGACATGGTGGTGTGGG + Intergenic
1125694568 15:41624401-41624423 TTAGCTAGGCGTGGTGGCGGCGG - Intronic
1125840237 15:42793699-42793721 TTAGCCGGGCGTGGTGGCAAAGG + Intronic
1125949599 15:43740723-43740745 TTAGCCAGGTGTGATGGCAGGGG + Intergenic
1126317137 15:47382361-47382383 TTAGCCAGGCATGGTGGCGGGGG + Intronic
1126470478 15:49005181-49005203 TTAGCCAGGCATGGTGGCACAGG + Intronic
1126756426 15:51929714-51929736 TTAGCCAGGCTTGGTGGCACGGG - Intronic
1126783756 15:52160092-52160114 TTAGCCAGGTGTGGTGGCATGGG - Intronic
1127078222 15:55349027-55349049 TTAGCCGGGCGTGGTGTCAGAGG - Intronic
1127103620 15:55590429-55590451 TTAGCCAGGCGTGGTGGCACCGG + Intergenic
1127126321 15:55815698-55815720 TTAGCTGGACATGGTGGCAGAGG + Intergenic
1127216839 15:56832369-56832391 GTTGGCAGAGGTTGTGGCAGCGG + Intronic
1127218810 15:56854854-56854876 GTAGCCAGGCGTGGTGGCGGGGG + Intronic
1127426503 15:58864020-58864042 AAAGCCAGGCGTGGTGGCACTGG - Intergenic
1127495738 15:59510217-59510239 TTAGCCAGGCATGGTGGCACAGG + Intronic
1127515180 15:59686868-59686890 TTAGCCAGGAGTGGTGGCACTGG + Intronic
1127572955 15:60262062-60262084 TTAGCCAGGCATGGTGGCACAGG - Intergenic
1127915116 15:63448976-63448998 AAAGCCAGGCGTGGTGGCACGGG + Intergenic
1127988605 15:64094655-64094677 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
1128036410 15:64530159-64530181 TTAGCCAGGCGTGGTGGCATGGG - Intronic
1128081891 15:64861811-64861833 TTAGCCAGAGTTGGTGCCAGAGG + Intronic
1128119495 15:65134981-65135003 TTAGCCAGGCGTGGCAGCAGGGG - Intergenic
1128317494 15:66670292-66670314 ATAGCCAGACGTGGTGGGGAGGG - Intronic
1128847674 15:70916439-70916461 CTAGCCAGGTGTGGTGGCATGGG - Intronic
1129217953 15:74111715-74111737 TTAGCCAGGCATGGTGGCACGGG - Intronic
1129368863 15:75074856-75074878 TTATCCAGATGTGGTGGCACAGG + Intronic
1129800741 15:78412199-78412221 TTAGCCAGATGTGGTGGCTTGGG + Intergenic
1130109954 15:80955765-80955787 TTAGCCAGGCGTGGTGGCTCAGG - Intronic
1130510562 15:84585718-84585740 TTAGCCAGGTGTGGTGGCATGGG - Intergenic
1130512826 15:84603513-84603535 TTAGCCGGGCGTGGTGGCGGGGG - Intronic
1130688438 15:86059487-86059509 TTAGCCAGGCGTGGTGGCATGGG - Intergenic
1130771407 15:86927437-86927459 ATAGCCAGGTGTGGTGGCACAGG + Intronic
1130982523 15:88822580-88822602 TTAGCCAGGCATGGTGGCTGAGG - Intronic
1131066787 15:89439685-89439707 GTAGAGAGAGGTGATGGCAGAGG - Intergenic
1131090465 15:89621164-89621186 TTAGCTGGGCGTGGTGGCAGGGG - Intronic
1131203830 15:90424690-90424712 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1131327673 15:91463947-91463969 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
1131631592 15:94182280-94182302 TTAGCCAGGCATGGTGGCAGGGG + Intergenic
1132046375 15:98566157-98566179 TTAGCCAGTCATGGTGGCACGGG - Intergenic
1132068722 15:98755592-98755614 TTAGCTGGGCGTGGTGGCAGTGG + Intronic
1132111290 15:99104192-99104214 TTAGCCAGGCGTGGTGGCGCTGG + Intronic
1132287328 15:100672914-100672936 ATAGCCAGGTGTGGTGGCACAGG - Intergenic
1132499271 16:277780-277802 TTAGCCAAGCGTGGTGGCGGGGG - Intronic
1132856376 16:2046823-2046845 TTAGCCGGGTGTGGTGGCAGGGG + Intronic
1132919525 16:2378648-2378670 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1132948326 16:2545478-2545500 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1132993327 16:2808769-2808791 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1133095908 16:3445311-3445333 GTAGCCAGACTGGGGTGCAGTGG + Intronic
1133112881 16:3559786-3559808 TTAGCCAGTCGTGGTGGTGGTGG - Intronic
1133159532 16:3901252-3901274 TTAGCCAGGTGCGGTGGCAGGGG + Intergenic
1133215015 16:4286876-4286898 AAAGCCAGGTGTGGTGGCAGAGG - Intergenic
1133552215 16:6867570-6867592 TTAGCCAGGCGTGGTGGTACCGG + Intronic
1133606487 16:7393018-7393040 TTAGCCAGGTGTGGTGGCATGGG - Intronic
1133877034 16:9744739-9744761 TTAGCCAGGCATGATGGCAGGGG - Intergenic
1133887865 16:9847416-9847438 TGAGCCAGACATGGTGGCACAGG + Intronic
1133906251 16:10025446-10025468 ATAGTCAGATGTGGTGGCATAGG - Intronic
1134034898 16:11022314-11022336 GTAGCCAGACATGGTGACTCTGG - Intronic
1134132123 16:11657105-11657127 TTAGCCAGGTGTGGTGGCAGGGG - Intergenic
1134304136 16:13017164-13017186 TTAGCCAGGCATGGTGGCGGGGG - Intronic
1134338973 16:13327801-13327823 TTAGCCAGGCGTGGTGGCAGGGG - Intergenic
1134648656 16:15890981-15891003 TTAGCCGGGCGTGGTGGCAGAGG + Intergenic
1134799977 16:17075319-17075341 TTAGCCAGGCATGGTGGCGGGGG - Intergenic
1134836880 16:17368729-17368751 TTAGCCAGGCGTGGTGGCACAGG - Intronic
1135083265 16:19454192-19454214 TTATCCAGGTGTGGTGGCAGGGG - Intronic
1135159099 16:20077802-20077824 TTAGCCGGGCATGGTGGCAGAGG - Intergenic
1135206772 16:20491664-20491686 GGTGCCAGCAGTGGTGGCAGGGG + Intergenic
1135212113 16:20531968-20531990 GGTGCCAGCAGTGGTGGCAGGGG - Intergenic
1135489188 16:22893931-22893953 TTAGCCAGGCATGGTGGCATGGG - Intronic
1135611290 16:23869873-23869895 TTAGCCAGGCATGCTGGCAGAGG + Intronic
1135641244 16:24121523-24121545 TTAGCTGGACATGGTGGCAGTGG - Intronic
1135667766 16:24350442-24350464 TTAGCCAGACATGGTGGTGGTGG - Intronic
1136097308 16:27966356-27966378 TTAGCCAGCTGTGGTGGCACGGG + Intronic
1136170310 16:28485419-28485441 TTAGCCAGGCATGGTGGCATGGG + Intronic
1136240566 16:28940977-28940999 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1136464986 16:30436589-30436611 TTAGCCAGGCATGGTGGCACAGG - Intergenic
1136471240 16:30482036-30482058 TTAGCCAGGCGTGGTGGCACAGG - Intronic
1136501668 16:30673426-30673448 CTAGCCAAATGTGGTGGCACAGG - Intergenic
1136561976 16:31044623-31044645 TTAGCCAGGCATGGTGGCACGGG + Intergenic
1136583091 16:31166118-31166140 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1136588069 16:31200665-31200687 CTAGCCAGGTGTGGTGGCAGGGG + Intergenic
1136603633 16:31315602-31315624 GTAGCCAGGCATGGTGGCGGAGG - Intronic
1137419561 16:48320011-48320033 TTAGCCAGGCATGGTGGCAGGGG + Intronic
1137580996 16:49633534-49633556 GAAGCCAGAGGTAGTGGCAGTGG - Intronic
1137672841 16:50289610-50289632 TTAGCCAGGCGTGGTGGCATGGG - Intronic
1138579895 16:57933867-57933889 TTAGCCAGGCGTGGTGGCAGGGG - Intronic
1138631330 16:58296317-58296339 TTAGCCAGACTTGGTGGCACAGG - Intronic
1138818627 16:60231901-60231923 TTAGCCAGGCATGGTGGCACAGG - Intergenic
1138934113 16:61697645-61697667 TTAGCCAGATATGGTGGCACAGG - Intronic
1139217272 16:65138884-65138906 TTAGCCAGGCGTGGTGGCGGCGG + Intergenic
1139441518 16:66970253-66970275 TTAGCCGGGCATGGTGGCAGGGG - Intronic
1139534823 16:67565146-67565168 TTAGCCGGGCGTGGTGGCACGGG - Intronic
1139715600 16:68810717-68810739 TTAGCCGGTCGTGGTGGCGGGGG + Intronic
1139743268 16:69053916-69053938 TTAGCCAGGTATGGTGGCAGGGG + Intronic
1139765252 16:69223339-69223361 TTAGCCAGGCGTGGTGGCTGGGG - Intronic
1139773222 16:69296132-69296154 TTAGCCAGGCGTGGTGGCGCAGG + Intronic
1139795718 16:69481583-69481605 TTAGCCTGAAGTGGTGGCATGGG - Intergenic
1139915749 16:70427483-70427505 TTAGCCAGGCATGGTGGCGGGGG - Intronic
1140104490 16:71947109-71947131 TTAGCCAGGCATGGTGGCAGAGG + Intronic
1140197891 16:72870560-72870582 TTAGCCGGGAGTGGTGGCAGTGG + Intronic
1140268867 16:73444986-73445008 TTAGCCAGGTGTGGTGACAGGGG + Intergenic
1140505663 16:75470611-75470633 TTAGCCAGGCGTGGTGGTGGTGG - Intergenic
1140564993 16:76031567-76031589 TTAGCCAGATGTGGTGGCATGGG - Intergenic
1140776608 16:78254672-78254694 TTAGCCAGGCATGGTGGCAGTGG - Intronic
1140980359 16:80103352-80103374 TTAGCCAGGCATGGTGGCACAGG - Intergenic
1141049837 16:80750871-80750893 CTAGCCAGGCGTGGTGGCGGGGG + Intronic
1141367208 16:83454851-83454873 TTAGCCAGGTGTGGTGGCAGGGG - Intronic
1142158576 16:88545474-88545496 AGAGCCAGACGTGGTGGCCCAGG - Intergenic
1142288369 16:89180868-89180890 TTAGCCGGGCATGGTGGCAGGGG - Intronic
1142445894 16:90137318-90137340 TTAGGCAGGCGTGGTGGCAGAGG - Intergenic
1203142071 16_KI270728v1_random:1773326-1773348 TTAGCCAGGTGTGGTGGCATGGG - Intergenic
1142461615 17:98143-98165 TTAGGCAGGCGTGGTGGCAGAGG + Intergenic
1142546102 17:704195-704217 GTAGCCAGGTTTGGTCGCAGTGG - Intronic
1142640664 17:1283963-1283985 TTAGCCGGGCATGGTGGCAGTGG + Intronic
1142824617 17:2500968-2500990 TTAGCCAGGCGTGGTGGTAGAGG + Intronic
1142833361 17:2565914-2565936 TTAGCCAGGCTTGGTGGCACGGG + Intergenic
1142833762 17:2569200-2569222 TTAGCCAGGTGTGGTGGCACGGG + Intergenic
1142857644 17:2740818-2740840 TTAGCCAGGCATGGTGGCATGGG + Intergenic
1142892063 17:2950198-2950220 TTAGCCAGGCATGGTGGCACAGG - Intronic
1142914989 17:3129109-3129131 ATAGCCAGGTGTGGTAGCAGTGG - Intergenic
1143089056 17:4437931-4437953 TTAGCCAGATGTTGTGGCACAGG - Intronic
1143132733 17:4690573-4690595 TTAGCCAGGCGTGGTGGCAGAGG + Intronic
1143187303 17:5018125-5018147 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1143199896 17:5105239-5105261 GTAGCCAGGCATGGTGGCTCAGG + Intergenic
1143220672 17:5258644-5258666 TTAGCCAGGCATGGTGGCACGGG + Intergenic
1143301786 17:5915858-5915880 TTAGCCAGGCGTGGTGGGGGGGG - Intronic
1143463002 17:7115709-7115731 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
1143550111 17:7625428-7625450 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1143558605 17:7678109-7678131 TCAGCCAGGCATGGTGGCAGGGG - Intronic
1143561015 17:7695100-7695122 TTAGCCTGGCGTGGTGGCAGTGG - Intronic
1143577015 17:7799667-7799689 TTAGCCAGGCATGGTGGCGGGGG + Intronic
1143614898 17:8043920-8043942 TTAGCCAGGTGTGGTGGCATGGG + Intronic
1143657203 17:8302309-8302331 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1143980306 17:10863431-10863453 TTAGACAGGCGTGGTGGCTGTGG - Intergenic
1144009541 17:11133515-11133537 TTAGCCAGGCGTGGTGGTGGCGG + Intergenic
1144023358 17:11256347-11256369 GTAGCTGGGCGTGGTGACAGGGG + Intronic
1144030636 17:11319223-11319245 TTAGCCAGGCGTGGTGGCACAGG - Intronic
1144158064 17:12527462-12527484 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1144412482 17:15014479-15014501 TTAGCCAGGCGTGGTGGCATGGG + Intergenic
1144870199 17:18364747-18364769 TTAGCCAGGCGTGGTGGCGGAGG - Intergenic
1145182350 17:20764537-20764559 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
1145773059 17:27507284-27507306 TTAGCCAGGCCTGGTGGCAGGGG + Intronic
1145943039 17:28753652-28753674 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
1146023884 17:29302687-29302709 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1146201856 17:30865317-30865339 TTAGCCGGGCGTGGTGGCGGGGG - Intronic
1146217766 17:30992076-30992098 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1146323622 17:31866736-31866758 TTAGCCAGGTGCGGTGGCAGGGG + Intronic
1146338935 17:32002846-32002868 TTAGCCGGGCATGGTGGCAGTGG + Intergenic
1146351358 17:32097314-32097336 TTAGCCGGGCGTGGTGGCGGTGG - Intergenic
1146370061 17:32260525-32260547 CTAGCCAGGTGTGGTGGCATGGG - Intergenic
1146417499 17:32649716-32649738 TTAGCCAGACGTGGTGGCACAGG - Intronic
1146475120 17:33156607-33156629 TTAGCCAGGTGTGGTGGCATGGG + Intronic
1146503784 17:33387032-33387054 TTAGCCGGGCTTGGTGGCAGGGG - Intronic
1146603656 17:34239524-34239546 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1146667726 17:34716017-34716039 GAAGCCAGACTTGGTGGTGGTGG - Intergenic
1146800350 17:35814313-35814335 TTAGCCGGACGTGGTGGTGGTGG - Intronic
1146823026 17:35999868-35999890 GCAGCCAGGCGTGGTGGCTCAGG + Intronic
1146983215 17:37185713-37185735 TTAGCCGGGAGTGGTGGCAGGGG - Intronic
1147049470 17:37781013-37781035 TTACCCGGGCGTGGTGGCAGGGG - Intergenic
1147165371 17:38590380-38590402 TTAGCCAGGTGTGGTGGCACGGG - Intronic
1147274707 17:39305836-39305858 TTAGCCAGGCGTGGTGGTGGGGG + Intronic
1147282528 17:39374073-39374095 TTAGCCAGGCGTGGTGGTGGTGG + Intronic
1147343647 17:39771884-39771906 CTAGCCAGGTGTGGTGGCATGGG - Intronic
1147431065 17:40371125-40371147 ATAGCCGGGCGTGGTGGCACGGG + Intergenic
1147455439 17:40535102-40535124 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
1147529937 17:41266052-41266074 TTAGCCAGGCGTGGTGGCACAGG - Exonic
1147623172 17:41881741-41881763 GTAGCCAGACGTGGTGGCAGGGG - Intronic
1147693760 17:42335715-42335737 ATAGCCAGGCATGGTGGCATGGG + Intronic
1147737537 17:42649813-42649835 TTAGCCAGGCGCGGTGGCAGCGG + Intergenic
1147867930 17:43565909-43565931 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1147958186 17:44149393-44149415 TTAGCCAGGCATGGTGGCGGGGG - Intronic
