ID: 1147623173

View in Genome Browser
Species Human (GRCh38)
Location 17:41881742-41881764
Sequence TGTAGCCAGACGTGGTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1035
Summary {0: 1, 1: 0, 2: 5, 3: 187, 4: 842}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623173_1147623177 -9 Left 1147623173 17:41881742-41881764 CCCTGCCACCACGTCTGGCTACA 0: 1
1: 0
2: 5
3: 187
4: 842
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623173_1147623180 29 Left 1147623173 17:41881742-41881764 CCCTGCCACCACGTCTGGCTACA 0: 1
1: 0
2: 5
3: 187
4: 842
Right 1147623180 17:41881794-41881816 TGTGCAAGCAGAGCTCACCCTGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623173 Original CRISPR TGTAGCCAGACGTGGTGGCA GGG (reversed) Intronic
900755956 1:4434879-4434901 ATTAGCCAGATGTGGTGGCATGG - Intergenic
901263651 1:7892624-7892646 CTTAGCCAGGCGTGGTGGCAGGG - Intergenic
902334209 1:15745744-15745766 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
902350861 1:15853332-15853354 ATTAGCCAGGCATGGTGGCACGG - Intronic
902553310 1:17232092-17232114 ATTAGCCAGGCGTGGTGGTAGGG - Intronic
902630406 1:17701361-17701383 TGTGGGCAGAAGTGGTGGCGGGG + Intergenic
902642147 1:17773959-17773981 GGTAGCCAGAGGTGGTGGGGTGG + Intronic
902934773 1:19757141-19757163 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
903204736 1:21772772-21772794 GTTAGCCAGGAGTGGTGGCACGG + Intronic
903264951 1:22152495-22152517 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
903948762 1:26981353-26981375 TGGTGCCAGGCGTGCTGGCAAGG - Intergenic
904144979 1:28382938-28382960 ATTAGCCAGACATGGTGGCGGGG - Intronic
904173502 1:28608788-28608810 ATTAGCCAGGCGTGGTGGGAGGG + Intronic
904497773 1:30896813-30896835 ATTAGCCAGGCATGGTGGCATGG + Intronic
904513896 1:31037929-31037951 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
904520171 1:31089027-31089049 ATTAGCCGGACATGGTGGCAAGG - Intergenic
904554949 1:31355025-31355047 ATTAGCCAGGCGTGGTGGCGAGG + Intronic
904697694 1:32339418-32339440 TGTAGTCAGAGATGGAGGCATGG + Intergenic
905035667 1:34916841-34916863 ATTAGCCAGACGTGGCGGCACGG - Intronic
905040392 1:34951976-34951998 ATTAGCCAGGCATGGTGGCATGG - Intergenic
905170264 1:36105799-36105821 GTTAGCCAGACTTGGTGGCGCGG + Intronic
905300822 1:36985264-36985286 TGGAGCCAGAGGAGGGGGCAAGG - Intronic
905412845 1:37783739-37783761 ATTAGCCAGGCATGGTGGCAGGG + Intergenic
905540999 1:38760402-38760424 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
905761229 1:40559453-40559475 ATTAGCCAGGTGTGGTGGCACGG - Intergenic
906016947 1:42590587-42590609 ATTAGCCAGATATGGTGGCATGG + Intronic
906160178 1:43642328-43642350 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
906317195 1:44794056-44794078 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
906386741 1:45376361-45376383 ATTAGCCAGACGTGGTGGCGGGG - Intronic
906465838 1:46078387-46078409 ATTAGCCGGACGTGGTGGCAGGG + Intronic
907137047 1:52149640-52149662 ATTAGCCACGCGTGGTGGCAGGG - Intronic
907191323 1:52651382-52651404 ATTAGCCAGGCGTGATGGCAGGG - Intronic
908005550 1:59724013-59724035 ATTAGCCAGGCATGGTGGCAGGG + Intronic
908176352 1:61559023-61559045 TGTAACCTCACGTGGTGGAAGGG + Intergenic
908241651 1:62193848-62193870 ACTAGCCAGGCGTGGTGGCATGG + Intergenic
908291824 1:62675253-62675275 ATTAGCCAGATGTGGTGGCGTGG + Intronic
908383170 1:63615707-63615729 ATTAGCCAGGCATGGTGGCAGGG - Intronic
909004182 1:70255913-70255935 ATTAGCCAGGCATGGTGGCACGG + Intergenic
909383788 1:75033902-75033924 TGTGGCCAGGCCTGGGGGCAAGG - Intergenic
909431184 1:75589697-75589719 TGCTGCCAGAGGTGGGGGCAGGG - Intronic
909947095 1:81676155-81676177 ATTAGCCAGGCATGGTGGCATGG - Intronic
910041233 1:82853599-82853621 TGTAGTCTGAGGTGGTGGCAGGG + Intergenic
910881718 1:91927705-91927727 ATTAGCCAAGCGTGGTGGCATGG - Intergenic
911514185 1:98846969-98846991 ATTAGCCAGGAGTGGTGGCAGGG - Intergenic
911575318 1:99570178-99570200 CATAGCCAGGTGTGGTGGCAGGG + Intergenic
911905405 1:103561766-103561788 TGTAGTAAGAAGAGGTGGCAGGG + Intronic
912039845 1:105375941-105375963 ATTAGCCAGGCGTGGTAGCAGGG + Intergenic
912397315 1:109356017-109356039 ATTAGCCAGGCGTGGTGACACGG - Intronic
913016549 1:114742432-114742454 TTTAGCCAGGCATGGTGGCATGG + Intronic
913167405 1:116200792-116200814 ACTACCCAGGCGTGGTGGCACGG - Intergenic
913262018 1:117007494-117007516 ATTAGCCAGGCATGGTGGCAAGG - Intronic
913468218 1:119164733-119164755 ATTAGCCAGAGGTGGTGGCATGG + Intergenic
914262558 1:146011342-146011364 ATTAGCCAGACGTGGTGGTGTGG - Intergenic
914730899 1:150369420-150369442 ATTAGCCAGGTGTGGTGGCATGG - Intronic
914871357 1:151477597-151477619 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
914888943 1:151605944-151605966 ATTAGCGAGGCGTGGTGGCATGG - Intergenic
914979948 1:152405679-152405701 ATTAGCCAGGTGTGGTGGCAAGG + Intergenic
915223296 1:154392114-154392136 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
915497510 1:156292318-156292340 TGTGCCCACACGTGGTGGCTGGG + Exonic
916092328 1:161317175-161317197 ATTAGCCAGGCGTGGTGGCGTGG - Intronic
916392506 1:164345910-164345932 TATAGCCAGGTGTGGTGGCAGGG + Intergenic
916799038 1:168197165-168197187 ATTAGCCAGGCATGGTGGCACGG + Intronic
917082885 1:171273999-171274021 ATTAGCCAGCCATGGTGGCATGG + Intronic
917089296 1:171336749-171336771 TTTAGCCAGGTGTGGTGGCATGG - Intronic
917148646 1:171921069-171921091 GCCAGCCAGACGTGGTGGCGTGG - Intronic
917925613 1:179786945-179786967 TGCAGGCAGAGCTGGTGGCAAGG - Intronic
918006482 1:180546251-180546273 GGTACCCAGAAGTGGAGGCAGGG + Intergenic
918372307 1:183873304-183873326 TGTAGCCAATGGTGGTGGCAAGG - Intronic
918757042 1:188352113-188352135 AGTAGCCAAGCCTGGTGGCATGG + Intergenic
918953340 1:191171229-191171251 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
919324330 1:196087060-196087082 AATAGCCAGGCGTGGTGGCATGG + Intergenic
919577279 1:199326608-199326630 ATTAGCCAGGCATGGTGGCATGG + Intergenic
919648440 1:200120573-200120595 TGTGGCCAGGCATGGTGGCTTGG + Intronic
919734569 1:200937842-200937864 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
919868491 1:201802155-201802177 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
919975931 1:202612513-202612535 ATTAGCCAGTTGTGGTGGCATGG - Intronic
920116470 1:203625177-203625199 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
920176377 1:204104425-204104447 TGTAGCCAGGAAGGGTGGCAGGG + Intronic
920736300 1:208535909-208535931 ATTAGCCAGGCATGGTGGCAGGG + Intergenic
920928150 1:210362372-210362394 ATTAGCCAGGTGTGGTGGCATGG - Intronic
921584802 1:216934284-216934306 ATTAGCCGGACGTGGTGGCAGGG + Intronic
921687458 1:218106170-218106192 ATTAGCCAGGCCTGGTGGCAGGG - Intergenic
921705214 1:218314842-218314864 ATTAGCCAGGCGTGGTGGTAGGG + Intronic
921907748 1:220513114-220513136 ATTAGCCAGGCTTGGTGGCATGG + Intergenic
922230020 1:223677697-223677719 GTTAGCCAGGCATGGTGGCATGG - Intergenic
922366393 1:224868480-224868502 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
923101725 1:230822556-230822578 TGGGGCCAGGCGTGGTGGCCGGG + Intergenic
923272186 1:232366522-232366544 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
923579690 1:235196703-235196725 ATTAGCCAGACGTGGTGGTGGGG + Intronic
923632280 1:235659250-235659272 ATTAGGCAGGCGTGGTGGCACGG - Intergenic
923762828 1:236862764-236862786 TGAATCCAGAAGTGGTGCCAAGG - Intronic
923786068 1:237070714-237070736 TGTAGCCAGGCATGCTGGCTGGG + Intronic
923880658 1:238100595-238100617 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
924080949 1:240397640-240397662 ATTAGCCAGGCGTGGTGGTAGGG + Intronic
924569088 1:245221552-245221574 ATTAGCCGGACGTGGTGGTAGGG - Intronic
924764731 1:247021707-247021729 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1063058976 10:2530963-2530985 ATTAGCCGGTCGTGGTGGCAGGG + Intergenic
1063137015 10:3226585-3226607 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1063307218 10:4915532-4915554 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1063454122 10:6171201-6171223 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1063486694 10:6426881-6426903 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
1063612283 10:7572923-7572945 ATTAGCCAGGCATGGTGGCAGGG - Intronic
1063641749 10:7837213-7837235 TTTAGCTGGACATGGTGGCATGG + Intronic
1063672441 10:8110299-8110321 TTTAGCCAGGCATGGTGGCGCGG + Intergenic
1063764098 10:9117280-9117302 ATTAGCCAGGCGTGGTGGCAAGG + Intergenic
1064342565 10:14500061-14500083 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1064446297 10:15396756-15396778 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1064619235 10:17197884-17197906 ATTAGCCAGGCATGGTGGCAGGG + Intronic
1064769715 10:18711134-18711156 ATTAGCCAGGCGTGGTGGCACGG - Intergenic
1065466283 10:26026847-26026869 ATTAGCCAGGCATGGTGGCATGG - Intronic
1066569605 10:36756564-36756586 ATTAGCCAGGCGTGGTGGCCGGG - Intergenic
1066579560 10:36865418-36865440 TTTAGCCAGGCTTGGTGGCGTGG - Intergenic
1067285538 10:44905100-44905122 TGTTTCCAGATTTGGTGGCAAGG + Intergenic
1067941127 10:50658414-50658436 TGTAGTAAGGGGTGGTGGCATGG - Intergenic
1068603888 10:58984178-58984200 ATTAGCCAGACATGGTGGTATGG - Intergenic
1069055274 10:63838450-63838472 ATTAGCCAGGCCTGGTGGCATGG - Intergenic
1069454153 10:68540554-68540576 TTTAGCCGGGCGTGGTGGCATGG - Intergenic
1069463811 10:68620044-68620066 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1069472310 10:68704125-68704147 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1069478343 10:68757561-68757583 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
1069567221 10:69471737-69471759 ATTAGCCAGGTGTGGTGGCACGG - Intronic
1069696876 10:70393012-70393034 ATTAGCCAGATGTGGTAGCATGG + Intergenic
1069720513 10:70546801-70546823 ATTAGCCAGGCGTGGTGGCATGG + Intronic
1070186529 10:74068470-74068492 ATTAGCCAGGCATGGTGGCAGGG - Intronic
1070431496 10:76343963-76343985 ATTAGCCAGGCGTGGTGGCACGG - Intronic
1070652343 10:78246494-78246516 ATTAGCCAGGCATGGTGGCAGGG + Intergenic
1070727800 10:78803920-78803942 TGAGGCCAGCAGTGGTGGCAGGG - Intergenic
1070862343 10:79683286-79683308 TGTAGTAAGGGGTGGTGGCATGG - Intergenic
1070898097 10:80002940-80002962 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1071019236 10:81032460-81032482 ATTAGCCAGGCCTGGTGGCATGG + Intergenic
1071084993 10:81859736-81859758 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
1071618604 10:87097442-87097464 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
1072217264 10:93297958-93297980 ATTAGCCAGGCGTGGTGGTAGGG - Intergenic
1072465426 10:95657913-95657935 TGTATCCTCACGTGGTGGAAGGG - Intergenic
1072679150 10:97493421-97493443 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1072711910 10:97721262-97721284 AATAGCCAGGTGTGGTGGCAGGG - Intergenic
1072996062 10:100245168-100245190 ATTAGCCAGGTGTGGTGGCACGG - Intronic
1073329233 10:102660097-102660119 ATTAGCCAGGCGTGGTGCCACGG + Intergenic
1073495140 10:103883940-103883962 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1073516031 10:104076391-104076413 TGTAACTAGAGGTGGAGGCATGG + Exonic
1073765307 10:106675864-106675886 TGTATCCTCACGTGGTGGAAGGG - Intronic
1073768258 10:106707334-106707356 CATAGCCAGGTGTGGTGGCAAGG - Intronic
1074139221 10:110657162-110657184 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1074393506 10:113077836-113077858 GCAAGCCAGGCGTGGTGGCATGG - Intronic
1074484104 10:113855613-113855635 ACTAGCCAGGCGTGGTGGCGCGG - Intronic
1074566071 10:114578932-114578954 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
1074802211 10:117011990-117012012 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
1075388197 10:122072963-122072985 ATTAGCCAGGCGTGGTGGCGCGG + Intronic
1077611097 11:3643367-3643389 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
1078132968 11:8628463-8628485 ATTAGCCAGGCATGGTGGCATGG + Intronic
1078217268 11:9322002-9322024 ATTAGCCAGGCGTGGTGGCACGG - Intergenic
1078239569 11:9518566-9518588 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1078405176 11:11064366-11064388 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1078770633 11:14348038-14348060 TGTAGCCAGATGTCTTGGGAGGG - Intronic
1079320016 11:19444088-19444110 ATTAGCCAGTCGTGGTGTCATGG - Intronic
1079436411 11:20457020-20457042 ATTAGCTGGACGTGGTGGCAGGG - Intronic
1079702520 11:23566642-23566664 ATTAGCCAGGCGTGGTGGCGAGG - Intergenic
1080795168 11:35556775-35556797 ATTAGCCAGATGTGGTGACACGG + Intergenic