1148055211 17:44790225-44790247 TTAGCCAGGCGTGGTGGCATAGG + Intergenic
1148057339 17:44808359-44808381 TTAGCCAGGTGTGGTGGCAGTGG + Intronic
1148094944 17:45045968-45045990 TTAGCTGGGCGTGGTGGCAGTGG - Intronic
1148516424 17:48222624-48222646 TTAGCCAAGTGTGGTGGCAGGGG - Intronic
1148611804 17:48969626-48969648 GAACCCAGACCTGGAGGCAGAGG + Intergenic
1148932243 17:51136608-51136630 TTAGCTAGGCGTGGTGGCACGGG + Intergenic
1149305282 17:55341252-55341274 TTAGCCAGAGGAGGTGGCACAGG - Intergenic
1149436733 17:56639680-56639702 GTAGCCAGTCTTGGTGGCAGCGG - Intergenic
1149768688 17:59302286-59302308 TTAGCCGGACGTGGTGGCGCGGG + Intergenic
1149894571 17:60419584-60419606 TTAGCCGGGCGTGGTGGCAGGGG + Intronic
1150097100 17:62386933-62386955 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1150189346 17:63221285-63221307 TTAGCCAGGCGTGGTGGTGGTGG + Intronic
1150191536 17:63245693-63245715 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
1150237254 17:63603084-63603106 TTAGCCAGGCGTGGTGGTGGCGG + Intronic
1150302416 17:64057513-64057535 TTAGCCGGGCATGGTGGCAGGGG - Intronic
1150611408 17:66736422-66736444 TTAGCCGGGCGTGGTGGCAGCGG - Intronic
1150683226 17:67299986-67300008 TTAGCCAGGCATGGTGGCATGGG + Intergenic
1150744334 17:67804091-67804113 TTAGCTGGGCGTGGTGGCAGCGG + Intergenic
1150772995 17:68057249-68057271 GTAGCCAGACATGGTGGCAGGGG + Intergenic
1150862029 17:68810454-68810476 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
1151223740 17:72633163-72633185 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
1151229538 17:72673919-72673941 TTAGCCAGGCGTGGTAGCATGGG + Intronic
1151559586 17:74863107-74863129 GTAGCCAGGCCTGGGGCCAGAGG + Exonic
1151648128 17:75447761-75447783 GTAGCCAGCCGTGGTGGTCCAGG - Intronic
1151846964 17:76663381-76663403 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
1151893446 17:76964546-76964568 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1151936164 17:77262946-77262968 TTAGCCAGGCGTGGTGGCGCAGG + Intergenic
1151994287 17:77598807-77598829 TTAGCCGGGCGTGGTGGCACGGG - Intergenic
1152083195 17:78201470-78201492 TTAGCCAGGTGTGGTGGCACGGG + Intronic
1152125103 17:78441934-78441956 GTAGCCAGGTGTGGTGGCACAGG + Intronic
1152149620 17:78590806-78590828 TTAGCCAGGCGTGGTGGCAAGGG - Intergenic
1152732965 17:81982113-81982135 TTAGCCAGGCATGGTGGCACAGG - Intronic
1152803903 17:82345656-82345678 GGAGCCAGATGTGGGGACAGCGG - Intergenic
1152836243 17:82534097-82534119 ATAGCCAGATGTTGTGGCAAGGG + Intronic
1152907714 17:82977989-82978011 GTTCCCACAGGTGGTGGCAGTGG + Intronic
1153045289 18:850341-850363 TTAGCCGGGCATGGTGGCAGGGG - Intergenic
1153216144 18:2822594-2822616 ATAGCCAGGTGTGGTGGCACAGG + Intergenic
1153245877 18:3072498-3072520 TTAGCCAGGCGTGGTGGTACAGG - Intronic
1154066995 18:11116566-11116588 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1154353317 18:13605362-13605384 TTAGCCAGGTGTGGTGGCATAGG - Intronic
1154380709 18:13847793-13847815 TCAGCCAGACGTGGTGGCCTGGG - Intergenic
1154437341 18:14357162-14357184 TTAGCCAGGCGTGGTGGCACAGG + Intergenic
1155003999 18:21711838-21711860 TTAGCCAGACATGGTGGCATGGG - Intronic
1155138073 18:23016395-23016417 TTAGCCAGGCGTGGTGGTACAGG + Intronic
1155145115 18:23077106-23077128 TTAGCCAGACGTGGTGGCGGGGG - Intergenic
1155278161 18:24210276-24210298 TTAGCCAGGCGTGGTGGTGGGGG + Intronic
1155330252 18:24708395-24708417 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
1155575452 18:27241028-27241050 TTAGCCAGACATGGTGGCATGGG - Intergenic
1156214498 18:34982028-34982050 TTAGCCAGGTGTGGTGGCGGGGG - Intronic
1156603423 18:38637976-38637998 TTAGCCAGATGTTGTGGCACAGG + Intergenic
1156736007 18:40261283-40261305 TTAGCCAGGCGCGGTGGCGGGGG - Intergenic
1156975541 18:43217727-43217749 TTAGCCAGGCATGGTGGCATGGG + Intergenic
1157164454 18:45345549-45345571 GAAGACAGACCTGGTGGGAGAGG - Intronic
1157278489 18:46329636-46329658 GGAGCCAGGCGTGGTGGCTCAGG - Intronic
1157501274 18:48192606-48192628 TTAGCCAGGCGTGGTGCCACGGG - Intronic
1157524980 18:48373812-48373834 TTAGCCAGGCATGGTGGCGGGGG + Intronic
1158147085 18:54326476-54326498 TTAGCCAGGCATGGTGGCACAGG - Intronic
1158263425 18:55634120-55634142 TTAGCCACGCGTGGTGGCAGGGG + Intronic
1158485974 18:57866124-57866146 TTAGCCAGATGGGATGGCAGGGG - Intergenic
1158529878 18:58250294-58250316 TTAGCCAGGCGTGGTGGTACGGG - Intronic
1158840701 18:61383432-61383454 TTAGCCAGGCATGGTGGCATGGG + Intronic
1158903340 18:61986791-61986813 TTAGCCGGGCGTGGTGGCAAAGG + Intergenic
1159259816 18:65999305-65999327 TTAGCCAGGCGTGGTGGCGCAGG - Intergenic
1159573864 18:70152088-70152110 GGAGCCAGAAGTGGAGACAGAGG - Intronic
1159700913 18:71625274-71625296 TTAGCCGGGCGTGGTGGCACAGG + Intergenic
1160070365 18:75622866-75622888 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
1160163016 18:76490237-76490259 GGAGCCTGCCGTGGTGTCAGGGG - Intronic
1160473152 18:79157247-79157269 CTAGCCAGTCATGGTGGCACAGG + Intronic
1160506779 18:79431847-79431869 TTAGCCGGGCGTGGTGGCGGAGG - Intronic
1160548527 18:79678820-79678842 TTAGCCAGGCGCGGTGGCTGAGG - Intergenic
1160651315 19:230510-230532 TTAGGCAGGCGTGGTGGCAGAGG + Intergenic
1160789000 19:914121-914143 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1160819323 19:1050488-1050510 GTGGCCAGGCGTGGTGGCTCAGG + Intronic
1160876018 19:1296516-1296538 TTAGCCAGGTGTGGTGGCATGGG + Intronic
1160999597 19:1903710-1903732 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
1161206475 19:3043835-3043857 TTAGCCAGGCATGGTGGCGGGGG + Intronic
1161245135 19:3247271-3247293 TTAGTCGGGCGTGGTGGCAGGGG - Intronic
1161246593 19:3255916-3255938 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
1161263895 19:3354046-3354068 TTAGCCAGGCGTGGTGGTGGTGG - Intergenic
1161335197 19:3709197-3709219 GGAGGCAGAGGTGGAGGCAGAGG - Intronic
1161397008 19:4050069-4050091 TGAGCCAGGTGTGGTGGCAGAGG - Intronic
1161441353 19:4293405-4293427 TTAGCCAGACGTAGTAGCGGGGG - Intronic
1161445366 19:4315756-4315778 TTAGCCAGGTGTGGTGGCGGGGG - Intronic
1161500570 19:4612525-4612547 TTAGCTGGGCGTGGTGGCAGGGG + Intergenic
1161506644 19:4647767-4647789 TTAGCCAGGCATGGTGGCACGGG - Intronic
1161548586 19:4897661-4897683 TTAGCCAGGCATGGTGGCATGGG - Intronic
1161877864 19:6925840-6925862 TTAGCCAGACATGGTGGCACAGG - Intronic
1161935647 19:7370347-7370369 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1162054978 19:8057164-8057186 TTAGCCAGGCGTGGTGGCGTGGG - Intronic
1162088124 19:8260802-8260824 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
1162111269 19:8401036-8401058 TTAGCCAGGCATGGTGGCACAGG - Intronic
1162631609 19:11931966-11931988 TTAGCCAGGCGTGGTGGCAGAGG + Intronic
1162636468 19:11971913-11971935 TTAGCCAGGCGTGGTGGCAGAGG + Intronic
1162644536 19:12039211-12039233 TTAGCCAGGCATGGTGGCACGGG - Intronic
1162644656 19:12040015-12040037 TTAGCCAGGCGTGGTGGTGGGGG + Intronic
1162695708 19:12472734-12472756 TTAGCCAGGTGTGGTGGCACGGG + Intronic
1162710378 19:12589208-12589230 TTAGCCAGGCATGGTGGCACAGG + Intronic
1162773938 19:12967392-12967414 TTAGCCAGGCATGGTGGCAGGGG + Intronic
1162894966 19:13759775-13759797 TTAGCCAGGCGTGGTGGTGGTGG - Intronic
1163043136 19:14617542-14617564 TTAGCCAGGCGTGGTGGCAGGGG - Intergenic
1163135949 19:15311142-15311164 TTAGCCAGGCATGGTGGCAAGGG + Intronic
1163206908 19:15810146-15810168 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1163599875 19:18242636-18242658 ATAGCCAGGCATGGTGGCATGGG + Intronic
1163660902 19:18576812-18576834 CTAGCCAGGCGTGGTGGTGGTGG - Exonic
1163841713 19:19615198-19615220 TTAGCCAGGCGTGGTGGCACAGG + Intronic
1163925781 19:20342095-20342117 TTAGCCAGGCGTGGTGGCGCAGG + Intergenic
1164039115 19:21478972-21478994 TTAGCCAGGTGTGGTGGCATAGG - Intronic
1164075829 19:21817093-21817115 TTAGCCAGGCATGGTGGCATGGG + Intronic
1164245563 19:23425447-23425469 TTAGCCAGCCGTGGTGGCATGGG + Intergenic
1164309593 19:24034102-24034124 CTAGCCAGGCGTGGTGGCGCAGG - Intronic
1164316365 19:24091637-24091659 CTAGCCAGGTGTGGTGGCACAGG - Intronic
1164654055 19:29907883-29907905 TTAGCCAGGCGTGGTGGCGCAGG - Intergenic
1164659638 19:29951691-29951713 GTAGCTGGGCGTGGTGGCAGAGG - Intronic
1164885518 19:31775183-31775205 TTAGCCAGGCATGGTGGCAGAGG - Intergenic
1165213329 19:34252603-34252625 TTAGCCAGGCGTGGTGGTGGAGG - Intergenic
1165213374 19:34252902-34252924 TTAGCCAGGCGTGGTGGTGGAGG - Intergenic
1165341934 19:35218833-35218855 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
1165362663 19:35346331-35346353 GTAGGCATCCGTGGTGGCAGAGG + Intronic
1165507222 19:36241335-36241357 TTAGCCAGATGTGGTAGCGGGGG + Intronic
1165575176 19:36809288-36809310 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1165619371 19:37232219-37232241 TTAGCCAGGCGTGGTGGCAGGGG - Intronic
1165619847 19:37236532-37236554 TTAGCCAGGCATGGTGGCACAGG - Intronic
1165678829 19:37755114-37755136 TTATCCGGGCGTGGTGGCAGGGG - Intronic
1165703049 19:37953075-37953097 TTAGCCAGGCGTGGTGGCGGAGG + Intronic
1165868602 19:38954414-38954436 TTAGCCAGGCGTGGTGGCAGAGG - Intronic
1165876699 19:39012811-39012833 TTAGCCAGACGTGGAGGCGCGGG + Intronic
1165920508 19:39294904-39294926 TCAGCCAGGCGTGGTGGCACAGG - Intergenic
1166009740 19:39933668-39933690 TTAGCCGGACATGGTGGCATGGG + Intronic
1166036558 19:40172373-40172395 TTAGCCAGGCGTGGTGGCACAGG + Intergenic
1166058838 19:40311800-40311822 GTAGCCAGGCGTGATGGTATAGG - Intergenic
1166095625 19:40537154-40537176 TTAGCCAGGCTTGGTGGCACAGG - Intronic
1166262325 19:41649115-41649137 GGGGCCAAACATGGTGGCAGAGG - Intronic
1166756313 19:45194257-45194279 TTAGGCAGACATGGTGGCACAGG - Intronic
1166788194 19:45382092-45382114 GTAGCCGGGCGTGGTGGTGGTGG + Intronic
1167007076 19:46783024-46783046 GCAGCCAGGCGGGCTGGCAGGGG + Intronic
1167076201 19:47250990-47251012 TTAGCCGGGCGTGGTGGCACTGG - Intergenic
1167081184 19:47277032-47277054 TTAGCCAGGCGTGGTGGCAGGGG - Intergenic
1167176756 19:47869934-47869956 TTAGCCAGATGTGTTGGCGGAGG - Intergenic
1167286612 19:48601993-48602015 TTAGCCAGGCGTGGTGGCGTGGG + Intronic
1167549551 19:50150690-50150712 TTAGCCGGACGTGGTGGCTGGGG + Intergenic
1167590321 19:50401140-50401162 TTAGCCAGGTGTGGTGGCATGGG + Intronic
1167700810 19:51044267-51044289 TTAGCTGGGCGTGGTGGCAGGGG - Intergenic
1167712072 19:51118200-51118222 TTAGCCGGGTGTGGTGGCAGAGG + Intergenic
1167842001 19:52129927-52129949 TTAGCCAGTCATGGTGGCAGGGG - Intronic
1167891203 19:52541096-52541118 TTAGCCAGGCGTGGTGGCGGGGG - Intronic
1167909826 19:52692565-52692587 TTAGCCAGGCGTGGTCGCACTGG - Intergenic
1167989581 19:53347028-53347050 TTAGCCAGGCATGGTGGCACAGG - Intronic
1168031902 19:53686832-53686854 TTAGCCGGGCGTGGTGGCATGGG - Intergenic
1168157871 19:54487076-54487098 ATAGCTGGGCGTGGTGGCAGAGG + Intergenic
1168215560 19:54922630-54922652 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1168264701 19:55216310-55216332 TTAGCCAGGCGTGGTGGCCAAGG - Intergenic
1168284450 19:55323647-55323669 TTAGCCAGGCATGGTGGCACCGG - Intronic
1168404790 19:56104979-56105001 TTAGCCAGGCCTGGTGGCAGGGG + Intronic
1168462583 19:56571753-56571775 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1168512001 19:56980351-56980373 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1168648654 19:58078354-58078376 TTAGCCGGGCATGGTGGCAGGGG + Intronic
1168699149 19:58425614-58425636 TTAGCCAGGCGTGGTGGTGGCGG - Intergenic
1168709361 19:58489813-58489835 TTAGCCAGGCGTGGTGGCGTGGG - Intronic
1168715413 19:58524213-58524235 TTAGCCAGGCGTGGTGGTGGTGG + Intronic
1168717476 19:58537982-58538004 TTAGCCGGGCGTGGTGGCACGGG - Intronic
925173906 2:1769021-1769043 TTAGCCAGATGTGGTGGCGGGGG + Intergenic
925349506 2:3190945-3190967 TTAGCCAGACATGGTGCCATGGG + Intronic
925753631 2:7111669-7111691 TAAGACAGACCTGGTGGCAGGGG + Intergenic
926042156 2:9681895-9681917 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
926313687 2:11693979-11694001 TTAGCCAGATGTGGTGGCTCAGG - Intronic
926720654 2:15957832-15957854 TTAGCCAGGCATGGTGGCATGGG + Intergenic
926890092 2:17632031-17632053 TTAGCCAGGCATGGTGGCATGGG - Intronic
926923390 2:17961448-17961470 GTAGCCAGAGGTGGAAGAAGAGG - Intronic
927522885 2:23711514-23711536 TTAGCTGGACGTGGTGGCAGGGG - Intergenic
927604769 2:24476942-24476964 TTAGCCGGGCGTGGTGGCACAGG + Intergenic
927689904 2:25201219-25201241 TTAGCCAGGTGTGGTGGCAAGGG - Intergenic
927745549 2:25616783-25616805 TTAGCCGGGCGTGGTGGCAGGGG + Intronic
927756189 2:25709955-25709977 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
927834911 2:26387547-26387569 TTAGCCAGATGTGGTGGTACAGG + Intronic
927896195 2:26784044-26784066 TTAGCCGGGCGTGGTGGCACGGG - Intronic
928092533 2:28383986-28384008 TTAGCCAGGCATGGTGGCAGGGG + Intergenic
928155589 2:28873490-28873512 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
928379965 2:30809309-30809331 GTAGACACAGGTAGTGGCAGGGG - Intronic
928508335 2:31977676-31977698 TTAGCCAGGCGTGGTGGTGGCGG - Intronic
928509226 2:31986250-31986272 TTAGCCGGGCGTGGTGGCAGGGG + Intronic
928509241 2:31986323-31986345 TTAACCAGGCGTGGTGGCGGGGG + Intronic
928511336 2:32006816-32006838 TTAGCCAGGCATGGTGGCGGGGG + Intronic
928540123 2:32276900-32276922 TTAGCCAAACATGGTGGCAGGGG + Intergenic
928541692 2:32291395-32291417 TTAGCCGGGCGTGGTGTCAGGGG + Intronic
928653829 2:33428647-33428669 TTAGCCAGGCATGGTGGCGGGGG - Intergenic
928680981 2:33701752-33701774 TTAGCCAGGCGTGGTGGCAGCGG + Intergenic
928695576 2:33846381-33846403 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
929119577 2:38473292-38473314 TTAGCCGGACGAGGTGGCATAGG + Intergenic
929152319 2:38758388-38758410 TTAGCCAGGCGTGGTGGCATGGG - Intronic
929400907 2:41580473-41580495 GTAGCCGGACATGGTGGCATGGG + Intergenic
929447282 2:42011335-42011357 GCAGCCGGGTGTGGTGGCAGGGG - Intergenic
929534357 2:42771279-42771301 ATAGCCAGGCATGCTGGCAGGGG + Intronic
929639892 2:43567478-43567500 TTAGCCAGGTGTGGTGGCAGAGG + Intronic
929686082 2:44035999-44036021 TTAGCCAGACATGGTGGCGGGGG + Intergenic
929721279 2:44371129-44371151 TTAGCCAGGTGTGGTGGCGGGGG - Intronic
929730477 2:44486109-44486131 TTAGCCAGGCGTGGTGGCACGGG - Intronic
929903380 2:46025190-46025212 ATTGCCAGACGTGGTGACTGAGG + Intronic
930080623 2:47444924-47444946 TTAGCCAGGCGTGGTAGCATAGG - Intronic
930106817 2:47646853-47646875 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
930177824 2:48317752-48317774 TAAGCCAGGCTTGGTGGCAGGGG - Intronic
930283316 2:49397150-49397172 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
930379201 2:50606101-50606123 TTAGCCAGGCATGGTGGCATAGG + Intronic
930630417 2:53747397-53747419 TTAGCCAGGCGTGGTGGCGGGGG + Intronic
930662158 2:54064935-54064957 TTAGCCAGGTGTGGTGGCACAGG + Intronic
931318865 2:61157185-61157207 TTAGCCAGGCGTGGTGGCGTGGG - Intronic
931424158 2:62155865-62155887 TTAGCCGGGCGTGGTGGCACGGG - Intergenic
931524222 2:63134974-63134996 TTAGCCAGGTGTGGTGGCACGGG + Intronic
931565042 2:63607388-63607410 TTAGCCAGGCGTGGTGGCACAGG + Intronic
931660392 2:64556132-64556154 TTAGCCGGGCGTGGTGGCATGGG - Intronic
931782693 2:65592372-65592394 TTAGCCAGGCGTGGTGGCAGGGG - Intergenic
932066929 2:68573524-68573546 GTAGCTGGGCGTGGTGGCGGGGG + Intronic
932219719 2:69990328-69990350 TTAGCCGGACATGGTGGCGGGGG - Intergenic
932473870 2:71987602-71987624 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
932723899 2:74160910-74160932 TTAGCCAGACGTGGTGACTAAGG + Intronic
932794430 2:74682267-74682289 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
932998359 2:76885610-76885632 TTAGCCGGACGTGGTGGCGGTGG - Intronic
933182379 2:79242050-79242072 TTAGCCAGGAGTGGTGGCGGGGG - Intronic
933208254 2:79535349-79535371 TTAGCTGGGCGTGGTGGCAGGGG - Intronic
933441393 2:82319103-82319125 TTAGCCGAGCGTGGTGGCAGGGG + Intergenic
933480532 2:82851603-82851625 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
933483623 2:82889945-82889967 TTAGACAGACATGGTGGCACAGG + Intergenic
933546301 2:83716967-83716989 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
933666059 2:84966033-84966055 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
933697390 2:85229859-85229881 ATAGCCGGACGTGGTGGCACAGG + Intronic
933822852 2:86130152-86130174 TTAGCCAGGCGTGGTGGCGAGGG + Intronic
933870378 2:86560116-86560138 TTAGCCAGATGTGGTGGCACGGG + Intronic
933960318 2:87404250-87404272 TTAGCTGGACGTGGTGGCACAGG + Intergenic
934244430 2:90295223-90295245 TTAGCTGGACGTGGTGGCACAGG + Intergenic
934694640 2:96390663-96390685 TTAGCCAGGCATGGTGGCATGGG + Intergenic
934702443 2:96453033-96453055 GTGCCTAGAAGTGGTGGCAGGGG - Intergenic
934745345 2:96756154-96756176 GTAGCCAGTCTTGGGGACAGAGG + Intergenic
934750348 2:96789837-96789859 TTAGCCAGGCGTGGTGGCGCGGG - Intronic
934773492 2:96922818-96922840 TTAGCCAGGCGTGGAGGCTGAGG - Intronic
934923366 2:98364229-98364251 TTAGCCAGGCATGGTGGCATGGG + Intronic
935231204 2:101098243-101098265 TTAGCCAGGTGTGGTGGCAGGGG + Intronic
935713977 2:105923784-105923806 TTAGCCAGGCATGGTGGCTGGGG + Intergenic
935966195 2:108479046-108479068 TTAGCTGGACGTGGTGGCTGAGG + Intronic
936105722 2:109622978-109623000 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
936558674 2:113517865-113517887 TTAACCAGGCGTGGTGGCACGGG - Intergenic
936763448 2:115814878-115814900 GTAGCAAGATTTGATGGCAGAGG + Exonic
936763516 2:115815875-115815897 GTAGCAAGATTTGATGGCAGAGG + Intronic
936801230 2:116269018-116269040 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
936875261 2:117181326-117181348 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
937346638 2:121130177-121130199 GTAGCCAGATGTGGCTACAGAGG - Intergenic
938030565 2:127989243-127989265 TTAGCCAGGCGTGGTGGCGGGGG - Intronic
938046139 2:128122385-128122407 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
938206188 2:129425974-129425996 TTAGCTGGGCGTGGTGGCAGGGG - Intergenic
938903600 2:135818688-135818710 TTAGCCAGGCGTGGTGGTGGGGG + Intronic
939065305 2:137476684-137476706 TTAGCCTGGCGTGGTGGCTGAGG - Intronic
939147212 2:138430112-138430134 TCAGCCAGGCGTAGTGGCAGGGG + Intergenic
939170523 2:138689944-138689966 GTAGCTTGAGGGGGTGGCAGAGG + Intronic
939384540 2:141478688-141478710 TTAGCCGGCTGTGGTGGCAGGGG - Intronic
939494340 2:142910281-142910303 TTAGCCAGGTTTGGTGGCAGAGG - Intronic
939583824 2:143983618-143983640 TTAGCCGGGCATGGTGGCAGGGG - Intronic
939712636 2:145541913-145541935 TTAGCCAGGCATGGTGGCAAGGG - Intergenic
939757516 2:146132462-146132484 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
939984224 2:148814278-148814300 TTAGCCAGGCGTGGTGGCACAGG + Intergenic
940427078 2:153542171-153542193 TTAGCCAGTCGTGGTGGCACAGG + Intergenic
940655857 2:156487157-156487179 TTAGCCAGGTGTGGTGGCGGGGG + Intronic
940886029 2:158990060-158990082 TTAGCCAGGCGTGGTGGCAGGGG - Intronic
940886237 2:158991605-158991627 TTAGCCAGGCGTGGTGGCGGGGG + Intronic
940894623 2:159068884-159068906 TTAGCCAGGCGTGGTGGCACGGG - Intronic
941472782 2:165910254-165910276 TTAGCCGGGCGTGGTGGCAGGGG + Intronic
941516464 2:166486344-166486366 GGAGCCAGACTTGGTGCTAGGGG - Intronic
941807074 2:169720264-169720286 CTAGCCAGGCGTGGTGGCATGGG - Intronic
941835988 2:170021442-170021464 GTAACCTCACGTGGTGGAAGGGG + Intronic
941976912 2:171415496-171415518 TTAGCCAGGCATGGTGACAGGGG - Intronic
942040580 2:172058146-172058168 TTAGCCAGATGTGGTGGCTTGGG - Intronic
942238765 2:173939616-173939638 TTAGCCAGGTGTGGTGGCATGGG + Intronic
942602742 2:177658021-177658043 GTAGCCAGAGCTGGTGGCCAGGG + Intronic
942908779 2:181216144-181216166 TTAGCCAGATGTGGTGGCACGGG - Intergenic
943368074 2:186983977-186983999 TTAGCTAGGCGTGGTGGCACAGG - Intergenic
943582488 2:189701377-189701399 TTAGCCAGCCATGGTGGCATGGG - Intronic
943598930 2:189891368-189891390 TTAGCCAGGCATGGTGGCATGGG - Intronic
943763078 2:191631124-191631146 TTAGCCAGATGTGGTGGCACAGG - Intergenic
943927956 2:193812213-193812235 TTAGCCGGACGTGGTGGCTCAGG + Intergenic
944058232 2:195545643-195545665 TTAGCCAAACGTGGTGGCACAGG + Intergenic
944163477 2:196691792-196691814 TTAGCCAGGCGTGGTGGCATGGG + Intronic
944281882 2:197907383-197907405 TTAGCCAGGCGTGGTAGCACAGG - Intronic
944362223 2:198870500-198870522 TTAGCCAGGCGTGGTGGCGTAGG + Intergenic
944572910 2:201062499-201062521 TTAGCCAGGCGTGGTGGTGGCGG + Intronic
944657090 2:201886470-201886492 TTAGCCAGGCGTGGTGGCACAGG - Intronic
944696360 2:202203914-202203936 TTAGCCAGGCATGGTGGCGGGGG - Intergenic
944704762 2:202277323-202277345 CTAGCCAGGCATGGTGGCACAGG + Intronic
944712818 2:202350502-202350524 TTAGCCAGGCGTAGTGGCTGAGG + Intergenic
944713744 2:202359026-202359048 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
945269881 2:207927367-207927389 TTAGCCAGGTGTGGTGGCATAGG + Intronic
945311120 2:208314748-208314770 TTAGCCAGGCGTGGTGGCGCTGG + Intronic
945493490 2:210482447-210482469 TTAGCCAGGCGTGGTGGCACGGG - Intronic
945680162 2:212904066-212904088 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
945893433 2:215455761-215455783 TTAACCAGACATGGTGGCAGAGG - Intergenic
946072495 2:217046613-217046635 TTAGCCAGGTGTGGTGGCAGGGG - Intergenic
946300300 2:218819738-218819760 TTAGCCAGGCATGGTGGCGGAGG - Intergenic
946406974 2:219496995-219497017 GGACCCTGACGTGGTGGCACTGG + Intronic
946651256 2:221894253-221894275 TTAGCCAGGCGTGGTGGTGGTGG + Intergenic
946665169 2:222041823-222041845 TTAGCCAGGCGTGGTGGCACAGG + Intergenic
946877894 2:224148213-224148235 TTAGCCAGGCGCGGTGGCATGGG + Intergenic
946951880 2:224885144-224885166 TTAGCCAGATGCGGTGGCACAGG - Intronic
947073384 2:226316166-226316188 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
947420790 2:229939934-229939956 TTAGCCAGGCGTGGTGGCGCAGG + Intronic
947495885 2:230636394-230636416 TTAGCCAGGCATGGTGGCACGGG + Intergenic
947737146 2:232461535-232461557 TTAGCCAGGCGTGGTGGTGGGGG + Intergenic
947761250 2:232605301-232605323 TTAGCCGGGCGTGGTGGCATGGG + Intergenic
948054131 2:234998720-234998742 GTAGCCAGAGGCGGGGGCAGGGG - Intronic
948597876 2:239092090-239092112 TTAGCCAGATGTGGTGGCCTGGG + Intronic
948969915 2:241417467-241417489 TTAGCCAGGCGTGGTGGCGGAGG - Intronic
1168755691 20:315876-315898 TTAGCCGGGCGTGGTGGCACGGG - Intergenic
1168766724 20:386717-386739 TTAGCCAGGCGTGGTGGCGTGGG - Intronic
1168767273 20:390179-390201 TTAGCCGGGCATGGTGGCAGGGG + Intronic
1168768735 20:399940-399962 ATAGCCAGGCGTGGTGGCATGGG + Intergenic
1168776573 20:453000-453022 TTAGCCGGGCGTGGTGGCACAGG + Intronic
1168813539 20:721528-721550 GAAGGCAGACGTGGGTGCAGAGG + Intergenic
1168904816 20:1394631-1394653 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1168974616 20:1954792-1954814 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1169044172 20:2522877-2522899 GGAGGCAGAGGTTGTGGCAGCGG + Intronic
1169088538 20:2841898-2841920 TTAGCCGGGCGTGGTGACAGGGG - Intronic
1169164414 20:3409434-3409456 TTAGCCAGGCTTGGTGGCACAGG - Intergenic
1169242707 20:3998157-3998179 GTGGCCAGGCGTGGTGGCTCAGG + Intronic
1169440438 20:5629479-5629501 TTAGCCAGGTGTGGTGGCTGGGG - Intergenic
1170318207 20:15065506-15065528 TTAGCCAGGCTCGGTGGCAGCGG + Intronic
1170694848 20:18648847-18648869 TTAGCCGGGTGTGGTGGCAGGGG + Intronic
1170985940 20:21258597-21258619 CTAGCCAGGCGTGGTGGCACAGG + Intergenic
1171061048 20:21960467-21960489 TTAGCCGGGCGTGGTGACAGGGG - Intergenic
1171131853 20:22661306-22661328 TTAGCCAGGCATGGTGGCGGGGG - Intergenic
1171251080 20:23648069-23648091 TTAGCCAGGCGTGATGGCACAGG + Intergenic
1171385337 20:24765968-24765990 GCAGCCAGCGGTGGAGGCAGTGG - Intergenic
1171440275 20:25155147-25155169 CTAGCCAGGCGTGGTGGTACAGG - Intergenic
1171467062 20:25337114-25337136 TTAGCCAGACGTTGTGGTGGTGG + Intronic
1171474492 20:25397676-25397698 TTAGCCAGGCGTGGTGGTGGAGG + Intergenic
1171868467 20:30507811-30507833 TTAGCCAGGCCTGGTGGCATGGG - Intergenic
1171980617 20:31625865-31625887 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
1172019585 20:31904502-31904524 TTAGCCAGGCATGGTGGCATGGG - Intronic
1172272329 20:33661795-33661817 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1172293918 20:33794712-33794734 TTAGCCAGATGTGGTGGCCCTGG + Intergenic
1172306961 20:33887637-33887659 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
1172406927 20:34696699-34696721 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1172415687 20:34765308-34765330 TTAGCCAGGCATGGTGGCATGGG + Intronic