1081446538 11:43136504-43136526 ATTAGCCAGGCATGGTGGCACGG + Intergenic
1081999347 11:47384938-47384960 ATTAGCCAGGCATGGTGGCACGG + Intergenic
1082037578 11:47657875-47657897 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1082043203 11:47703951-47703973 ACTAGCCAGGCGTGGTGGCCAGG + Intronic
1082052843 11:47786934-47786956 ATTAGCCAGGCATGGTGGCATGG - Intronic
1082126983 11:48444693-48444715 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1082560563 11:54615671-54615693 GTTAGCCAGGCATGGTGGCAGGG - Intergenic
1083200090 11:61115795-61115817 TGCAGCCAGAGGGGGTGACAGGG + Intronic
1083357808 11:62080213-62080235 ATTAGCCAGGCATGGTGGCACGG - Intergenic
1083561597 11:63677381-63677403 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1083820882 11:65170728-65170750 ATTAGCCGGGCGTGGTGGCATGG + Intronic
1084300996 11:68252363-68252385 ATTAGCCAGGCATGGTGGCACGG - Intergenic
1084344198 11:68533555-68533577 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1084356574 11:68642442-68642464 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1084379538 11:68802584-68802606 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1084382034 11:68818708-68818730 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1084849266 11:71925730-71925752 ATTAGCCGGACGTGGTGGCGGGG + Intronic
1084881706 11:72176433-72176455 AATAGCCAGGTGTGGTGGCATGG + Intergenic
1085107023 11:73853836-73853858 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
1085243589 11:75078711-75078733 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
1087028721 11:93680455-93680477 ATTAGCCAGGCGTGGTGGCCTGG + Intronic
1087475375 11:98627304-98627326 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1088647422 11:111927866-111927888 ATTAGCCAGGCATGGTGGCACGG + Intronic
1088775072 11:113074777-113074799 ATTAGCCAGGCATGGTGGCATGG - Intronic
1088870220 11:113884397-113884419 AGTAGCCAGGTGTGGTGGCGGGG + Intergenic
1088890459 11:114040219-114040241 TGTGTCCTCACGTGGTGGCAGGG + Intergenic
1089181740 11:116588020-116588042 ATTAGCCAGGCATGGTGGCATGG - Intergenic
1089383589 11:118053157-118053179 TTTAGCCAGGCGTGTTGGCAGGG + Intergenic
1089453975 11:118615045-118615067 ATTAGCCAGGCGTGGTGGCACGG + Intronic
1089537016 11:119167163-119167185 ATCAACCAGACGTGGTGGCATGG - Intronic
1090018427 11:123105962-123105984 ATTAGCCAGGCGTGGTGGCGTGG - Intronic
1090053258 11:123399765-123399787 ATTAGCCAGACGTGGTGGCGTGG - Intergenic
1090380733 11:126325968-126325990 ATTAGCCAGGCGTGGTGGCGTGG + Intronic
1090541890 11:127715692-127715714 ATTAGCCTGGCGTGGTGGCATGG - Intergenic
1090649639 11:128794926-128794948 ATTAGCCAGGCATGGTGGCACGG + Intronic
1090705545 11:129333110-129333132 TTTAGCCAGGTATGGTGGCATGG + Intergenic
1091713829 12:2762148-2762170 TGTAGCTGGAGGTGGTGGGAGGG + Intergenic
1092612635 12:10188309-10188331 TTTAGCTGGGCGTGGTGGCACGG + Intronic
1092623042 12:10294544-10294566 ATTAGCCAGGCATGGTGGCATGG - Intergenic
1092782644 12:12001530-12001552 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1093171716 12:15868549-15868571 ATTAGCCAGGCATGGTGGCAGGG + Intronic
1094624806 12:32113531-32113553 ATTAGCCAGGCATGGTGGCATGG - Intronic
1096033745 12:48445021-48445043 ATTAGCCAGGCGTGGTGGCTTGG + Intergenic
1096067946 12:48756023-48756045 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1096277871 12:50226192-50226214 TTTAGCTGGGCGTGGTGGCATGG - Intronic
1096287306 12:50311443-50311465 ACTAGCCAGGCATGGTGGCATGG + Intergenic
1096349043 12:50878952-50878974 TGTATCCTTACGTGGTGGAAGGG - Intronic
1096376006 12:51111289-51111311 ATTAGCCGGGCGTGGTGGCACGG - Intronic
1096428471 12:51523760-51523782 ATTAGCCAGGCGTGGTGGCAAGG - Intergenic
1096723257 12:53540201-53540223 ATTAGCCAGGCATGGTGGCATGG + Intronic
1096802013 12:54116743-54116765 TACAGCCAGGCCTGGTGGCATGG + Intergenic
1097004305 12:55904113-55904135 ATTAGCCGGATGTGGTGGCAGGG - Intronic
1097238790 12:57558922-57558944 AATAGCCAGGTGTGGTGGCATGG - Intronic
1097345962 12:58492840-58492862 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1097430733 12:59502868-59502890 TGAAGCCAGACTTTGTGGAAAGG - Intergenic
1097499734 12:60387806-60387828 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1097588979 12:61550147-61550169 AATAGCCAGGTGTGGTGGCAGGG + Intergenic
1097877500 12:64657157-64657179 ATTAGCCAGACGTGGTGGCGTGG - Intronic
1097937544 12:65270716-65270738 TTTTGCCAGGCATGGTGGCATGG + Intergenic
1098089815 12:66889311-66889333 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1099089158 12:78282721-78282743 ATTAGCCAGGCATGGTGGCAGGG + Intergenic
1100147171 12:91692243-91692265 ATTAGCCGGGCGTGGTGGCACGG - Intergenic
1100221199 12:92506199-92506221 TGTACCCAGAAGTGGGGGTAGGG + Intergenic
1100848569 12:98685482-98685504 ATTAGCCAGGCATGGTGGCACGG - Intronic
1100998092 12:100325079-100325101 TTTAGCTGGATGTGGTGGCATGG + Intronic
1101002689 12:100372495-100372517 TTGAGCCAGGTGTGGTGGCATGG - Intronic
1101101027 12:101392667-101392689 ATTAGCCGGGCGTGGTGGCACGG + Intergenic
1101160721 12:101972232-101972254 TTTAGCCAGGTGTGGTGGCATGG - Intronic
1101176708 12:102159275-102159297 ATTAGCCAGGCGTGGTGGCACGG - Intronic
1101538584 12:105643327-105643349 ATTAGCCAGGCGTGGTGGCGCGG - Intergenic
1101951057 12:109175561-109175583 ATTAGCCAGGCATGGTGGCATGG - Intronic
1102062271 12:109941970-109941992 ATTAGCCAAGCGTGGTGGCACGG - Intronic
1102156776 12:110736359-110736381 AGCAGCCAGATGTGGTGGCTTGG + Intronic
1102332437 12:112045645-112045667 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
1102368907 12:112364579-112364601 ATTAGCCAGCCGTGGTGGCATGG + Intronic
1102369848 12:112373383-112373405 AATAGCCAGGTGTGGTGGCACGG + Intronic
1102372554 12:112394255-112394277 CTTAGCCAGACATGGTGGCAGGG + Intergenic
1102872184 12:116422679-116422701 ATTAGCCAGGCATGGTGGCATGG - Intergenic
1102910128 12:116707334-116707356 TTTTGCCAGGTGTGGTGGCATGG + Intergenic
1103083759 12:118045548-118045570 ATTAGCTGGACGTGGTGGCAGGG + Intronic
1103228411 12:119307563-119307585 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1103346453 12:120254026-120254048 ATTAGCCAAGCGTGGTGGCACGG - Intronic
1103375739 12:120454554-120454576 ATTAGCCAGGCGTGGTGGCGGGG - Intronic