1172433140 20:34909219-34909241 GTAGCCAGACATGGTGACTCTGG + Intronic
1172466893 20:35161935-35161957 TGAGCCAGGCGTGGTGGCAGGGG + Intergenic
1172502873 20:35439372-35439394 TCAGCCAGGTGTGGTGGCAGGGG - Intronic
1172524098 20:35587187-35587209 GAGGCCAGGCGTGGTGGCTGAGG + Intergenic
1172658716 20:36552123-36552145 TTAGTCAGGCGTGGTGGCACAGG - Intergenic
1172715296 20:36958674-36958696 TTAGCCAGGCATGGTGGCAAAGG + Intergenic
1172758158 20:37301996-37302018 GCAGCCAGAGGTGTGGGCAGGGG + Intronic
1172849783 20:37953240-37953262 TTAGCCAGGCTTGGTGGCACAGG - Intergenic
1172892540 20:38277165-38277187 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1173471107 20:43324183-43324205 TTAGCCAGGCATGGTGGCATAGG - Intergenic
1173799282 20:45884862-45884884 TTAGCCAGGTGTGGTGGCGGGGG + Exonic
1174245255 20:49174788-49174810 TTAGCCAGGCGTGATGGCGGGGG + Intronic
1174341023 20:49895482-49895504 TTAGCCAGGCGTGGTGGCAGGGG - Intergenic
1174394882 20:50241012-50241034 ATAGCCAGGCGTGGTGGCACGGG - Intergenic
1174448621 20:50606874-50606896 TTAGCCAGGCGTGGTGGCACGGG - Intronic
1174522072 20:51139358-51139380 TTAGCCGGGCGTGGTGGCATGGG - Intergenic
1174549637 20:51352645-51352667 TTAGCCAGGCGTGGTGGTGGTGG - Intergenic
1174574160 20:51525071-51525093 TTAGCCAGGCGTGGTGGCACAGG + Intronic
1174609333 20:51786234-51786256 TTAGCCGGGCGTGGTGGCGGTGG - Intronic
1174617875 20:51850291-51850313 TTAGCCAGGCGTGGTGACTGTGG + Intergenic
1174864158 20:54119542-54119564 GAAGTCAGCCTTGGTGGCAGTGG + Intergenic
1174934766 20:54855330-54855352 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1175146716 20:56902124-56902146 TTAGCCAGGCATGGTGGCAGTGG + Intergenic
1175333180 20:58178554-58178576 GTAGGCAGACGTTGTGGAAAGGG - Intergenic
1175885881 20:62290564-62290586 TTAACCGGGCGTGGTGGCAGGGG - Intronic
1176012257 20:62904632-62904654 TTAGCCAGGCATGGTGGCACGGG + Intronic
1176523844 21:7849958-7849980 TTAGCCAGGCGTGGTGGCATGGG + Intergenic
1176589839 21:8636457-8636479 TTAGCCAGGTGTGGTGGCAGGGG + Intergenic
1176704286 21:10100172-10100194 TTAGCCAGGCATGGTGGCACGGG - Intergenic
1176780818 21:13192704-13192726 TTAGCCAGGCGAGGTGGCGGCGG - Intergenic
1176839713 21:13828476-13828498 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1177104954 21:16944076-16944098 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
1177434791 21:21037173-21037195 ATAGCCAGGCGTGGTGGCGCAGG - Intronic
1177710788 21:24772012-24772034 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
1177798192 21:25801123-25801145 TTAGCTGGACGTGGTGGCGGGGG - Intergenic
1177926510 21:27222504-27222526 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
1178219242 21:30637523-30637545 TTGGCCAGGCGTGGTGGCGGCGG - Intergenic
1178234518 21:30825438-30825460 TTAGCCAGGCATGGTGGCGGCGG - Intergenic
1178266368 21:31146285-31146307 TTAGCCAGGTGTGGTGGCAGGGG + Intronic
1178333850 21:31726516-31726538 TTAGCCAGGCATGGTGGCAGAGG + Intronic
1178463296 21:32822921-32822943 TTAGCCAGGCGTGGTGGCACGGG + Intergenic
1178556623 21:33597014-33597036 TTAGCCAGGCATGGTGGCACAGG - Intronic
1178657864 21:34479970-34479992 TTAGCCAGGCGTGGTGGCATGGG + Intergenic
1178854753 21:36241145-36241167 TAAGCCAGGCATGGTGGCAGGGG + Intronic
1178883800 21:36468904-36468926 TTAGCCAGACGTGGTAGTGGGGG - Intronic
1178899894 21:36590598-36590620 TTAGCCAGGCATGGTGGCGGGGG - Intergenic
1178982081 21:37272986-37273008 TTAGCCAGGCGTGGTGGCGCAGG + Intergenic
1178993664 21:37377264-37377286 TTAGCCGGGCGTGGTGGCAGGGG - Intronic
1179068493 21:38049468-38049490 TTAGCTAGGCGTGGTGGCATGGG + Intronic
1179454065 21:41486444-41486466 TTAGCCAGACGTGGTGGTGCGGG - Intronic
1179658680 21:42861165-42861187 TTAGCCGGGCGTGGTGGCAGGGG + Intronic
1179672049 21:42956228-42956250 TTAGCCAGGTGTGGTGGCAAGGG + Intergenic
1179878659 21:44284405-44284427 GGGGCCAGAGGTGGTGGCCGAGG - Intergenic
1180272672 22:10613472-10613494 TTAGCCAGGTGTGGTGGCAGGGG + Intergenic
1180340315 22:11612693-11612715 TTAGCCAGGCCTGGTGGCATAGG + Intergenic
1180556765 22:16584549-16584571 TTAGCCAGGCGTGGTGGCGGAGG + Intergenic
1180669958 22:17545226-17545248 TTAGCCGGACGTGATGGTAGAGG + Intronic
1180893216 22:19306803-19306825 TTAGCCAGGTGTGGTGGCTGAGG - Intergenic
1180896504 22:19337936-19337958 TTATCCAGGCCTGGTGGCAGGGG - Intronic
1180942708 22:19670002-19670024 TTAGCCAGATGTAGTGGCACTGG - Intergenic
1180992223 22:19943493-19943515 TTAGCCCGGCGTGGTGGCATGGG + Intronic
1181280974 22:21720349-21720371 TTAGCCAGGCGTGGTGGCATGGG - Intronic
1181590185 22:23879400-23879422 TTAGCCAAGCGTGGTGGCACGGG - Intronic
1181673825 22:24439227-24439249 CTAGCCGGCCGTGGTGGCGGGGG - Intronic
1181700160 22:24616265-24616287 TTAGTCAGGCGTGGTGGCACAGG + Intronic
1181789875 22:25256814-25256836 TTAGCCAGGCGTGGTGGTGGCGG - Intergenic
1181916673 22:26286892-26286914 TTAGTCAGGCATGGTGGCAGGGG - Intronic
1182237833 22:28890351-28890373 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1182297821 22:29319836-29319858 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1182309454 22:29394298-29394320 TTAGCCAGGAGTGGTGGCACAGG - Intronic
1182333553 22:29568334-29568356 TTAGCCAGGCCTGGTGGCACAGG + Intronic
1182415085 22:30216353-30216375 TTAGCCAGGTGTGGTGGCATGGG + Intergenic
1182490175 22:30666473-30666495 TTAGCCAGGCGTGGTGGCATGGG + Intronic
1182522350 22:30891639-30891661 GTGGCCAGACCTGGGGGAAGGGG + Intronic
1182596351 22:31424009-31424031 TTAGCCAGGCGTGGCGGCACAGG - Intronic
1182604609 22:31493470-31493492 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1182725190 22:32439759-32439781 TTAGCCAGAGGTGGTGGCGCAGG - Intronic
1183010948 22:34946125-34946147 TTAGCCAGGCATGGTGGCACGGG + Intergenic
1183030592 22:35101178-35101200 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1183151711 22:36042781-36042803 ATAGCCAGGTGTGGTGGCACTGG - Intergenic
1183195026 22:36347586-36347608 TTAGCCAGGCGTGGTGGCACAGG + Intronic
1183218558 22:36497031-36497053 TTAGCCAGGTGTGGTGGCATGGG + Intronic
1183389567 22:37537697-37537719 TTAGCCAGATGTGGTAGCGGTGG - Intergenic
1183483403 22:38076899-38076921 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
1183503181 22:38193427-38193449 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1183527341 22:38331296-38331318 TTAGCCAGGCGTGGTGGCACAGG - Intronic
1183657660 22:39198298-39198320 GTAGCTGGACATGGTGGCATAGG - Intergenic
1183833849 22:40435783-40435805 TTAGCCAGGCGTGGTGGTGGTGG + Intronic
1183988257 22:41581175-41581197 TTAGCCAGGTGTGGTGGCATGGG + Intronic
1184142444 22:42585755-42585777 GCAGCCAGAAGTGGGGGCAGAGG - Exonic
1184374018 22:44100253-44100275 GTGGGCAGACATGTTGGCAGAGG + Intronic
1184497847 22:44852947-44852969 TTAGCCAGGCGTGGTGACACGGG - Intronic
1184529363 22:45044699-45044721 TTAGCCAGGCATGGTGGTAGAGG - Intergenic
1184625739 22:45727502-45727524 CTAGCCAGCCGTGGTGGCAGGGG - Intronic
1184634642 22:45817469-45817491 TTAGCCAGGCGTCGTGGCATGGG - Intronic
1184737032 22:46405311-46405333 TTAGCCAGGCGTCGTGGCAGGGG + Intronic
1184752792 22:46498463-46498485 TTAGCCGGGCGTGGTGGCAGGGG + Intronic
1184921358 22:47608026-47608048 TTAGCCAGGGGTGGTGGCATGGG - Intergenic
1184990251 22:48163250-48163272 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1185031059 22:48443248-48443270 TTAGCCAGGTGTGGTAGCAGGGG - Intergenic
1185200023 22:49496046-49496068 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1185319707 22:50194914-50194936 GCAGCCTGACGTGGTGGTCGTGG + Exonic
1203295779 22_KI270736v1_random:41959-41981 CAAGCCGGACGTGGTGTCAGAGG + Intergenic
949137449 3:585249-585271 TCAGCCAGGCGTGGTGGCAGGGG - Intergenic
949223288 3:1662060-1662082 TTAGCCAGACGTGGTGACTCAGG + Intergenic
949525857 3:4902691-4902713 ATAGCCAGATGTGGTGGCACAGG + Intergenic
949539725 3:5022886-5022908 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
949757963 3:7435657-7435679 CTAGCCGGATGTGGTGGCAAGGG - Intronic
949910209 3:8897923-8897945 TTAGCCAGGCGTGGTGGCACAGG + Intronic
949937466 3:9127188-9127210 TTAGCCAGGTGTGGTGGCATGGG + Intronic
950111101 3:10419210-10419232 GTGGCCACCCGTGGTGGGAGGGG - Intronic
950180658 3:10910966-10910988 TTAGCCAGGTGTGGTGGCGGGGG - Intronic
950515841 3:13464622-13464644 TTAGCCAGGCATGGTGGCACAGG - Intergenic
950553996 3:13684368-13684390 GGAGCCAGAGGTGGGGGTAGAGG + Intergenic
950804819 3:15590932-15590954 TTAGCCGGGCGTGGTGGCAGGGG + Intronic
950979251 3:17284262-17284284 TTAGCCAGACATGGTGGCAGGGG - Intronic
951095704 3:18627422-18627444 GTTGCCAGAGGAAGTGGCAGGGG + Intergenic
951218319 3:20044331-20044353 TTAACCAGGCGTGGTGGCAGAGG + Intronic
951218884 3:20049006-20049028 TTAGCCGGGCGTGGTGGCGGGGG - Intronic
951495389 3:23319666-23319688 TTAGCTGGATGTGGTGGCAGGGG + Intronic
951856111 3:27198924-27198946 TTAGCCAGGTGTGGTGGCACAGG + Intronic
951877252 3:27440896-27440918 TTAGCCAGCCATGATGGCAGAGG + Intronic
951886906 3:27533291-27533313 GTAGTCAGACCTGGGGGGAGAGG + Intergenic
952356246 3:32587134-32587156 TTAGCCAGATGTGGTGGCATGGG - Intergenic
952390997 3:32880170-32880192 TTAGCCAGGCGTGGTGGTACAGG - Intronic
952571978 3:34728966-34728988 GCAGCCAGGCGTGGTGGCTCAGG + Intergenic
952595904 3:35016962-35016984 TTAGCCGAGCGTGGTGGCAGGGG - Intergenic
952618690 3:35308317-35308339 TTAGCCAGGCGTGGTGGCATGGG - Intergenic
952758258 3:36891191-36891213 TTAGCCAGGCGTGGTGGCGGGGG + Intronic
953220363 3:40965231-40965253 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
953272104 3:41455790-41455812 GTAGCCTGAGCTGGTGGCAGTGG - Intronic
953397729 3:42586367-42586389 TTAGCCAGGCATGGTGGCACAGG - Intronic
953401145 3:42618589-42618611 TTAGCCAGGTGTGGTGGCACAGG - Intronic
953486710 3:43305628-43305650 TTAGCTAGGCGTGGTGGCAGGGG - Intronic
953593627 3:44285715-44285737 TTAGCCAGGCATGGTGGCACAGG - Intronic
953763261 3:45711251-45711273 CCAGGCAGAGGTGGTGGCAGAGG + Intronic
954071939 3:48149446-48149468 CTAGCCAGGCGTGGTGGCAGGGG - Intergenic
954158637 3:48703568-48703590 TTAGCCAGGCATGGTGGCAGGGG + Intronic
954168892 3:48783725-48783747 TTTGCCAGGCGTGGTGGCACAGG - Intronic
954221381 3:49156520-49156542 TTAGCCAGGCATGGTGGCACAGG + Intergenic
954237286 3:49266406-49266428 TTAGCCAGGCGTGGTGGCACAGG + Intergenic
954331446 3:49892805-49892827 TTAGACAGGTGTGGTGGCAGTGG + Intronic
954373537 3:50182811-50182833 GAAGCCAGAACTGGTGGAAGGGG - Intronic
954585827 3:51735579-51735601 TTAGCCAGGCGTGGTGGCAGGGG - Intergenic
955062339 3:55504123-55504145 TTAGCCAGACATGGTGGCACAGG + Intergenic
955293368 3:57713318-57713340 TTAGCCAGATGTGGTGGTGGGGG - Intergenic
955367929 3:58327407-58327429 TTAGCTAGGCATGGTGGCAGAGG - Intergenic
955371364 3:58354828-58354850 CTGGCCAGGTGTGGTGGCAGTGG + Intronic
956024009 3:64962832-64962854 TTAGCCAGGCGTGGTGGTGGGGG + Intergenic
956098568 3:65743560-65743582 TTAGCCGGGCGTGGTGGCATAGG + Intronic
956852364 3:73241409-73241431 TTAGCCAGGTGTGGTGGCACGGG - Intergenic
957178843 3:76850038-76850060 TTAGCCAGATGTGGTGGCACAGG + Intronic
957657317 3:83097205-83097227 TTAGCCAGGCATGGTGGCATGGG - Intergenic
958487927 3:94735117-94735139 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
958616747 3:96503298-96503320 TTAGCCAGCTGTGGTGGCACAGG - Intergenic
958637953 3:96769337-96769359 TTAGCCGGGCATGGTGGCAGAGG + Intergenic
958692041 3:97481059-97481081 CTTCCCAGACGGGGTGGCAGCGG + Intronic
959038806 3:101396988-101397010 TTAGCTGGGCGTGGTGGCAGGGG - Intronic
959053085 3:101542859-101542881 TTAGCCAGGCATGGTGGCACAGG + Intergenic
959057870 3:101586022-101586044 TTAGACAGGCGTGGTGGCACAGG + Intronic
959188819 3:103083268-103083290 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
959302268 3:104618487-104618509 TTAGCCAGGCATTGTGGCAGGGG + Intergenic
959419994 3:106117253-106117275 GGAGCCAGAAGGGGAGGCAGTGG + Intergenic
959704721 3:109329386-109329408 TTAGCCAGGCGTGGTGGCGGGGG + Intronic
960097336 3:113700743-113700765 TTTGCCAGGCATGGTGGCAGGGG + Intergenic
960807092 3:121594345-121594367 TTAGCCAGGCGTGGTGGCACAGG - Intronic
960959024 3:123056111-123056133 TTAGCCAGACGAAGTGGCATGGG + Intergenic
961417377 3:126769647-126769669 TTAGCCAGGAGTGGTGGCACAGG - Intronic
961526803 3:127507246-127507268 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
961750598 3:129091922-129091944 TTAGCTAGGCGTGGTGGCGGGGG + Intronic