1103393916 12:120593359-120593381 AGTAGCCGGGCATGGTGGCAGGG - Intergenic
1103398309 12:120624958-120624980 TTTAGCGAGGCGTGGTGGCCTGG - Intergenic
1103955355 12:124573400-124573422 ATTAGCCAGGTGTGGTGGCACGG - Intergenic
1104024330 12:125014912-125014934 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1104315354 12:127694609-127694631 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
1104455273 12:128905978-128906000 TTCAGCCAGGTGTGGTGGCATGG - Intronic
1104707159 12:130955934-130955956 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1104892369 12:132146607-132146629 TATAGACAGACGTGTTGGCGAGG - Intronic
1105211868 13:18261737-18261759 TGTCCCCACACGTGGTGGGAAGG + Intergenic
1105453558 13:20520954-20520976 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1105478049 13:20746298-20746320 AATAGCCAGGTGTGGTGGCATGG - Intronic
1105696107 13:22890245-22890267 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
1106050095 13:26181455-26181477 TGTAGCAAGAGGTGATGTCAGGG + Intronic
1106397127 13:29391979-29392001 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1107453434 13:40533437-40533459 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1108594838 13:51940495-51940517 TGTAGCTGGGCGTGGTGGCGGGG + Intronic
1109291283 13:60478450-60478472 ATTAGCCACATGTGGTGGCACGG - Intronic
1110310864 13:74047447-74047469 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
1110563487 13:76934785-76934807 TTCAGCCAGAGCTGGTGGCAGGG - Intergenic
1110701420 13:78553123-78553145 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1111119719 13:83830843-83830865 TGTGGCCAGGCGTGGTGGCCAGG - Intergenic
1111409193 13:87852736-87852758 TGATGACAGAGGTGGTGGCAGGG - Intergenic
1111597108 13:90426540-90426562 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1112172976 13:96993364-96993386 ATTAGCCAGACGTGGTGGAACGG - Intronic
1112511829 13:100016507-100016529 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
1112521348 13:100098041-100098063 TGAAGCTAGGTGTGGTGGCAGGG + Intronic
1112593264 13:100784011-100784033 ATTAGCCAGGCATGGTGGCATGG - Intergenic
1112972480 13:105277403-105277425 AGTAGCCAGATATGGTGGCCTGG + Intergenic
1113033798 13:106025814-106025836 CTTAGCCAGGTGTGGTGGCATGG + Intergenic
1113718678 13:112534396-112534418 ATTAGCCGGGCGTGGTGGCAAGG + Intronic
1114147901 14:19999337-19999359 TATAGCCAGGAGTGGTGGCATGG + Intergenic
1114218708 14:20677721-20677743 CTTAGCCAGGCGTGGTGGCGGGG - Intergenic
1114229024 14:20763727-20763749 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
1114249952 14:20950754-20950776 ATTAGCCAGGCGTGGTGGCACGG - Intergenic
1114352167 14:21864816-21864838 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1114490665 14:23099710-23099732 CTTAGCCAGACGTGGTGGTGCGG - Exonic
1114538065 14:23435660-23435682 TGGAGCCAGACCTGGTCTCAGGG + Exonic
1114594233 14:23898252-23898274 ACTTCCCAGACGTGGTGGCAGGG + Intergenic
1114759291 14:25295231-25295253 TTTAGCCAGGCGTGGTGGTGCGG - Intergenic
1115242063 14:31259587-31259609 ATTAGCCAGACATGGTGGCATGG + Intergenic
1115252551 14:31364704-31364726 TGTGGCCAGGTGTGGTGGCTTGG - Intronic
1115627601 14:35209681-35209703 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1116168202 14:41361634-41361656 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1116804559 14:49480130-49480152 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1116850431 14:49903623-49903645 ATTAGCCGGGCGTGGTGGCAGGG - Intergenic
1116964759 14:51002267-51002289 ATCAGCCAGCCGTGGTGGCAGGG - Intronic
1117010864 14:51469086-51469108 ATTAGCCGGGCGTGGTGGCAGGG - Intergenic
1117049544 14:51846707-51846729 TGTAGCCAGGGGTGTTGGCATGG - Intronic
1117414205 14:55478863-55478885 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
1117770207 14:59126577-59126599 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1117876531 14:60256269-60256291 ATTAGCCAGGCGTGGTGGCACGG + Intronic
1118403064 14:65396991-65397013 CTTAGCCAGGCCTGGTGGCATGG - Intergenic
1119020333 14:71105687-71105709 AATAGCCGGGCGTGGTGGCAGGG - Intronic
1119147424 14:72329881-72329903 TGTAGCCAGAGGTGGGGAGAGGG - Intronic
1119591214 14:75889679-75889701 ATTAGCCAGGCGTGGTGGCATGG + Intronic
1119747659 14:77055791-77055813 ATTAGCCAGATGTGGTGGCAGGG + Intergenic
1119791964 14:77359053-77359075 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1119838463 14:77772122-77772144 AATAGCCAGGCATGGTGGCATGG - Intergenic
1119838535 14:77772848-77772870 TTTGGCCAGGCGTGGTGGCGTGG + Intergenic
1119920518 14:78441946-78441968 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
1120293404 14:82606794-82606816 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
1120601650 14:86517567-86517589 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1120936263 14:89898510-89898532 ATTAGCCACACATGGTGGCATGG - Intronic
1121520976 14:94586095-94586117 CGTAGCCAGATGGGGAGGCATGG + Intronic
1121768429 14:96508021-96508043 ATTAGCTGGACGTGGTGGCACGG - Intronic
1121895381 14:97642077-97642099 ATTAGCCGGGCGTGGTGGCATGG + Intergenic
1122511307 14:102270450-102270472 ATTAGCCAAGCGTGGTGGCAGGG + Intronic
1122555505 14:102577240-102577262 GTTAGCCAGGCATGGTGGCATGG - Intergenic
1122668959 14:103355280-103355302 ATTAGCCAGGCGTGGTGGCAAGG - Intergenic
1202927815 14_KI270725v1_random:7793-7815 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1123484031 15:20668356-20668378 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1123679964 15:22755963-22755985 ATTAGCCAGGCGTGGTGGCAAGG - Intergenic
1123708236 15:22966204-22966226 ATTAGCCAGGCGTGGTGGCGTGG + Intronic
1124176339 15:27428027-27428049 ATTAGCCAGGCATGGTGGCATGG - Intronic
1124332177 15:28830408-28830430 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
1124491579 15:30160844-30160866 ATTAGCCAGTTGTGGTGGCATGG - Intergenic
1124527130 15:30466694-30466716 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1124751958 15:32377462-32377484 ATTAGCCAGTTGTGGTGGCATGG + Intergenic
1124771523 15:32540989-32541011 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1125659988 15:41386261-41386283 AGTAGCCAGACATGGTGGTGTGG + Intergenic
1126170754 15:45693367-45693389 TGTAGACAAAAGTGCTGGCAAGG + Intergenic
1126756427 15:51929715-51929737 ATTAGCCAGGCTTGGTGGCACGG - Intronic
1126783757 15:52160093-52160115 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1127097561 15:55527685-55527707 ATTAGCCAGACATGGTGGCATGG + Intergenic
1127218809 15:56854853-56854875 AGTAGCCAGGCGTGGTGGCGGGG + Intronic
1127915115 15:63448975-63448997 AAAAGCCAGGCGTGGTGGCACGG + Intergenic
1128034425 15:64511323-64511345 TTTAGCCAGGCATGGTGGCGTGG + Intronic
1128036411 15:64530160-64530182 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1128317495 15:66670293-66670315 CATAGCCAGACGTGGTGGGGAGG - Intronic
1128757673 15:70194539-70194561 TGGAGCCAAATGTGCTGGCATGG + Intergenic
1128847675 15:70916440-70916462 ACTAGCCAGGTGTGGTGGCATGG - Intronic
1129058711 15:72842635-72842657 ATTAGCCAGTTGTGGTGGCATGG - Intergenic
1129217954 15:74111716-74111738 ATTAGCCAGGCATGGTGGCACGG - Intronic
1129800740 15:78412198-78412220 ATTAGCCAGATGTGGTGGCTTGG + Intergenic
1129828148 15:78648922-78648944 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1130510563 15:84585719-84585741 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1130688439 15:86059488-86059510 GTTAGCCAGGCGTGGTGGCATGG - Intergenic
1130983539 15:88829409-88829431 TCTAAACAGACGTGGTGGGATGG - Intronic
1131033769 15:89207576-89207598 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1131327672 15:91463946-91463968 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
1131631591 15:94182279-94182301 ATTAGCCAGGCATGGTGGCAGGG + Intergenic
1131890738 15:96969235-96969257 TGCACCCTGAGGTGGTGGCAGGG + Intergenic
1132046376 15:98566158-98566180 ATTAGCCAGTCATGGTGGCACGG - Intergenic
1132167617 15:99611092-99611114 ATTAGCCAGGCGTGATGGCAGGG + Intronic
1132297094 15:100747032-100747054 ATTAGCCAGACGTGGTGGTGCGG - Intergenic
1132489847 16:221552-221574 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
1132987590 16:2776036-2776058 ACCAGCCAGCCGTGGTGGCATGG - Intronic
1133595441 16:7286769-7286791 ATTAGCCAGGCATGGTGGCAGGG - Intronic
1133606488 16:7393019-7393041 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1134068921 16:11248871-11248893 ATTAGCCGGGCGTGGTGGCATGG - Intergenic
1134132124 16:11657106-11657128 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1134338974 16:13327802-13327824 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1134765289 16:16752100-16752122 ATTAGCCAGGCATGGTGGCATGG - Intergenic
1135409339 16:22221337-22221359 TTTAGCCGGGCATGGTGGCATGG + Intronic
1135422020 16:22311637-22311659 ATTAGCCAGATGTGGTGGCATGG - Intronic
1135489189 16:22893932-22893954 ATTAGCCAGGCATGGTGGCATGG - Intronic
1136097307 16:27966355-27966377 ATTAGCCAGCTGTGGTGGCACGG + Intronic
1136170309 16:28485418-28485440 ATTAGCCAGGCATGGTGGCATGG + Intronic
1136383787 16:29910503-29910525 TTTAGCCAGGTGTGGTGGCTTGG - Intronic
1136561975 16:31044622-31044644 ATTAGCCAGGCATGGTGGCACGG + Intergenic
1136588068 16:31200664-31200686 ACTAGCCAGGTGTGGTGGCAGGG + Intergenic
1136789147 16:32954156-32954178 ATTAGCCAAGCGTGGTGGCATGG - Intergenic
1136880666 16:33899782-33899804 ATTAGCCAAGCGTGGTGGCATGG + Intergenic
1137419560 16:48320010-48320032 ATTAGCCAGGCATGGTGGCAGGG + Intronic
1137434429 16:48443914-48443936 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
1137672842 16:50289611-50289633 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1138579896 16:57933868-57933890 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
1138605391 16:58085286-58085308 TGTGGCCACACGAGGTGGTAAGG + Intergenic
1138893801 16:61178431-61178453 TGTGGCCAGACCAGGCGGCAGGG - Intergenic
1138963137 16:62051357-62051379 GTTAGCCAGGTGTGGTGGCAGGG + Intergenic
1139529199 16:67534265-67534287 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1139534824 16:67565147-67565169 ATTAGCCGGGCGTGGTGGCACGG - Intronic
1139726598 16:68905072-68905094 ATTAGCCGGGCGTGGTGGCATGG + Intronic
1139765253 16:69223340-69223362 ATTAGCCAGGCGTGGTGGCTGGG - Intronic
1139795719 16:69481584-69481606 ATTAGCCTGAAGTGGTGGCATGG - Intergenic
1140529181 16:75649007-75649029 TTTAGCGGGACGTGGTGGCGCGG - Intronic
1140564994 16:76031568-76031590 ATTAGCCAGATGTGGTGGCATGG - Intergenic
1141049836 16:80750870-80750892 ACTAGCCAGGCGTGGTGGCGGGG + Intronic
1141367209 16:83454852-83454874 CTTAGCCAGGTGTGGTGGCAGGG - Intronic
1141496281 16:84412164-84412186 AGTAGTCAGGTGTGGTGGCATGG - Intronic
1141625111 16:85257255-85257277 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1141988494 16:87595341-87595363 ATTAGCCAGGCATGGTGGCACGG - Intergenic
1142236487 16:88924924-88924946 TGCACCCACACGTGGTGGCGGGG - Intronic
1203142072 16_KI270728v1_random:1773327-1773349 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1142603533 17:1069514-1069536 ATTAGCCAGACATGGTGGCATGG + Intronic
1142667332 17:1470492-1470514 TGCATCCAGTCGTGGTGGCGTGG - Exonic
1142824976 17:2504709-2504731 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1142833360 17:2565913-2565935 ATTAGCCAGGCTTGGTGGCACGG + Intergenic
1142833761 17:2569199-2569221 ATTAGCCAGGTGTGGTGGCACGG + Intergenic
1142857643 17:2740817-2740839 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1142864770 17:2784118-2784140 ATTAGCCTGGCGTGGTGGCATGG - Intronic
1143133459 17:4695837-4695859 ATTAGCCAGACGTGGTGGTGTGG + Intronic
1143220671 17:5258643-5258665 ATTAGCCAGGCATGGTGGCACGG + Intergenic
1143463001 17:7115708-7115730 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
1143614897 17:8043919-8043941 CTTAGCCAGGTGTGGTGGCATGG + Intronic
1144412481 17:15014478-15014500 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1145182351 17:20764538-20764560 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1145773058 17:27507283-27507305 ATTAGCCAGGCCTGGTGGCAGGG + Intronic
1145866317 17:28244144-28244166 ATTAGCCAGATGTGGTGGCTCGG - Intergenic
1145943040 17:28753653-28753675 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1146370062 17:32260526-32260548 CCTAGCCAGGTGTGGTGGCATGG - Intergenic
1146475119 17:33156606-33156628 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1147053321 17:37814578-37814600 AGTAGCCAGGCATGGTGGCGTGG - Intergenic