961778108 3:129304608-129304630 GTAGCCAGAGGATGTTGCAGTGG + Exonic
961930495 3:130528242-130528264 GTTGCCAGAGAGGGTGGCAGTGG + Intergenic
962325531 3:134428867-134428889 GAAGCCAGCGGTGGTGACAGTGG + Intergenic
962518903 3:136179917-136179939 CTAGCCAGGCGTGGTGGCGGGGG + Intronic
962545373 3:136428987-136429009 CTAGCTAGGCGTGGTGGCACAGG + Intronic
962592658 3:136906778-136906800 GTTGCCAGCTGTGGTGGTAGAGG + Intronic
962772969 3:138630334-138630356 GAAGCCACACGTGGTAGCACAGG + Intronic
963097895 3:141565130-141565152 TTAGCCAGGCATGGTGGCACAGG - Intronic
964167357 3:153725016-153725038 TTAGCCGGGCATGGTGGCAGGGG - Intergenic
965094472 3:164207021-164207043 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
965299874 3:166996167-166996189 TCAGCCAGGCATGGTGGCAGAGG - Intergenic
965571700 3:170180300-170180322 TTAGCCAGGCCTGGTGGCACAGG + Intronic
965937956 3:174138579-174138601 TTAGCCGGGCGTGGTGGCGGGGG - Intronic
966255814 3:177915793-177915815 AGAGGCAGATGTGGTGGCAGAGG - Intergenic
966364817 3:179173871-179173893 TTAGCCAGGTGTGGTGGCAGGGG - Intronic
966381161 3:179346916-179346938 GTAGCCGGGCGTGGTGGTGGCGG - Intergenic
966523911 3:180900590-180900612 TCAGCCAGGCGTGGTGGCACGGG + Intronic
966537732 3:181052975-181052997 TTAGCCAGACCTTGTGGCATAGG - Intergenic
966711450 3:182977580-182977602 TTAGCCAGGCGTGGTGGTGGGGG - Intronic
966814807 3:183881266-183881288 TTAGCCAGGCACGGTGGCAGGGG - Intronic
966815351 3:183885517-183885539 TTAGCCGGGCATGGTGGCAGGGG + Intergenic
966819898 3:183916046-183916068 TTAGCCAGGCGTGGTGGCACGGG + Intergenic
966990156 3:185221717-185221739 GTAGCCGGGGGTGGTGGCATGGG - Intronic
967063786 3:185896060-185896082 TTAGCCAGGAGTGGTGGCATGGG - Intergenic
967279235 3:187806199-187806221 CGAGCCAGAGGTGCTGGCAGAGG + Intergenic
967535774 3:190601129-190601151 TTAGCCAGGCATGGTGGCAGAGG - Intronic
968033472 3:195524373-195524395 TTAGCCAGGCTTGGTGGCATGGG + Intronic
968196949 3:196714315-196714337 GTAGCCAGGTGTGGTGGCGTGGG + Intronic
968366516 3:198189469-198189491 TTAGGCAGGCGTGGTGGCAGAGG - Intergenic
968469224 4:770907-770929 TTAGCCGGGTGTGGTGGCAGGGG + Intergenic
968484772 4:853942-853964 TTAGCTGGACGTGGTGGCACAGG - Intronic
969029423 4:4199557-4199579 TTAGCCGGGCGTGGTGGCACGGG - Intronic
969050170 4:4367304-4367326 GAAGCCAGATGTGGTGGCACAGG + Intronic
969127303 4:4960634-4960656 TTAGCCAGGCATGGTGGCACAGG - Intergenic
969232638 4:5842273-5842295 TTAGCCAGGCGTGGTGGCACAGG + Intronic
969483100 4:7457305-7457327 GCAGCCAGGCCTGGAGGCAGAGG + Intronic
969562141 4:7955999-7956021 TTAGCTGGGCGTGGTGGCAGGGG + Intergenic
969580630 4:8062583-8062605 TTAGCCAGGCGTGGTGGTGGGGG - Intronic
969732851 4:8967064-8967086 TCAGCCAGGAGTGGTGGCAGGGG + Intergenic
969851328 4:9959243-9959265 TTAGCCAGGCGTGGTGGCGGGGG + Intronic
970036838 4:11745934-11745956 TTAGCCGGGCATGGTGGCAGTGG + Intergenic
970757200 4:19441127-19441149 TTAGCCAGGTGTGGTGGCAGAGG - Intergenic
970789454 4:19839604-19839626 TTAGCCAGACGTGGTGGAGCAGG - Intergenic
970823158 4:20242974-20242996 CTAGCCAGATGTGGTGGCACAGG - Intergenic
971030446 4:22631290-22631312 TTAGCCAGGCGTGGTGGCGCAGG - Intergenic
971080718 4:23207817-23207839 TTAGCTGGGCGTGGTGGCAGGGG - Intergenic
971435234 4:26614822-26614844 TTAGCCAGGTGTTGTGGCAGGGG - Intronic
971679722 4:29681575-29681597 TTAGCCAGGTGTGGTGGCATGGG - Intergenic
971742952 4:30543305-30543327 TTACCCAGTTGTGGTGGCAGTGG + Intergenic
972227148 4:37026477-37026499 TTAGCCAGGCGTGGTGGTGGGGG - Intergenic
972242731 4:37210806-37210828 GGAGACAGAGGGGGTGGCAGTGG + Intergenic
972320508 4:37969490-37969512 TTAGCCAGGCATGGTGGTAGTGG - Intronic
972351640 4:38241840-38241862 TTAGCCAGGCATAGTGGCAGGGG + Intergenic
972475906 4:39449177-39449199 TTAGCCAGGCGTGGTGACAGTGG + Exonic
972496682 4:39640833-39640855 TTAGCCAGGCGTGGTGGCGGCGG - Intergenic
972514442 4:39798871-39798893 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
972539030 4:40023033-40023055 CTAGCCAGGCGTGGTGGTACAGG + Intergenic
972546850 4:40088037-40088059 GTAGCCGGGCGTGGTGGCTCCGG - Intronic
972547583 4:40095225-40095247 TTAGCCAGGCGTGGTGGCATGGG - Intronic
972548431 4:40104947-40104969 TTAACCAGGCGCGGTGGCAGTGG - Intronic
972713600 4:41623612-41623634 TTAGCCAGGCGTGGTGGCATAGG + Intronic
972779135 4:42270705-42270727 TTAGCCAGGTGTGGTGGCACGGG + Intergenic
973268113 4:48231608-48231630 TTAGCCAGGCGTGGTGGCGGGGG + Intronic
973275538 4:48303031-48303053 TTAGCTGGGCGTGGTGGCAGGGG + Intergenic
973796152 4:54428677-54428699 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
974037947 4:56833403-56833425 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
974045613 4:56895945-56895967 TTAGCCAGGCGTGGTGGCGCAGG - Intergenic
974069178 4:57109290-57109312 TTGGCCAGGCGTGGTGGCACAGG + Intronic
974282722 4:59820237-59820259 TGAGCCAGGCGTGGTGGCGGGGG - Intergenic
975138849 4:70900602-70900624 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
975139418 4:70904127-70904149 TTAGCCAGGCGTGGTGGCGCGGG - Intronic
975780976 4:77839581-77839603 TTAGTCAGTCGTGGTGGCATAGG + Intergenic
975877115 4:78854418-78854440 TTAGCCAGGCATGGTGGCATAGG - Intronic
976430915 4:84963275-84963297 TTAGCCAGGCGTGGTGGCGAGGG + Intronic
976505379 4:85839994-85840016 TTAGCCAGGCATGGTGGCACAGG - Intronic
977195457 4:94053527-94053549 TTAGCCAGGCGTGGTGGCAGGGG - Intergenic
977206028 4:94166143-94166165 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
977232229 4:94465545-94465567 TTAGCCAGGTGTGGTGGCACAGG - Intronic
977546542 4:98388577-98388599 TTAGCTAGGTGTGGTGGCAGGGG + Intronic
977605344 4:98978973-98978995 GTATCCTCACGTGGTGGAAGGGG + Intergenic
977805987 4:101298454-101298476 GTAGGTAGAGGAGGTGGCAGGGG - Intronic
977819243 4:101453254-101453276 GTAGCCGGGCATGGTGGCACTGG - Intronic
978062529 4:104355206-104355228 TTAGCCAGGCATGGTGGCAGGGG + Intergenic
978237153 4:106473212-106473234 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
978443308 4:108757483-108757505 TTGGCCAGACATGGTGGCGGTGG + Intronic
978446408 4:108784802-108784824 TTAGCCAGACGTGGTGGTGCAGG + Intergenic
978494656 4:109346369-109346391 GCACCAAGAGGTGGTGGCAGTGG - Intergenic
978541654 4:109822464-109822486 GGTGGCAGAGGTGGTGGCAGAGG + Exonic
978604388 4:110463580-110463602 GTGGCCAGGCGTGGTGGCTGAGG - Intronic
978977747 4:114899322-114899344 TTAGCCTGGCGTGGTGGCACAGG - Intronic
979081529 4:116349704-116349726 TTAGCCAGGCGTGGTAGCAGGGG + Intergenic
979250536 4:118562505-118562527 TTAGCCAGGCGTGGTGGCACTGG + Intergenic
979309702 4:119188145-119188167 TTAGCCAGGCGTGGTGGTCGAGG + Intergenic
979333410 4:119441401-119441423 TCAGGCAGGCGTGGTGGCAGAGG + Intergenic
979492852 4:121348948-121348970 TTAGCCAGGAGTGGTGGCAGGGG + Intronic
979868471 4:125785720-125785742 TTAGCCAGGCGTGGTGGCTCAGG - Intergenic
980080812 4:128341943-128341965 TTAGCCAGGCGTGGTGGCATGGG - Intergenic
980107704 4:128603592-128603614 TTAGCCAGGTGTGGTGGCATGGG + Intergenic
980259346 4:130427581-130427603 TTAGCTGGGCGTGGTGGCAGGGG + Intergenic
980286972 4:130792168-130792190 ATAGCCGGGTGTGGTGGCAGGGG + Intergenic
980376501 4:131956508-131956530 TTAGCCAGGCATGGTGGCATGGG - Intergenic
980936075 4:139227162-139227184 TTAGCCGGGCATGGTGGCAGGGG - Intergenic
981251085 4:142601820-142601842 TTAGCCAGGTGTGGTGGCGGGGG + Intronic
981744010 4:148034462-148034484 TTAGCCGGGAGTGGTGGCAGGGG - Intronic
981810152 4:148765019-148765041 TTAGCCGGGCGTGGTGGCATAGG - Intergenic
982161026 4:152569516-152569538 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
982178316 4:152727387-152727409 CCAGCCAGACATGGTGGCACAGG - Intronic
982410497 4:155071046-155071068 TTAGCCGGGCGTGGTGGCCGGGG - Intergenic
982441428 4:155440724-155440746 TTAGCTGGACGTGGTGGCACGGG - Intergenic
982453802 4:155584111-155584133 TTAGCCGGGCGTGGTGGCATGGG + Intergenic
982541887 4:156682790-156682812 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
982954733 4:161749643-161749665 ATAGCCGGGCATGGTGGCAGGGG + Intronic
983090189 4:163494020-163494042 TTAGCCGGGCGTGGTGGCGGAGG + Intergenic
983124073 4:163928407-163928429 AGAGCTAGGCGTGGTGGCAGAGG + Intronic
983235279 4:165172090-165172112 TTAGCCTGGCGTGGTGGCGGGGG + Intronic
983271353 4:165565837-165565859 TTAGCCAGGCGTGGTGGCATGGG + Intergenic
983482945 4:168297747-168297769 TTAGCCAGGTGTGGTGGCACAGG + Intronic
983730208 4:170983722-170983744 TTAGCCTGGCGTGGTGGCAGGGG + Intergenic
983990627 4:174115015-174115037 GTAGCCAGGTGTGGTGGCGCAGG + Intergenic
984067060 4:175062033-175062055 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
984082689 4:175267946-175267968 TTAGCCAGGCATGGTGGCAAGGG + Intergenic
984360820 4:178729618-178729640 TTAGCCAGACTTGGGGGCACAGG - Intergenic
984366740 4:178808416-178808438 ATAGCCAGGCATGGTGGCACAGG - Intergenic
984551882 4:181170591-181170613 TTAGCTGGACGTGGTGGCACAGG + Intergenic
984682184 4:182623447-182623469 TTAGCCAGATGTGATGGCGGGGG - Intronic
984728952 4:183047864-183047886 TTAGCCAGGCTTGGTGGCATGGG - Intergenic
984867806 4:184297511-184297533 TTAGTCAGGTGTGGTGGCAGGGG + Intergenic
984916183 4:184726941-184726963 TTAGCCAGGCGTGGTGGTGGTGG + Intronic
984969142 4:185170836-185170858 TTAGCCAGGTGTGGTGGCACAGG + Intronic
985112136 4:186556507-186556529 TTAGCCGGGCGTGGTGGCACAGG + Intergenic
985275597 4:188234455-188234477 TTAGCCAGGTGTGGTGGCAGGGG + Intergenic
986063158 5:4210629-4210651 TTAGCCAGGCGTGGTGGCGGTGG + Intergenic
986390926 5:7287748-7287770 GGTGGCAGACGTGGTGGCATGGG - Intergenic
986401838 5:7389707-7389729 TTAGCCAGGCGTGGTGGCAGGGG - Intergenic
986415845 5:7527161-7527183 GTCCCCAGGGGTGGTGGCAGTGG + Intronic
986456037 5:7920044-7920066 TTAGCCAGGTGTGGTGGCGGGGG - Intergenic
986621550 5:9680914-9680936 TTAGCCAGGTATGGTGGCAGGGG + Intronic
987328863 5:16837161-16837183 TTAGCAGGGCGTGGTGGCAGAGG + Intronic
987365029 5:17141027-17141049 TTAGCCAGGCGTGGTGGTGGGGG + Intronic
987442390 5:17971590-17971612 ATGGCCAGACATTGTGGCAGAGG + Intergenic
987661618 5:20885757-20885779 TTAGCCAGGCATGGTGGCATGGG - Intergenic
987677981 5:21099474-21099496 TTAGCCTGGCGTGGTGGCGGGGG + Intergenic
987767825 5:22257644-22257666 TTAGCCAGGCATGGTGACAGTGG - Intronic
987883990 5:23789052-23789074 TTAGCCAGGCATGGTGGCACAGG + Intergenic
988039524 5:25871672-25871694 TTAGCCAGACGTGGTGGCACAGG + Intergenic
988201423 5:28074710-28074732 TTAGCCAGGTGTGGTGGCATGGG + Intergenic
988240777 5:28605315-28605337 TTAGCCAGATGCGGTGGCACAGG + Intergenic
988254760 5:28808102-28808124 TTAGTCAGGCGTGGTGGCACAGG - Intergenic
988512823 5:31880064-31880086 GTAGCCAGGCGTGGTGGTGGTGG - Intronic
988533272 5:32043382-32043404 GTAACCAGAGGTGGTGGATGTGG - Intronic
988677006 5:33442649-33442671 TTAGCCAGGCCTGGTGGCTGAGG - Intronic
988733060 5:33992561-33992583 TTAGCCAGGCCTGGTGGCACAGG + Intronic
988992046 5:36680768-36680790 TTAGCCAGGCCTGGTGGCACGGG + Intronic
989013102 5:36896743-36896765 TTAGCCAGGCATGGTGGCAAAGG - Intronic
989264255 5:39454933-39454955 TTAGCCAGGCGTGGTGGCAGGGG - Intronic
989269580 5:39516572-39516594 TTAGTCAGATGTGGTGGCACTGG - Intergenic
989416124 5:41178620-41178642 TTTGCCAGACGTGGTGGCGGGGG - Intronic
989635799 5:43531508-43531530 TTAGCCAGGCGTGGTGGCACAGG + Intronic
989672841 5:43938381-43938403 TTAGCCAGGCGTGGAGGCAGGGG + Intergenic
990019251 5:51105099-51105121 TTAGCCAGGCATGGTGGCATGGG - Intergenic
990089901 5:52030119-52030141 TTAGCCAGGCGTGGTGGCATGGG + Intronic
990782704 5:59384033-59384055 ATAGCCAGGTGTGGTGGCATGGG - Intronic
990847427 5:60158707-60158729 TTAGCCAGGAGTGGTGGCGGGGG - Intronic
990929673 5:61074611-61074633 TTAGCCAGTCGTGGTGGCACAGG + Intronic
991054206 5:62305040-62305062 TTAGCCAGGCGTGGTGGCGCGGG + Intergenic
991699418 5:69303164-69303186 TTAGCCAGATGTGGTGGCACTGG - Intronic
991971612 5:72147113-72147135 TTAGCCAGTCGTGGTGGCGCAGG - Intronic
992443536 5:76815019-76815041 TTAGCCAGACGTGGTGGCACAGG - Intergenic
992554991 5:77894132-77894154 TTAGCCAGGCATGGTGGCACAGG + Intergenic
992558423 5:77926411-77926433 TTAGCTGGATGTGGTGGCAGAGG + Intergenic
992682445 5:79166634-79166656 TTAGCCGGGCGTGGTGGCAGGGG + Intronic
992750603 5:79857252-79857274 GTAGTTGGGCGTGGTGGCAGGGG + Intergenic
993178908 5:84523313-84523335 TTAGCTAGGCGTGGTGGCTGAGG + Intergenic