1147165372 17:38590381-38590403 ATTAGCCAGGTGTGGTGGCACGG - Intronic
1147343648 17:39771885-39771907 CCTAGCCAGGTGTGGTGGCATGG - Intronic
1147431064 17:40371124-40371146 AATAGCCGGGCGTGGTGGCACGG + Intergenic
1147455438 17:40535101-40535123 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1147623173 17:41881742-41881764 TGTAGCCAGACGTGGTGGCAGGG - Intronic
1147693759 17:42335714-42335736 AATAGCCAGGCATGGTGGCATGG + Intronic
1147787006 17:42986140-42986162 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1148005047 17:44420996-44421018 ATTAGCCAGGCGTGGTGGCCTGG - Intronic
1148274536 17:46291806-46291828 ATTAGCCAGAGATGGTGGCATGG + Intronic
1148932242 17:51136607-51136629 ATTAGCTAGGCGTGGTGGCACGG + Intergenic
1149637124 17:58179967-58179989 TGTCACCAAACATGGTGGCAGGG + Intergenic
1149710718 17:58739653-58739675 GTTAGCCGGACATGGTGGCATGG - Intergenic
1149768687 17:59302285-59302307 ATTAGCCGGACGTGGTGGCGCGG + Intergenic
1149791646 17:59482815-59482837 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1149894570 17:60419583-60419605 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
1150408521 17:64922743-64922765 ATTAGCCAGAGATGGTGGCAGGG - Intergenic
1150640087 17:66943733-66943755 TGTAGTCAGTCATGGTGGCAAGG - Intergenic
1150683225 17:67299985-67300007 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1150760149 17:67954143-67954165 ATTAGCCAGACAGGGTGGCATGG - Intronic
1150772994 17:68057248-68057270 AGTAGCCAGACATGGTGGCAGGG + Intergenic
1150862030 17:68810455-68810477 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1151229537 17:72673918-72673940 ATTAGCCAGGCGTGGTAGCATGG + Intronic
1151247415 17:72805502-72805524 TGTGGCCAGATGTGCTGTCAAGG + Intronic
1151262663 17:72929007-72929029 TGTAGCCAGGGGTGATGGCCAGG + Intronic
1151483375 17:74383515-74383537 TGTACCCAGAGGTGGTCGGAAGG + Intergenic
1151959021 17:77395378-77395400 ATTAGCCAGACGTGGTGGCCGGG + Intronic
1151994288 17:77598808-77598830 ATTAGCCGGGCGTGGTGGCACGG - Intergenic
1152083194 17:78201469-78201491 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1152149621 17:78590807-78590829 ATTAGCCAGGCGTGGTGGCAAGG - Intergenic
1152310540 17:79547297-79547319 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1152377274 17:79925356-79925378 GGAAGCCAGGCGTGCTGGCAGGG - Intergenic
1152836242 17:82534096-82534118 AATAGCCAGATGTTGTGGCAAGG + Intronic
1153916276 18:9748356-9748378 ATTAGCCAGGCATGGTGGCATGG + Intronic
1154197721 18:12278754-12278776 TGTGGCCAGAGTTGGTGGCTAGG - Intergenic
1154270586 18:12915099-12915121 ATTAGCCAGGCATGGTGGCATGG + Intronic
1154380710 18:13847794-13847816 ATCAGCCAGACGTGGTGGCCTGG - Intergenic
1155004000 18:21711839-21711861 CTTAGCCAGACATGGTGGCATGG - Intronic
1155145116 18:23077107-23077129 ATTAGCCAGACGTGGTGGCGGGG - Intergenic
1155330251 18:24708394-24708416 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
1155575453 18:27241029-27241051 ATTAGCCAGACATGGTGGCATGG - Intergenic
1155975152 18:32120986-32121008 ATTAGCCAGGCATGGTGGCATGG + Intronic
1156788688 18:40946686-40946708 ATTAACCAGGCGTGGTGGCAGGG - Intergenic
1156975540 18:43217726-43217748 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1157237943 18:45981704-45981726 ATTAGCCGGGCGTGGTGGCAGGG - Intergenic
1157501275 18:48192607-48192629 ATTAGCCAGGCGTGGTGCCACGG - Intronic
1157520242 18:48340570-48340592 TGCAGCCAGTCGGGGTGGGATGG - Intronic
1158263424 18:55634119-55634141 ATTAGCCACGCGTGGTGGCAGGG + Intronic
1158301590 18:56058542-56058564 ATTAGCCAGACATGGGGGCATGG + Intergenic
1158529879 18:58250295-58250317 ATTAGCCAGGCGTGGTGGTACGG - Intronic
1158840700 18:61383431-61383453 ATTAGCCAGGCATGGTGGCATGG + Intronic
1158865162 18:61631590-61631612 TGCAGACAGAAGTTGTGGCAAGG - Intergenic
1159041176 18:63324022-63324044 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1160070364 18:75622865-75622887 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1160876017 19:1296515-1296537 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1160999598 19:1903711-1903733 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1161155809 19:2731499-2731521 TGTAGGGAGGCGTGGTGGCGAGG + Intronic
1161240696 19:3221849-3221871 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1161506645 19:4647768-4647790 ATTAGCCAGGCATGGTGGCACGG - Intronic
1161548587 19:4897662-4897684 ATTAGCCAGGCATGGTGGCATGG - Intronic
1162054979 19:8057165-8057187 ATTAGCCAGGCGTGGTGGCGTGG - Intronic
1162117175 19:8437890-8437912 ATTAGCCTGGCGTGGTGGCACGG - Intronic
1162138800 19:8572841-8572863 GTTAGCCAGGCATGGTGGCATGG - Intronic
1162333829 19:10047681-10047703 CTTAGCCAGGCATGGTGGCAGGG - Intergenic
1162399220 19:10434737-10434759 ATTAGCCAGGCGTGGTGGCGGGG - Intronic
1162522082 19:11187106-11187128 ATTAGCCAGGCGTGGTAGCAGGG + Intronic
1162644537 19:12039212-12039234 ATTAGCCAGGCATGGTGGCACGG - Intronic
1162695707 19:12472733-12472755 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1162773937 19:12967391-12967413 ATTAGCCAGGCATGGTGGCAGGG + Intronic
1162980860 19:14238774-14238796 TCTAGCCGGGCATGGTGGCATGG - Intergenic
1163043137 19:14617543-14617565 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1163135948 19:15311141-15311163 ATTAGCCAGGCATGGTGGCAAGG + Intronic
1163599874 19:18242635-18242657 AATAGCCAGGCATGGTGGCATGG + Intronic
1163750228 19:19072553-19072575 TTTAGCCAGGCGTGGAGACAGGG + Intronic
1164075828 19:21817092-21817114 ATTAGCCAGGCATGGTGGCATGG + Intronic
1164245562 19:23425446-23425468 ATTAGCCAGCCGTGGTGGCATGG + Intergenic
1164530751 19:29046451-29046473 TGAAGCAAGGCTTGGTGGCAAGG + Intergenic
1165347391 19:35257458-35257480 TGTAGCCAGACACTGTTGCAAGG + Intronic
1165619372 19:37232220-37232242 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
1165876698 19:39012810-39012832 ATTAGCCAGACGTGGAGGCGCGG + Intronic
1165987634 19:39784608-39784630 TGTAGCCAAACTTGGGTGCATGG - Exonic
1166009739 19:39933667-39933689 ATTAGCCGGACATGGTGGCATGG + Intronic
1166056573 19:40293291-40293313 ATTGGCCAGGCGTGGTGGCATGG - Intergenic
1166467746 19:43047968-43047990 ATTAGCCAGGCATGGTGGCATGG + Intronic
1167081185 19:47277033-47277055 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1167286611 19:48601992-48602014 ATTAGCCAGGCGTGGTGGCGTGG + Intronic
1167549550 19:50150689-50150711 ATTAGCCGGACGTGGTGGCTGGG + Intergenic
1167590320 19:50401139-50401161 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1167842002 19:52129928-52129950 ATTAGCCAGTCATGGTGGCAGGG - Intronic
1167891204 19:52541097-52541119 ATTAGCCAGGCGTGGTGGCGGGG - Intronic
1168031903 19:53686833-53686855 ATTAGCCGGGCGTGGTGGCATGG - Intergenic
1168404789 19:56104978-56105000 ATTAGCCAGGCCTGGTGGCAGGG + Intronic
1168709362 19:58489814-58489836 ATTAGCCAGGCGTGGTGGCGTGG - Intronic
1168717477 19:58537983-58538005 ATTAGCCGGGCGTGGTGGCACGG - Intronic
925173905 2:1769020-1769042 ATTAGCCAGATGTGGTGGCGGGG + Intergenic
925349505 2:3190944-3190966 GTTAGCCAGACATGGTGCCATGG + Intronic
925753630 2:7111668-7111690 TTAAGACAGACCTGGTGGCAGGG + Intergenic
926051829 2:9750030-9750052 TGAAGCCAGTTGTGGTGGCATGG + Intergenic
926720653 2:15957831-15957853 ATTAGCCAGGCATGGTGGCATGG + Intergenic
926890093 2:17632032-17632054 ATTAGCCAGGCATGGTGGCATGG - Intronic
926899656 2:17736724-17736746 ATTAGCCAGGCGTTGTGGCATGG + Intronic
927522886 2:23711515-23711537 ATTAGCTGGACGTGGTGGCAGGG - Intergenic
927660009 2:24985168-24985190 GGTGGACAGTCGTGGTGGCAGGG - Intergenic
927689905 2:25201220-25201242 ATTAGCCAGGTGTGGTGGCAAGG - Intergenic
927733695 2:25499066-25499088 ATTAGCCAGGCATGGTGGCAGGG + Intronic
927745548 2:25616782-25616804 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
927821482 2:26269340-26269362 ATTAGCCAGGCGTGGTGGCATGG - Intronic
927845969 2:26473094-26473116 TGGAGCCAGGCTTGGTGGCAGGG + Intronic
927896196 2:26784045-26784067 ATTAGCCGGGCGTGGTGGCACGG - Intronic
927999659 2:27512089-27512111 ATTAGCCAGGCGTGGTGGCTTGG + Intronic
928092532 2:28383985-28384007 ATTAGCCAGGCATGGTGGCAGGG + Intergenic
928198616 2:29232394-29232416 TGCAGCCGGAGGTGGTGGCAGGG - Exonic
928509225 2:31986249-31986271 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
928540122 2:32276899-32276921 ATTAGCCAAACATGGTGGCAGGG + Intergenic
928554050 2:32404460-32404482 TTTACCCAGGCATGGTGGCACGG - Intronic
928695577 2:33846382-33846404 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
929152320 2:38758389-38758411 ATTAGCCAGGCGTGGTGGCATGG - Intronic
929400906 2:41580472-41580494 AGTAGCCGGACATGGTGGCATGG + Intergenic
929480856 2:42306639-42306661 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
929686081 2:44035998-44036020 ATTAGCCAGACATGGTGGCGGGG + Intergenic
929730478 2:44486110-44486132 ATTAGCCAGGCGTGGTGGCACGG - Intronic
930207896 2:48606740-48606762 ACTAGCCAGACGTGGTGGCAGGG + Intronic
930283317 2:49397151-49397173 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
930630416 2:53747396-53747418 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
930776851 2:55181274-55181296 ATTAGCCAGACGTGGTGGCCAGG - Intronic
931116575 2:59172804-59172826 ATTAGCCAGGCGTGGTGGCTGGG - Intergenic
931318866 2:61157186-61157208 ATTAGCCAGGCGTGGTGGCGTGG - Intronic
931400415 2:61926116-61926138 ATTAGCCAGGCGTGGTGGTAGGG - Intronic
931424159 2:62155866-62155888 ATTAGCCGGGCGTGGTGGCACGG - Intergenic
931524221 2:63134973-63134995 ATTAGCCAGGTGTGGTGGCACGG + Intronic
931660393 2:64556133-64556155 ATTAGCCGGGCGTGGTGGCATGG - Intronic
931782694 2:65592373-65592395 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
932204766 2:69869268-69869290 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
932207353 2:69894827-69894849 ATTAGCCAGGCGTGGTGGCACGG - Intronic
933480533 2:82851604-82851626 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
933666058 2:84966032-84966054 CTTAGCCAGGCGTGGTGGCGGGG + Intergenic
933725893 2:85427010-85427032 TGTGACCAAACGTGGTGGCGGGG - Intronic
933733940 2:85480056-85480078 AGGAGCCAGGTGTGGTGGCATGG + Intergenic
933822851 2:86130151-86130173 ATTAGCCAGGCGTGGTGGCGAGG + Intronic
933870377 2:86560115-86560137 ATTAGCCAGATGTGGTGGCACGG + Intronic
933973161 2:87486553-87486575 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
934694639 2:96390662-96390684 ATTAGCCAGGCATGGTGGCATGG + Intergenic
934750349 2:96789838-96789860 ATTAGCCAGGCGTGGTGGCGCGG - Intronic
934923365 2:98364228-98364250 ATTAGCCAGGCATGGTGGCATGG + Intronic
935099433 2:99978772-99978794 TGTATCCTCACGTGGTGGGAGGG - Intronic
935231203 2:101098242-101098264 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
935697417 2:105782215-105782237 TGTAGGCAGGCGGGGTGGCCGGG + Intronic
936320560 2:111463660-111463682 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
936558675 2:113517866-113517888 ATTAACCAGGCGTGGTGGCACGG - Intergenic
936666563 2:114603765-114603787 TGTAGCCAGACATGGCACCATGG + Intronic
936801231 2:116269019-116269041 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
936875262 2:117181327-117181349 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
936937816 2:117854945-117854967 TGTAGCAGGAGGTGGTGGCTCGG - Intergenic
937004347 2:118497509-118497531 TGTGGCCAAACATGGTGGGAGGG - Intergenic
937835652 2:126468087-126468109 ATTAGCTAGACGTGGTGGCAGGG + Intergenic
938030566 2:127989244-127989266 ATTAGCCAGGCGTGGTGGCGGGG - Intronic
938066685 2:128285363-128285385 TCTAGCCTGCCGTGGTGGCAGGG + Intronic
938313097 2:130307476-130307498 GGTAGTCAGAGGTGATGGCAAGG - Intergenic
939712637 2:145541914-145541936 ATTAGCCAGGCATGGTGGCAAGG - Intergenic
940288588 2:152056212-152056234 ATTAGCCAGGCATGGTGGCAGGG + Intronic
940759227 2:157719455-157719477 TGAAGGCAGACTTGGTGACAGGG + Intergenic
940886030 2:158990061-158990083 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
940886236 2:158991604-158991626 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
940894624 2:159068885-159068907 ATTAGCCAGGCGTGGTGGCACGG - Intronic
940976387 2:159949804-159949826 TGCTGCCAGCCGTCGTGGCAAGG - Intronic
941472781 2:165910253-165910275 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
941516465 2:166486345-166486367 TGGAGCCAGACTTGGTGCTAGGG - Intronic
941807075 2:169720265-169720287 ACTAGCCAGGCGTGGTGGCATGG - Intronic
941835987 2:170021441-170021463 TGTAACCTCACGTGGTGGAAGGG + Intronic
942040581 2:172058147-172058169 ATTAGCCAGATGTGGTGGCTTGG - Intronic