993542388 5:89168375-89168397 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
993612428 5:90071681-90071703 TTAGCCAGGCATGGTGGCGGGGG - Intergenic
993695129 5:91052579-91052601 TTAGCCAGGCGTGGTGGTGGGGG - Intronic
994411893 5:99417243-99417265 GTAGCCGGGCATGGTGGCACAGG - Intergenic
994481929 5:100347997-100348019 GTAGCCGGGCATGGTGGCACAGG + Intergenic
995109052 5:108407673-108407695 GTAGCCAGGTGTGGTGGCGTAGG + Intergenic
995156385 5:108918631-108918653 TTAGCCAGGCGTGGTGGCGGGGG - Intronic
995459450 5:112387480-112387502 TTAGCCAGGCATGGTGGCAGGGG + Intronic
995600534 5:113790737-113790759 TTAGCCAGGCGTGGTGGCACGGG + Intergenic
995698761 5:114909079-114909101 ATTGCCAGGCATGGTGGCAGGGG + Intergenic
995841700 5:116448197-116448219 TTAGCCAGGCGCGGTGGCGGGGG + Intronic
996105622 5:119498731-119498753 TTAGCCAGGCATGGTGGCACGGG + Intronic
996342458 5:122453904-122453926 TTAGCCAGATGTGGTGGCACAGG - Intronic
996370482 5:122747680-122747702 TTAGCCGGGCGTGGTGGCATGGG - Intergenic
996724153 5:126659312-126659334 TTAGCCAAGCGTGGTGGCATGGG + Intergenic
996726660 5:126678602-126678624 TTAGCCAGGTGTGGTGGCATGGG + Intergenic
997051549 5:130386925-130386947 TTAGCCAGGTGTAGTGGCAGGGG + Intergenic
997131716 5:131283638-131283660 TTAGCCAGGCATGGTGGCACAGG - Intronic
997344284 5:133175147-133175169 TTAGCCGGGCGTGGTGGCAGGGG - Intergenic
997457848 5:134030752-134030774 TTAGCCAGATGTGGTGGCAGAGG - Intergenic
997461001 5:134052438-134052460 TTAGCCAGGCGTGGTAGCATGGG - Intergenic
997462803 5:134065938-134065960 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
997485167 5:134225483-134225505 GGCGCCAGACGAGGTGGCAGGGG - Intronic
997558492 5:134822477-134822499 TTAGCCAGGCATGGTGGCACAGG - Intronic
997723433 5:136099635-136099657 TTAGCCAGGCATGGTGACAGGGG + Intergenic
997912704 5:137891828-137891850 TTAGCCGGGCGTGGTGGCACAGG - Intronic
997942895 5:138174447-138174469 TTAGCCAGGCATGGTGGCAAAGG + Intronic
997944827 5:138190759-138190781 GTGGCCAGGCATGGTGGCATAGG + Intronic
997953648 5:138261545-138261567 TTAGCCAGGCATGGTGGCAGGGG + Intronic
998255527 5:140584410-140584432 TTAGCCAGGCATGGTGGCAGGGG + Intronic
998438872 5:142139071-142139093 ATAGCCAGACATGGTAGCGGGGG + Intronic
998451959 5:142241632-142241654 ATAGCCAGGCGTGGTGGCAGGGG + Intergenic
998502609 5:142646497-142646519 GTAGCCGGGCGTGGTGGCACAGG - Intronic
998659370 5:144219358-144219380 TTAGCCAGACGCAGTGGCGGGGG - Intronic
998792159 5:145777575-145777597 GCAGCCAGCAGTGATGGCAGTGG - Intronic
999103667 5:149049622-149049644 TTAGCCAGACATGGTGGCCTGGG + Intronic
999933771 5:156463184-156463206 TTAGCCAGACGTGGTGGCCTGGG - Intronic
1000074972 5:157776464-157776486 TTAGCCAGGTGTGGTGGCATAGG - Intergenic
1000083915 5:157872521-157872543 TTAGCCGGGTGTGGTGGCAGGGG + Intergenic
1000190932 5:158909788-158909810 TTAGCTGGACGTGGTGGCACAGG + Intronic
1000602889 5:163296261-163296283 TTAGCCAGGCCTGGTGGCAGGGG - Intergenic
1000750176 5:165085579-165085601 TTAGCCGGGCGTGGTGGCACCGG + Intergenic
1000889527 5:166786443-166786465 CTAGCCAGGGGAGGTGGCAGTGG - Intergenic
1001031567 5:168266919-168266941 TTAGCCGGGCGTGGTGGCGGAGG + Intergenic
1001221885 5:169907534-169907556 GTTGCCAGTCATAGTGGCAGAGG + Intronic
1001886805 5:175299588-175299610 ATAGCCACACATGGTGGAAGGGG - Intergenic
1002141703 5:177145423-177145445 TTAGCCAGGCGTGGTGGCATGGG - Intronic
1002156999 5:177290552-177290574 TTAGCCAGGTGTGGTGGCAGGGG - Intronic
1002174222 5:177392314-177392336 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
1002476028 5:179466781-179466803 TTAGCCACGCGTGGTGGCAGGGG + Intergenic
1002539583 5:179897462-179897484 GTAGCTGGGCGTGGTGGCATGGG - Intronic
1002563079 5:180095827-180095849 TTAGCCAGGCGTGGTGGTAATGG - Intergenic
1002603507 5:180368746-180368768 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1002610185 5:180412605-180412627 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1002648272 5:180673135-180673157 CTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1002725739 5:181294679-181294701 TTAGGCAGGCGTGGTGGCAGAGG - Intergenic
1003432097 6:6048379-6048401 TTAGCCAGGTGTGGTGGCGGGGG - Intergenic
1003579438 6:7326270-7326292 TTAGCCAGGTGTGGTGGCGGGGG - Intronic
1004055190 6:12129061-12129083 GTAGCCAGGTGTGGTGGCTCAGG + Intronic
1004164283 6:13241884-13241906 CTAGCCAGGTGTGGTGGCACAGG + Intronic
1004222292 6:13757152-13757174 TTAGCCAGGTGTGGTGGCAGGGG + Intergenic
1004227258 6:13797559-13797581 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
1004263674 6:14130581-14130603 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1004424370 6:15497501-15497523 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1004614379 6:17276059-17276081 TTAGCTGGGCGTGGTGGCAGGGG + Intergenic
1004629319 6:17406538-17406560 TTAGCCAGGCGTGGTGGCATGGG - Intronic
1004694102 6:18018134-18018156 TTAGCCAGGCACGGTGGCAGGGG - Intergenic
1004858061 6:19771451-19771473 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
1005265143 6:24104501-24104523 TTAGCCAGGCATGGTGGCTGAGG + Intergenic
1005726192 6:28651100-28651122 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
1005751942 6:28891708-28891730 TTAGCCGGGCGTGGTGGCACGGG + Intergenic
1005985062 6:30867129-30867151 TTAGCTAGGCCTGGTGGCAGAGG - Intergenic
1006140509 6:31926477-31926499 TTAGCCGGGTGTGGTGGCAGGGG - Intronic
1006199039 6:32269824-32269846 TTAGCCGGGCGTGGTGGCAGGGG - Intergenic
1006853965 6:37119859-37119881 TTAGCCAGGCGTGGTGGCGTGGG + Intergenic
1006893379 6:37449085-37449107 TTAGCCAGGCATGGTGGCACAGG - Intronic
1007078080 6:39080487-39080509 GTAGCCAGGCCTAGTCGCAGAGG + Intronic
1007469732 6:42081327-42081349 TTAGCCAGGCGTGGTGGTGGTGG - Exonic
1007555433 6:42761765-42761787 ATAGCGAGACATGGTGGCACAGG + Intronic
1007566603 6:42856168-42856190 TTAGCCAGGCGTGGTGGTACGGG + Intronic
1007891622 6:45299204-45299226 TTAGCCGGATGTGATGGCAGGGG + Intronic
1008612510 6:53197386-53197408 TTAGCCAGACGTGGTAGGGGGGG - Intergenic
1008702909 6:54123078-54123100 TTAGCCGGGCGCGGTGGCAGAGG - Intronic
1009408471 6:63337314-63337336 TTAGCCAGGCATGGTGGCATAGG + Intergenic
1009435120 6:63608897-63608919 TTAGCCTGGCATGGTGGCAGGGG - Intergenic
1010210595 6:73360238-73360260 TTAGCGAGATGTGGTGGCAGGGG - Intergenic
1010215586 6:73398396-73398418 TTAGCCAGATATGGTGGCGGGGG - Intronic
1010818138 6:80384503-80384525 TTAGCCAGGCATTGTGGCAGGGG - Intergenic
1011219613 6:85040349-85040371 TTAGACAGGCATGGTGGCAGAGG + Intergenic
1011293558 6:85803255-85803277 TTAGCTAGATGTGGTGGCATGGG + Intergenic
1011477300 6:87760615-87760637 TTAGCCATGCGTGGTGGCACAGG - Intergenic
1011669150 6:89665558-89665580 TTAGCCAGGCGTGGTGGTGGGGG + Intronic
1011964871 6:93143121-93143143 TTAGCCGGGCGTGGTGGCGGCGG + Intergenic
1012082296 6:94775832-94775854 TTAGCCGGGCGTGGTGGCCGGGG - Intergenic
1012457066 6:99419001-99419023 TTAGCCGGACATGGTGGCACTGG + Intronic
1012683490 6:102212419-102212441 TTAGCCAGGTGTGGTGGCATGGG + Intergenic
1012886954 6:104857808-104857830 TTAGCCGGGCCTGGTGGCAGGGG + Intronic
1012899399 6:104989736-104989758 TTAGCCAGACATGGTGGCGCAGG - Intronic
1013049284 6:106516378-106516400 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1013263182 6:108467390-108467412 CTAGCCAGGTGTGGTGGCGGGGG - Intronic
1013517434 6:110901123-110901145 TTAGCCAGGCATGGTGGCAGGGG + Intergenic
1013517493 6:110901654-110901676 TTAACCAGGCATGGTGGCAGGGG - Intergenic
1014439344 6:121455833-121455855 TTAGCCAGGCGTGGTGGCACAGG + Intergenic
1014949471 6:127537950-127537972 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1015335302 6:132030291-132030313 GCAGCCAGGCGTGGTGGCTCAGG + Intergenic
1015369004 6:132429463-132429485 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
1015402435 6:132801177-132801199 CTAGCCAGGTGTGGTGGCACAGG - Intergenic
1015563727 6:134543876-134543898 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1015588863 6:134803543-134803565 TTAGCCTGGCGTGGTGGCGGAGG - Intergenic
1015770188 6:136760821-136760843 TTAGCCAGGCATGGTGGCACAGG + Intronic
1015875653 6:137819235-137819257 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1015967808 6:138712366-138712388 TTAGCCAGATGTGGTGGCACAGG - Intergenic
1016140869 6:140608012-140608034 TTAGCCAGGCGTGGTGGCACAGG - Intergenic
1016150505 6:140735616-140735638 TTAGCCAGGCGTGGTGGCGCGGG - Intergenic
1016460735 6:144278276-144278298 TTAGCCCGGCGTGGTGGCACAGG - Intergenic
1016834900 6:148467241-148467263 TTAGCTAGGCGTGGTGGCACAGG - Intronic
1017045038 6:150338999-150339021 ATAGCCTGGCGTGGTGGCACAGG + Intergenic
1017195364 6:151694638-151694660 TTAGCCAGGAGTGGTGGCATGGG + Intronic
1017478500 6:154824794-154824816 TTAGCTAGACGTGGTGGCACAGG + Intronic
1017489865 6:154935575-154935597 GTGGCCAGGCGTGGTGGCGCGGG + Intronic
1017652147 6:156593474-156593496 GTAGGCTGAGGAGGTGGCAGAGG - Intergenic
1017807449 6:157958039-157958061 TTAGCCAGGTGTGGTGGCATGGG - Intergenic
1017833035 6:158149136-158149158 TTAGCCAGGCGTGGTGGCGAGGG - Intronic
1017882446 6:158571441-158571463 GCAGCCAGGCGTGGTGGCTCAGG - Intronic
1018245464 6:161818477-161818499 TTAGCCAGGCATGGTGGCATAGG - Intronic
1018692687 6:166361737-166361759 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1018699689 6:166416595-166416617 GATGACAGAAGTGGTGGCAGAGG - Intronic
1018699737 6:166416835-166416857 GATGGCAGAAGTGGTGGCAGAGG - Intronic
1018734123 6:166674813-166674835 TTAGCTGGGCGTGGTGGCAGGGG - Intronic
1018844279 6:167544596-167544618 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1019574717 7:1731794-1731816 TTAGCCAGGCGTGGTGGTGGGGG - Intronic
1019661881 7:2229012-2229034 GTGGCCAGATGTGGTGGCTCAGG - Intronic
1019703527 7:2486758-2486780 TTAGCCAGGCATGGTGGCACAGG - Intergenic
1020030232 7:4927558-4927580 TTAGCCAGGCGTGGTGCCACAGG + Intronic
1020054987 7:5111459-5111481 TTAGCCAGGGGTGGTGGCGGGGG + Intergenic
1020168661 7:5827652-5827674 TTAGCTAGACATGATGGCAGGGG + Intergenic
1020185589 7:5957034-5957056 TTAGCCAGGCATGGTGGCAGTGG + Intronic
1020254024 7:6491781-6491803 TTAGCCAGGCGTGGTGGTGGGGG - Intergenic
1020297327 7:6767722-6767744 TTAGCCAGGCATGGTGGCAGTGG - Intronic
1020416263 7:7949483-7949505 TTAGCCAGGCGTGGTGGCAGGGG + Intronic
1020421286 7:8008441-8008463 TTAGCTGGACGTGATGGCAGGGG - Intronic
1020424860 7:8053467-8053489 TTAGCCAGACGTGGTGGTGTGGG - Intronic
1020447055 7:8280246-8280268 TTAGCCAGGCATGGTGACAGAGG - Intergenic
1020459869 7:8417312-8417334 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
1020629400 7:10622414-10622436 TCAGCCAGGCGTGGTGGCTGAGG + Intergenic
1020642637 7:10775451-10775473 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1020885605 7:13815801-13815823 TTAGCCAGGCGTGGTGGCTGGGG + Intergenic
1020887981 7:13843358-13843380 TTAGCCAGGTGTGGTGGCACGGG + Intergenic
1021149151 7:17128394-17128416 TTAGCCGGGCATGGTGGCAGTGG - Intergenic
1021712124 7:23426178-23426200 TTAGCCAGGCATGGTGGCACAGG + Intronic
1021860958 7:24905747-24905769 GTGGCCAGGCGTGGTGGCTCAGG + Intronic
1022492652 7:30832654-30832676 TTAGCCAGGTGTGGTGGCACGGG - Intronic
1022799717 7:33764477-33764499 TTAGCTTGGCGTGGTGGCAGGGG + Intergenic
1022997393 7:35770955-35770977 TTGGCCAGGCGTGGTGGCATGGG + Intergenic
1023132656 7:37018271-37018293 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1023182469 7:37498996-37499018 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
1023920678 7:44627141-44627163 TTAGCCGGGCGTGGTGGCACAGG - Intronic
1024070630 7:45782276-45782298 TTAGGCAGGCGTGGTGGCAGAGG - Intergenic
1024143933 7:46491869-46491891 TTAGCCAGATGTGGTGGCGGGGG + Intergenic
1024184766 7:46938916-46938938 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1024691641 7:51809264-51809286 CTAGCCAGGCGCGGTGGCACAGG - Intergenic
1025065446 7:55850928-55850950 TTAGCCAGTCATGGTGGCGGAGG + Intronic
1025135642 7:56409541-56409563 TTAGGCAGGCGTGGTGGCAGGGG + Intergenic
1025165172 7:56706002-56706024 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
1025193818 7:56917102-56917124 TTAGCCAGGCGTGGTGGTGGGGG + Intergenic
1025678127 7:63659840-63659862 TTAGCCAGGCGTGGTGGTGGGGG - Intergenic
1025802517 7:64799788-64799810 TTAGCCAGGCGTGGTGGCACAGG - Intronic
1025921256 7:65915236-65915258 TTAGCCAGGCATGGCGGCAGAGG - Intronic
1025928548 7:65977955-65977977 TTAGCCGGGCATGGTGGCAGGGG - Intronic
1026105799 7:67419706-67419728 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1026307665 7:69155626-69155648 TTAGCCAGGCATGGTGGCAAAGG + Intergenic
1026570369 7:71523969-71523991 CTAGCCAGATGTGGTGGCACAGG + Intronic
1026572891 7:71547309-71547331 TTAGCCAGGTGTGGTGACAGGGG - Intronic
1026577362 7:71583373-71583395 GTGGCCAGATGTGGTGGCTCAGG - Intronic
1026594872 7:71726090-71726112 TTAGCCAGGCGTGGTGGCGGGGG + Intergenic
1026636446 7:72086578-72086600 GTAGCCAGGCATGGTGGCACGGG - Intronic
1026712418 7:72754287-72754309 TTAGCCAGACGTGGTGGCAGCGG - Intronic
1026715191 7:72782728-72782750 TTAGCCAGGCATGGTGGCAAAGG + Intronic
1026722714 7:72845757-72845779 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1026736999 7:72955241-72955263 TTAGCCGGGCGTGGTGGCACGGG - Intergenic
1026797305 7:73374619-73374641 TTAGCCAGGCGTGGTGGCTGGGG + Intergenic
1026836805 7:73645171-73645193 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1026884316 7:73929658-73929680 TTAGCCAGGCGTGGTGGTGGGGG - Intergenic
1026902935 7:74046935-74046957 TTAGCCAGGTGTGGTGGCATAGG + Intronic
1026941998 7:74292531-74292553 TTAGCCAGTCTTGGTGGCATGGG - Intronic
1027106733 7:75409827-75409849 TTAGCCGGGCGTGGTGGCACGGG + Intronic
1027135478 7:75621089-75621111 TTAGCCTGGCTTGGTGGCAGAGG + Intronic
1027596148 7:80176789-80176811 TTAGCCAGGGGTGGTGACAGGGG + Intronic
1027795429 7:82687335-82687357 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
1027992253 7:85377317-85377339 TTAGCCAGGCGTGGTGGTGGAGG + Intergenic
1028048178 7:86150455-86150477 GAAGTCAGACGTGGTGGCTCAGG + Intergenic
1028431154 7:90748727-90748749 ATAGCCAGACATGATGGCATGGG - Intronic
1028703919 7:93815751-93815773 TTAGCCAGGTGTGGTGGCATGGG + Intronic
1028767027 7:94571188-94571210 TTAGCCAGGCATGGTGGCATGGG - Intergenic
1029098643 7:98109006-98109028 TTAGCCGGACATGGTGGCAGGGG - Intronic
1029248756 7:99221225-99221247 GTAGCCAGGCGTGGTGGCGGGGG + Intergenic
1029367108 7:100123665-100123687 TTAGCTGGGCGTGGTGGCAGGGG - Intronic
1029527626 7:101104708-101104730 TTAGCCGGGCATGGTGGCAGGGG - Intergenic
1029544760 7:101204725-101204747 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1029734576 7:102458421-102458443 TTAGACAGATGTGGTGGCACAGG + Intronic
1029906409 7:104098026-104098048 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1029919822 7:104251386-104251408 TTAGCCAGGCATGGTGGCAGAGG - Intergenic
1030009686 7:105153782-105153804 GCAGCCAGATGGGCTGGCAGAGG + Intronic
1030022657 7:105291190-105291212 GAAGCCAGAGATGATGGCAGGGG + Intronic
1030050876 7:105536303-105536325 TTAGCCAGGCGTGGGGGCACAGG - Intronic
1030664068 7:112254822-112254844 TTAGCCGGGCGTGGTGGCATGGG + Intronic
1030685874 7:112486627-112486649 TTAGCGGGACGTGGTGGCGGGGG + Intronic
1030823478 7:114124741-114124763 GAAAACAGAGGTGGTGGCAGAGG - Intronic
1031469020 7:122147053-122147075 TTAGCCAGGCATGGTGGCAAGGG + Intergenic
1032157674 7:129482522-129482544 TTAGCCAGGCGTGGTGGCATGGG - Intronic
1032539607 7:132692269-132692291 TTAGCCAGGCATGGTGGCGGGGG + Intronic
1032583007 7:133120668-133120690 ATAGCTGGGCGTGGTGGCAGGGG + Intergenic
1032833783 7:135654712-135654734 TTAGCCCGGCGTGGTGGCAGGGG + Intergenic
1032842067 7:135722095-135722117 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1033035197 7:137868937-137868959 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1033061915 7:138117870-138117892 TTAGCCAGGCGCGGTGGCGGGGG + Exonic
1033146861 7:138878613-138878635 TTAGCCAGGTGTGATGGCAGAGG + Intronic
1033172574 7:139096974-139096996 TTAGCCGGGCATGGTGGCAGAGG + Intronic
1033204493 7:139406196-139406218 TTAGCCAGGTGTGGTGGCATGGG - Intronic
1033235344 7:139633796-139633818 TTAGCCAGGCGTGGTGGCGCAGG + Intronic
1033332074 7:140425137-140425159 TTAGCCAGGCGTGGTGGCATTGG + Intronic
1033683473 7:143619286-143619308 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
1033701140 7:143838352-143838374 TTAGCCGGGCGTGGTGGCACAGG + Intergenic
1033842606 7:145393297-145393319 TTAGCCAGGCGTGGTCGCGGGGG + Intergenic
1033940021 7:146641178-146641200 TTAGCCAGGCATGGTGGCGGGGG + Intronic
1033947233 7:146735406-146735428 CTAGCCAGGCGTTGTGGCGGGGG + Intronic
1034064032 7:148119381-148119403 TTAGCCAGGTGTGGTGGCGGGGG + Intronic
1034179112 7:149124300-149124322 TTAGCCGGGCGTGGTGGCGGGGG - Intronic
1034182214 7:149147673-149147695 GGAGCCGGGCGCGGTGGCAGCGG + Exonic
1034183985 7:149160282-149160304 GTAGCCAGATGTGGTGGTGGGGG + Intronic
1034458447 7:151184873-151184895 TTAGCCAGGCATGGTGGCGGGGG + Intronic
1034477823 7:151297593-151297615 ATAGCCAGGCATGGTGGCACAGG + Intergenic
1034555609 7:151848669-151848691 TTAGCCAGGGGTGGTGGCGGGGG - Intronic
1034653903 7:152713402-152713424 TTAGCCAGGCATGGTGGCACAGG - Intergenic
1034682583 7:152940339-152940361 GCAGCCAAGGGTGGTGGCAGTGG + Intergenic
1034864240 7:154627340-154627362 TTAGCTGGACATGGTGGCAGGGG - Intronic
1035158939 7:156936873-156936895 TTAGCCAGGTGTGGTGGCATGGG - Intergenic
1035188303 7:157143012-157143034 TTAGCCAGACGTGGTGGTGCAGG - Intronic
1035856562 8:2982207-2982229 TTAGCCAGGCATGGTGGCAGGGG + Intronic
1035863538 8:3056513-3056535 ATAGCCAGGCGTGGTGGCCTGGG - Intronic
1036586433 8:10128230-10128252 TTAGCCAGGCGTGGTGGTGGAGG + Intronic
1036693971 8:10962770-10962792 TTAGCCAGGTGTGGTGGCGGGGG - Intronic
1036774768 8:11603411-11603433 TTAGCCAGGCATGGTGGCATGGG + Intergenic
1036805176 8:11826666-11826688 TTAGCCGGGCGTGGTGGCAAGGG + Intronic
1036809383 8:11857168-11857190 TTAGCCAAACGTGGTAGCACAGG - Intronic
1036845423 8:12166227-12166249 TCAGCCAGACATGGTGGCACAGG + Intergenic
1036866790 8:12408548-12408570 TCAGCCAGACATGGTGGCACAGG + Intergenic
1037113969 8:15201161-15201183 TTAGCCAGACTTGATGGCACAGG - Intronic
1037245957 8:16835087-16835109 TTAGCCAGGCGTGGTGGTACAGG + Intergenic
1037377335 8:18245067-18245089 TTAGCCAGGTGTGGTGGCATGGG + Intergenic
1037489574 8:19385480-19385502 GTGGCCAGGCGTGGTGGCTCAGG - Intronic
1037495766 8:19439315-19439337 GAAACCAGACGTGGTGGCCAAGG - Intronic
1037499809 8:19474719-19474741 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1037576434 8:20208849-20208871 TTAGCCAGGCATGGTGGCACAGG - Intronic
1037665389 8:20964657-20964679 GTGGCCACACGTGTTGGCTGTGG + Intergenic
1037672937 8:21030691-21030713 TTAGCCAGGCCTGGTGGCAGGGG - Intergenic
1038003165 8:23407512-23407534 TTAGCCAGGCGTGGTGGTATGGG + Intronic
1038636374 8:29290938-29290960 TTAGCCAGGCATGGTGGCACGGG - Intergenic
1038680214 8:29659906-29659928 TTAGCTGGGCGTGGTGGCAGAGG + Intergenic
1038801628 8:30754528-30754550 GCAGCCAAACAGGGTGGCAGTGG + Intronic
1039311416 8:36321648-36321670 TTAGCCAGGGGTGGTGGCGGCGG + Intergenic
1039452598 8:37687622-37687644 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1039705213 8:39999558-39999580 GTGGCCAGGCGTGGTGGCTCAGG - Intronic
1039898374 8:41732557-41732579 TCAGCCAGTCGTGGTGGCACAGG - Intronic
1040448386 8:47519636-47519658 TTAGCCAGGCATGGTGGCACAGG + Intronic
1040581482 8:48702152-48702174 GTGGCCAGACTTCTTGGCAGAGG + Intergenic
1040676395 8:49756232-49756254 TTAGCCAGACATGGTGGCATGGG - Intergenic
1040704784 8:50112667-50112689 TTAGCCAAGTGTGGTGGCAGGGG - Intronic
1040758764 8:50812576-50812598 TTAGCCAGACAGGGTGGCATGGG + Intergenic
1041063381 8:54058395-54058417 GTAGCCGGGCATGGTGGCACAGG + Intronic
1041243263 8:55867438-55867460 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1041291807 8:56315096-56315118 TTAGCCAGGCATGGTGGCACAGG + Intronic
1041822956 8:62060580-62060602 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1042169933 8:65981344-65981366 GCAACCAGACGTGGTGACATGGG - Intergenic
1042286510 8:67118270-67118292 GTAGCCAAAGGTGGTAGTAGGGG - Exonic
1042306186 8:67335894-67335916 TTAGCCGGGCGTGGTGGCAGTGG - Intronic
1042569678 8:70149385-70149407 TTAGCCAGACATGGTGGTGGTGG - Intronic
1042692857 8:71522754-71522776 TTAGCCAGGTGTGGTGGCATGGG - Intronic
1042866668 8:73362712-73362734 GGATCCAGGCGTGGTGGTAGTGG - Intergenic
1043050097 8:75375961-75375983 TTAGCCGGGCATGGTGGCAGGGG + Intergenic
1043325774 8:79049458-79049480 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
1043434618 8:80226291-80226313 TTAGCCAGGTGTGGTGGCGGGGG + Intronic
1043450435 8:80360911-80360933 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1043491394 8:80752686-80752708 TTAGCCAGGCGTGGTGGCACAGG - Intronic
1043680474 8:83018787-83018809 GTAGCCAGGCATGGTGGCATGGG + Intergenic
1043699148 8:83262189-83262211 TTAGCCAGGCGTGGTGGCATGGG + Intergenic
1043779092 8:84309869-84309891 TTAGCCGGTCGTGGTGGCGGGGG - Intronic
1043828556 8:84960037-84960059 TTAGCCAGATGTGGTGGCACGGG + Intergenic
1044583882 8:93850718-93850740 TTAGCCGGGCGTGGTGGCATGGG + Intergenic
1044650949 8:94494443-94494465 TTAGCCAGGCGTGGTGGCACAGG + Intronic
1045092036 8:98755994-98756016 TTAGCTGGGCGTGGTGGCAGGGG + Intronic
1045162830 8:99568435-99568457 TTAGCCAGGCGTGGTGGCGTGGG - Intronic
1045262503 8:100589152-100589174 TTAACCAGGCGTGGTGGCAGGGG + Intronic
1045490494 8:102664856-102664878 ACAGCCAGGCTTGGTGGCAGTGG - Intergenic
1045662016 8:104448007-104448029 AGAGCCAGCCGTGGTGGCATGGG + Intronic
1045781136 8:105864781-105864803 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1045936664 8:107687257-107687279 ATAGCCAGGCGTGGTGGTGGGGG + Intergenic
1046055961 8:109078782-109078804 CTAGCCAGGCATGGTGGCACGGG + Intergenic
1046084967 8:109421635-109421657 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1046110045 8:109711909-109711931 GTATCCAGACCAGCTGGCAGAGG + Intergenic
1046170704 8:110501438-110501460 TTAGCCGGGCATGGTGGCAGGGG + Intergenic
1046852214 8:118987415-118987437 TTAGCCAGACGTGGTGGTACAGG + Intergenic
1046956155 8:120064864-120064886 TTAGCCAGGCGTGGTGGTGGAGG - Intronic
1047361613 8:124174409-124174431 TTAGCCAGATGTGGTGGTGGGGG + Intergenic
1048148202 8:131866232-131866254 TTAGCCAGGTGTGGTGGCACGGG - Intergenic
1048344881 8:133569070-133569092 GTTGCTAGAAGTGATGGCAGAGG - Intronic
1048524897 8:135193447-135193469 GGAGCCAGCCGAGCTGGCAGAGG - Intergenic
1049842355 8:144780987-144781009 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1049980695 9:901471-901493 TTAGCCAGGCATGGTGGCAGGGG - Intronic
1050408030 9:5330489-5330511 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1050463120 9:5893994-5894016 GTGGCCAGACATGGTGGCGCTGG + Intronic
1050529578 9:6576611-6576633 TTAGCCAGGTGTGGTGGCAGGGG - Intronic
1050587774 9:7130903-7130925 TTAGCCAGGCATGGTGGCACAGG - Intergenic
1050732825 9:8728831-8728853 TTAGCCGGGCATGGTGGCAGGGG + Intronic
1051041762 9:12820354-12820376 TTAGCCGGGCGTGGTGGCGGGGG + Intronic
1052193027 9:25679652-25679674 TTAGCCGGGCGTGGTGGCACGGG + Intergenic
1052205623 9:25836069-25836091 TTAGCCGGGCGTGGTGGCAGGGG + Intergenic
1052299649 9:26939239-26939261 TTAGCCAGGTGTGGTGGCAGGGG + Intronic
1052307687 9:27029599-27029621 TTAGCCGGGCGTGGTGGCACAGG + Intronic
1052693726 9:31849602-31849624 TTAGCCAGGCGTGGTGGCACGGG + Intergenic
1052812971 9:33077344-33077366 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1052948732 9:34190434-34190456 TTAGCCAGGCATGGTGGCAAGGG - Intronic
1052951633 9:34218103-34218125 TTAGCCAGGCGTGGTGGCGGGGG + Intronic
1052981854 9:34456044-34456066 TTAGCCATGCGTGGTGGCAGGGG + Intronic
1053123028 9:35560375-35560397 GGAGACAGAAGAGGTGGCAGAGG + Exonic
1053205023 9:36178948-36178970 ATTGCCAGGCGTGGTGGCAGGGG - Intergenic
1053435707 9:38072791-38072813 TTAGCCGGGCGTCGTGGCAGGGG - Intergenic
1053467226 9:38317412-38317434 TTAGCCGGGCGTGGCGGCAGGGG + Intergenic
1053613112 9:39735121-39735143 TTAGCCGGGCGTGGTGGCGGGGG + Intergenic
1053641548 9:40087189-40087211 TTAGCCAGGCATGGTGGCACGGG - Intergenic
1053655287 9:40213196-40213218 TCAGCCAGGCGTGGTGGCGGGGG - Intergenic
1053764586 9:41378275-41378297 TTAGCCAGGCATGGTGGCACGGG + Intergenic
1053871155 9:42493065-42493087 TTAGCCGGGCGTGGTGGCCGGGG + Intergenic
1054240404 9:62607281-62607303 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1054322433 9:63684573-63684595 TTAGCCAGGCATGGTGGCACGGG - Intergenic
1054367404 9:64359410-64359432 TCAGCCAGGCGTGGTGGCGGGGG - Intergenic
1054529312 9:66163119-66163141 TCAGCCAGGTGTGGTGGCAGGGG + Intergenic
1054554537 9:66641803-66641825 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1054675031 9:67849149-67849171 TCAGCCAGGCGTGGTGGCAGGGG - Intergenic
1054781115 9:69166788-69166810 TTAGCCAGGCCTGGTGGCATGGG + Intronic
1055026485 9:71727912-71727934 TTAGCCAGCCGTGGTGGCAGGGG + Intronic
1055037349 9:71831967-71831989 TTAGCCAGGCATGGTGGCACTGG + Intergenic
1055088801 9:72341657-72341679 GTAGCCTTACATGGTGGAAGAGG + Intergenic
1055453438 9:76452113-76452135 TTAGCTGGATGTGGTGGCAGGGG - Intronic
1055497545 9:76870718-76870740 GTTTCCAGATGTGGTGGTAGGGG + Intronic
1055528916 9:77163792-77163814 TTAGCCAGGCATGGTGGCATGGG + Intergenic
1055536237 9:77248360-77248382 TTAGCCGGGCGTGGTGGCGGGGG - Intronic
1055608495 9:77996529-77996551 TTAGCCAGGCATGGTGGCACAGG + Intronic
1055681477 9:78720266-78720288 GTAACCTCACGTGGTGGAAGGGG + Intergenic
1055805444 9:80087924-80087946 TTAGCCAGGCGTGGTAGCACAGG + Intergenic
1055939051 9:81631953-81631975 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1055987311 9:82064397-82064419 TTAGCCGGGCGTGGTGGCAGCGG - Intergenic
1056126649 9:83541142-83541164 GTAGTCAGAGATGGTGGGAGAGG - Intergenic
1056286692 9:85094181-85094203 TTAGCCGGGCGTGGTGGCACAGG + Intergenic
1056387420 9:86110623-86110645 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1056431142 9:86529067-86529089 TTAGCCAGTCGTGGTGGTGGTGG + Intergenic
1056537263 9:87540334-87540356 TTAGCCAGGCATGGTGGCACAGG - Intronic
1056566179 9:87774671-87774693 TTAGCCGGGCGTGGTGGCAGGGG - Intergenic
1056598840 9:88030162-88030184 TTAGCCAGAAATAGTGGCAGGGG - Intergenic
1056827405 9:89885902-89885924 TTAGCCAGGTGTGGTGGCTGAGG + Intergenic
1056919155 9:90770920-90770942 TTAGCCAGCCATGGTGGCACAGG - Intergenic
1057011095 9:91601999-91602021 GTGGCCAGATGCGGTGGCTGAGG - Intronic
1057023128 9:91716087-91716109 TTAGCCAGGCATGGTGGCATGGG + Intronic
1057157131 9:92852681-92852703 TTAGCCAGGCGAGGTGGCAGGGG - Intronic
1057159866 9:92881879-92881901 TTAGTCAGGCGTGGTGGCGGCGG + Intergenic
1057470491 9:95351897-95351919 TTAGCAGGGCGTGGTGGCAGGGG - Intergenic
1057601017 9:96457217-96457239 TTAGCCAGGCGTGGTGGCGCAGG + Intronic
1057946289 9:99331996-99332018 TTAGCCAGGTGTGGTGGCAGGGG + Intergenic
1058388693 9:104469563-104469585 TTAGCTAGACATGGTGGCGGGGG + Intergenic
1058448775 9:105077136-105077158 TTAGCCAGGCATGGTGGCAGAGG - Intergenic
1058454303 9:105125042-105125064 TTAGCCAGGCGTGGTGGCAGGGG + Intergenic
1058485009 9:105434998-105435020 GTAACCAGGTGTGGTGGCACGGG + Intronic
1058690540 9:107516809-107516831 TTAGCCAGGCATGGTGGCATGGG + Intergenic
1058740702 9:107939512-107939534 TTAGCCAGGCGTGGTGGCACGGG + Intergenic
1058785125 9:108379374-108379396 GTGGCCTCACGTGGTGGAAGGGG - Intergenic
1058845563 9:108955107-108955129 TTAGCCAGGCGTGGTGGCAGAGG - Intronic
1058849193 9:108994083-108994105 TTAGCCAGGTGTGGTGGCAGGGG + Intronic
1058875411 9:109239881-109239903 GTAGAGAGAAGTGGTGGCAGTGG - Intronic
1058951317 9:109906343-109906365 TTAGCCAGGCATGGTGGCACAGG - Intronic
1059065223 9:111076457-111076479 TTAGCCAGGCGTGGTGGTGGTGG + Intergenic
1059103868 9:111494725-111494747 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1059115050 9:111593830-111593852 GTAGCCAGGCCTGGTGGCGCAGG - Intronic
1059406628 9:114102327-114102349 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1059545077 9:115167818-115167840 GTAGCCAGGCATGGTGGTACAGG - Intronic
1059698758 9:116755062-116755084 GAAGCCGGAGTTGGTGGCAGGGG - Intronic
1059946222 9:119411071-119411093 TTAGCCAGGTGTGGTGGCAGGGG - Intergenic
1060197835 9:121634808-121634830 CTAGCCACAGGTGGTGGCTGGGG - Intronic
1060277778 9:122194871-122194893 TTAGCCAGGTGTGGTGGCACGGG + Intronic
1060322027 9:122571401-122571423 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1060618188 9:125038108-125038130 TTAGCCAGACATGGTGGCACAGG + Intronic
1060942788 9:127552836-127552858 TTAGCCAGGCGTGGTGGTGGTGG - Intronic
1060972519 9:127746789-127746811 TTAGCCAGGCGTGGTGGCAGGGG + Intronic
1061021743 9:128020208-128020230 CTATCCAGGTGTGGTGGCAGTGG - Intergenic
1061023195 9:128030234-128030256 TTACCCAGACGTGGTGGCGCAGG + Intergenic
1061127617 9:128686826-128686848 TTAGCCAGGCAAGGTGGCAGTGG + Intronic
1061146905 9:128805189-128805211 TTAGCCAGGCATGGTGGCACAGG + Intronic
1061153500 9:128843018-128843040 TTAGTCAGGCATGGTGGCAGGGG + Intronic
1061157447 9:128872789-128872811 TTGGCCAGACGTGGTGGCTCAGG + Intronic
1061212273 9:129200823-129200845 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
1061278786 9:129585193-129585215 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1061748639 9:132758594-132758616 TTAGCCAGGCCTGGTGGCACAGG - Intronic
1061985499 9:134128006-134128028 ATAGCCGTGCGTGGTGGCAGGGG - Intergenic
1062297867 9:135843178-135843200 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1062372473 9:136247205-136247227 GGAGCCGGACCTGGTGGGAGCGG + Intergenic
1062512238 9:136912984-136913006 TTAGCCAGGTGTGGTGGCACAGG + Intronic
1062563466 9:137152051-137152073 GTAGCAGGGCGTGGTGGCAGGGG - Intronic
1062750875 9:138252321-138252343 TTAGGCAGGCGTGGTGGCAGAGG - Intergenic
1202789323 9_KI270719v1_random:70274-70296 TTAGCCAGGCATGGTGGCACGGG - Intergenic
1185552209 X:992239-992261 TTAGCCAGGTGTGGTGGCAGGGG - Intergenic
1185584475 X:1234864-1234886 TTAGCCAGGTGTGGTGGCGGGGG - Intergenic
1185628156 X:1497070-1497092 TTAGCCAGGCGTGGTGGTGGCGG + Intronic
1185659003 X:1711831-1711853 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1185665437 X:1761702-1761724 TTAGCCGGATGTGCTGGCAGGGG - Intergenic
1185724250 X:2406585-2406607 TTAGCCGAGCGTGGTGGCAGGGG - Intronic
1185810127 X:3100741-3100763 TTAGCCAGGCATGGTGGCACAGG - Intronic
1185949032 X:4410152-4410174 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1186018762 X:5229493-5229515 TTAGCCGGGCGTGGTGGCGGGGG - Intergenic
1186049749 X:5578255-5578277 CTAGCCAGACGTGGTGGTAAAGG + Intergenic
1186427570 X:9475390-9475412 TTAGCCAGGCGTGGTGGTGGTGG - Intronic
1186582509 X:10835869-10835891 GTAGCTGGGCGTTGTGGCAGGGG - Intergenic
1187030797 X:15486205-15486227 TTAGCTAGGCGTGGTGGCTGAGG + Intronic
1187189153 X:17016554-17016576 TTAGCCAGGCGTGGTGGCACAGG - Intronic
1187377778 X:18771966-18771988 TTAGCCAGGCCTGGTGGCACAGG + Intronic
1187532529 X:20109887-20109909 TTAGCCGGTTGTGGTGGCAGAGG + Intronic
1187535207 X:20135297-20135319 TTAGCCAGGCATGGTGGCACAGG + Intronic
1187688953 X:21844364-21844386 TTAGCCAGGCGTGGTGGTATGGG + Intronic
1187696921 X:21932127-21932149 GTAGCCAGGCGTGGTGGCATGGG - Intergenic
1188220391 X:27534062-27534084 TTAGCCAGGTGTGGTGGCACAGG + Intergenic
1188306308 X:28563527-28563549 TTAGCCAGGCATAGTGGCAGGGG + Intergenic
1188844023 X:35051552-35051574 TTAGCTAGGCGTGGTGGCAGGGG - Intergenic
1188955464 X:36430516-36430538 GTAGCCAGACATGCTGGCACAGG + Intergenic
1189191031 X:39106079-39106101 TTAGCCAGGCGTGGTGGCGGGGG - Intergenic
1189306157 X:39988154-39988176 TTAGCCAGGCATGGTGGCGGGGG + Intergenic
1189471726 X:41319957-41319979 TTAGCCAGGCGTGGTGGTGGGGG - Intergenic
1189831600 X:44980141-44980163 TTAGCCAGGCGTGGTGGCGTGGG - Intronic
1189930700 X:46006019-46006041 TTAGCCAGAGATGGTGGCGGGGG - Intergenic
1190023192 X:46897842-46897864 GTATCCACACGTGGTGGTGGTGG - Intronic
1190192381 X:48288259-48288281 GTAGCCCGGCATGGTGGCATGGG - Intergenic
1190309606 X:49107505-49107527 TTAGCCAGGTGTGGTGGCAGGGG + Intergenic
1190325302 X:49203679-49203701 TTAGCCAGAGGAGGTGGCAGAGG - Intergenic
1190383944 X:49866141-49866163 TTAGCCAGGTGTGGTGGCACTGG - Intergenic
1190573497 X:51809259-51809281 TTAGCCAGGCATGGTGGCAGGGG - Intronic
1190972530 X:55365487-55365509 TTAGCCAGGCATGGTGGCATGGG - Intergenic
1192118991 X:68437310-68437332 TTAGCCAGACATGGTGGCTCAGG - Intergenic
1192149560 X:68703703-68703725 GGATGCAGACGTGGTGGCACAGG + Intronic
1192153429 X:68726037-68726059 GCAGCCAGACATGGTGGTGGGGG + Intergenic
1192351885 X:70362676-70362698 TTAGCCAGGCATGGTGGCACAGG - Intronic
1192393145 X:70752376-70752398 TTAGCCGGGCGTGGTGGCACAGG + Intronic
1192400794 X:70833121-70833143 GTAGCCAGGTGTGGTGGCGCAGG + Intronic
1192415182 X:70973323-70973345 TTAGCCAGGCATGGTGGCACAGG + Intergenic
1192445268 X:71206439-71206461 TTAGCCAGGCGTGGTGGCGTGGG + Intergenic
1192471607 X:71404118-71404140 TTAGCCAGGTGTGGTGGCACAGG - Intronic
1192776207 X:74248214-74248236 TTAGCCAGGCGTGGTGGCACGGG + Intergenic
1192805763 X:74507091-74507113 TTAGCCAGGTGTGGTGGCACGGG - Intronic
1192965567 X:76173365-76173387 GTAGCTGGGCGTGGTGGCACGGG - Intronic
1193114841 X:77766375-77766397 CTTCCCAGACGGGGTGGCAGCGG + Intronic
1193278021 X:79613405-79613427 TTAGCCAGGCTTGGTGGCACGGG - Intergenic
1193320814 X:80119245-80119267 TTAGCCAGGCGTGGTGGTGGTGG - Intergenic
1193371689 X:80706253-80706275 TTACCCGGATGTGGTGGCAGAGG - Intronic
1193373680 X:80731746-80731768 TTAGCCAGGCGTGGTGGCGGAGG + Intronic
1193843444 X:86438368-86438390 TTAGCCGGGCGTGATGGCAGGGG - Intronic
1193875564 X:86858276-86858298 TTAGCCGGGCGTGGTGGCAGGGG - Intergenic
1194177846 X:90673460-90673482 GCAGGCAGATGTGGAGGCAGAGG + Intergenic
1194284718 X:91995985-91996007 TTAGCCAGGCGTGGTGGCGGGGG - Intronic
1194481637 X:94433667-94433689 TTAGCCAGGCGTGGTGGCAGGGG - Intergenic
1195151996 X:102081454-102081476 TTAGCCGGTCATGGTGGCAGGGG - Intergenic
1195700015 X:107697927-107697949 TTAGCCAGGTGTGGTGGCACGGG - Intergenic
1196228837 X:113197305-113197327 GGAGCCTGTCGTGGGGGCAGAGG - Intergenic
1196248655 X:113430832-113430854 TTAGCCAGGCATGGTGGCACGGG + Intergenic
1196591387 X:117489117-117489139 GTTACCAGAAGTGGGGGCAGGGG - Intergenic
1196695571 X:118607566-118607588 TTAGCCAGGCGCGGTGGCGGGGG - Intronic
1196737282 X:118991002-118991024 TTAGCCAAGCGTGGTGGCACAGG - Intronic
1196810433 X:119624854-119624876 TTAGCCGGACATGGTGGCACAGG - Intronic
1196822530 X:119713514-119713536 TTAGCCGGGCGTGGTGGCGGTGG - Intergenic
1196859030 X:120010195-120010217 TTATCCAGACGTGGTGCCTGAGG + Intergenic
1197051507 X:122064298-122064320 TTAGCCGGGCATGGTGGCAGGGG + Intergenic
1197189354 X:123628562-123628584 TTAGCCAGGCGTGGTGGCGCAGG + Intronic
1197218434 X:123889069-123889091 TTAGCCAGGCATGGTGGCAGTGG - Intronic
1197750487 X:129960566-129960588 TTAGCCAGGCGTGGTGGCGCAGG + Intergenic
1197792141 X:130266952-130266974 TTAGCCGGGCGTGGTGGCAAGGG + Intronic
1197934922 X:131729992-131730014 TTAGCCGGGCGTGGTGGCACAGG + Intergenic
1198036830 X:132809133-132809155 TTAGCCAGGCGTGGTAGCACAGG - Intronic
1198076804 X:133201469-133201491 TTAGCCAGGTGTGGTGGCACAGG - Intergenic
1198084125 X:133266655-133266677 TTAGCCAGGTGTGGTGGCGGAGG - Intergenic
1198206262 X:134467951-134467973 TTAGCCAGGCATGGTGGCACAGG - Intronic
1198455784 X:136816311-136816333 TTAGCCAGGCGTGGTGGCGCAGG - Intergenic
1198854430 X:141001792-141001814 TTAGCCGGGCGTGGTGGCACAGG + Intergenic
1198877585 X:141243336-141243358 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
1198908521 X:141588871-141588893 TTAGCCGGGCGTGGTGGCACAGG + Intronic
1198918549 X:141699281-141699303 TTAGCCGGGCGTGGTGGCACAGG - Intergenic
1198974366 X:142318940-142318962 TTAGCCAGGCGTGGTGGTGGGGG + Intergenic
1199359135 X:146897460-146897482 TTATCCAGGTGTGGTGGCAGGGG - Intergenic
1200524510 Y:4255610-4255632 GCAGTCAGATGTGGAGGCAGAGG + Intergenic
1200602282 Y:5220555-5220577 TTAGCCAGGCGTGGTGGCGGGGG - Intronic
1200893341 Y:8346972-8346994 TTAGCCAGGCATGGTGGCAGGGG - Intergenic
1201225312 Y:11812862-11812884 TTAGCCAGGAGTGGTGGCAGGGG + Intergenic
1201281184 Y:12343745-12343767 GTAGCCAGGCACAGTGGCAGGGG - Intergenic
1201686794 Y:16713601-16713623 TTAGCCAGGCATGGTGGCATGGG + Intergenic
1201854981 Y:18531481-18531503 TTAGCCAGACATGGTGACTGAGG - Intergenic
1201857484 Y:18560934-18560956 TTAGCCGGGCGTGGTGGCAGTGG + Intronic
1201875837 Y:18759446-18759468 TTAGCCGGGCGTGGTGGCAGTGG - Intronic
1201878340 Y:18788904-18788926 TTAGCCAGACATGGTGACTGAGG + Intronic
1201899025 Y:19027637-19027659 TTAGCCAGATGTGGTGGCACAGG + Intergenic
1201948711 Y:19540170-19540192 TTAGCCAGACATGGTGGCACCGG + Intergenic
1202012438 Y:20358754-20358776 TTAGCCGGGCGTGGTGGCTGGGG + Intergenic
1202027029 Y:20535180-20535202 TTAGCCAGGCATGGTGGCACAGG - Intergenic