942238764 2:173939615-173939637 ATTAGCCAGGTGTGGTGGCATGG + Intronic
942602741 2:177658020-177658042 AGTAGCCAGAGCTGGTGGCCAGG + Intronic
942908780 2:181216145-181216167 ATTAGCCAGATGTGGTGGCACGG - Intergenic
942930700 2:181488987-181489009 TGCAGGCAGACATGGTGGAATGG - Intronic
943582489 2:189701378-189701400 ATTAGCCAGCCATGGTGGCATGG - Intronic
943598931 2:189891369-189891391 ATTAGCCAGGCATGGTGGCATGG - Intronic
944163476 2:196691791-196691813 ATTAGCCAGGCGTGGTGGCATGG + Intronic
944713743 2:202359025-202359047 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
945493491 2:210482448-210482470 ATTAGCCAGGCGTGGTGGCACGG - Intronic
945680161 2:212904065-212904087 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
946072496 2:217046614-217046636 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
946877893 2:224148212-224148234 ATTAGCCAGGCGCGGTGGCATGG + Intergenic
947215189 2:227743803-227743825 TGTAGCTGAACCTGGTGGCATGG + Intergenic
947495884 2:230636393-230636415 ATTAGCCAGGCATGGTGGCACGG + Intergenic
947761249 2:232605300-232605322 ATTAGCCGGGCGTGGTGGCATGG + Intergenic
947768342 2:232651672-232651694 ATTAGCTAGGCGTGGTGGCAGGG + Intronic
947775011 2:232701575-232701597 ATTGGCCAGATGTGGTGGCATGG - Intronic
947970456 2:234318959-234318981 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
948054132 2:234998721-234998743 GGTAGCCAGAGGCGGGGGCAGGG - Intronic
948597875 2:239092089-239092111 ATTAGCCAGATGTGGTGGCCTGG + Intronic
1168738338 20:164595-164617 ATTAGCCAGGCATGGTGGCAGGG + Intergenic
1168755692 20:315877-315899 ATTAGCCGGGCGTGGTGGCACGG - Intergenic
1168766725 20:386718-386740 ATTAGCCAGGCGTGGTGGCGTGG - Intronic
1168768734 20:399939-399961 AATAGCCAGGCGTGGTGGCATGG + Intergenic
1170876800 20:20257465-20257487 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
1171851068 20:30308304-30308326 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1171853762 20:30326543-30326565 TACAGCCAGGCCTGGTGGCATGG + Intergenic
1171868468 20:30507812-30507834 ATTAGCCAGGCCTGGTGGCATGG - Intergenic
1172019586 20:31904503-31904525 ATTAGCCAGGCATGGTGGCATGG - Intronic
1172306962 20:33887638-33887660 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
1172415686 20:34765307-34765329 ATTAGCCAGGCATGGTGGCATGG + Intronic
1172466892 20:35161934-35161956 ATGAGCCAGGCGTGGTGGCAGGG + Intergenic
1172758157 20:37301995-37302017 TGCAGCCAGAGGTGTGGGCAGGG + Intronic
1174341024 20:49895483-49895505 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1174394883 20:50241013-50241035 AATAGCCAGGCGTGGTGGCACGG - Intergenic
1174448622 20:50606875-50606897 ATTAGCCAGGCGTGGTGGCACGG - Intronic
1174522073 20:51139359-51139381 ATTAGCCGGGCGTGGTGGCATGG - Intergenic
1175333181 20:58178555-58178577 TGTAGGCAGACGTTGTGGAAAGG - Intergenic
1176012256 20:62904631-62904653 ATTAGCCAGGCATGGTGGCACGG + Intronic
1176229757 20:64026209-64026231 TGTGGCCGGGCGTGGTGGCCGGG + Intronic
1176423552 21:6534004-6534026 TGGAGGCAGACCTGGAGGCAGGG + Intergenic
1176523843 21:7849957-7849979 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1176589838 21:8636456-8636478 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1176704287 21:10100173-10100195 ATTAGCCAGGCATGGTGGCACGG - Intergenic
1177104953 21:16944075-16944097 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1177144654 21:17394398-17394420 ATTAGCCAGGCATGGTGGCACGG - Intergenic
1177849582 21:26330607-26330629 TTTAGCCAGGTGTGGCGGCACGG - Intergenic
1177926511 21:27222505-27222527 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1178266367 21:31146284-31146306 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
1178463295 21:32822920-32822942 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1178657863 21:34479969-34479991 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1178993665 21:37377265-37377287 ATTAGCCGGGCGTGGTGGCAGGG - Intronic
1179068492 21:38049467-38049489 ATTAGCTAGGCGTGGTGGCATGG + Intronic
1179454066 21:41486445-41486467 ATTAGCCAGACGTGGTGGTGCGG - Intronic
1179658679 21:42861164-42861186 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
1179672048 21:42956227-42956249 ATTAGCCAGGTGTGGTGGCAAGG + Intergenic
1179699046 21:43142320-43142342 TGGAGGCAGACCTGGAGGCAGGG + Intergenic
1180272671 22:10613471-10613493 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1180814673 22:18781983-18782005 TGTCCCCACACGTGGTGGGAAGG + Intergenic
1180992222 22:19943492-19943514 ATTAGCCCGGCGTGGTGGCATGG + Intronic
1181123078 22:20685475-20685497 TTTAGCCGGGCTTGGTGGCATGG + Intergenic
1181169051 22:20998136-20998158 TGAAGCCAGCAGTGGTGGCCGGG - Exonic
1181200862 22:21216319-21216341 TGTCCCCACACGTGGTGGGAAGG + Intronic
1181280975 22:21720350-21720372 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1181292725 22:21809806-21809828 ATTAGCCAGGCGTGGTGGCGGGG - Intronic
1181590186 22:23879401-23879423 ATTAGCCAAGCGTGGTGGCACGG - Intronic
1181700883 22:24620654-24620676 TGTCCCCACACGTGGTGGGAAGG - Intronic
1182415084 22:30216352-30216374 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
1182490174 22:30666472-30666494 ATTAGCCAGGCGTGGTGGCATGG + Intronic
1183010947 22:34946124-34946146 ATTAGCCAGGCATGGTGGCACGG + Intergenic
1183218557 22:36497030-36497052 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1183483402 22:38076898-38076920 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1183988256 22:41581174-41581196 CTTAGCCAGGTGTGGTGGCATGG + Intronic
1184084340 22:42250295-42250317 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
1184446936 22:44553564-44553586 ATTAGCCAGGCATGGTGGCAGGG + Intergenic
1184497848 22:44852948-44852970 ATTAGCCAGGCGTGGTGACACGG - Intronic
1184625740 22:45727503-45727525 ACTAGCCAGCCGTGGTGGCAGGG - Intronic
1184634643 22:45817470-45817492 ATTAGCCAGGCGTCGTGGCATGG - Intronic
1184737031 22:46405310-46405332 ATTAGCCAGGCGTCGTGGCAGGG + Intronic
1184752791 22:46498462-46498484 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
1184921359 22:47608027-47608049 ATTAGCCAGGGGTGGTGGCATGG - Intergenic
1184928454 22:47661172-47661194 TGGAGCCAAACTTGGTGGCAAGG + Intergenic
1185162648 22:49239082-49239104 TGAGGCCAGACGGGGTGGGAAGG + Intergenic
1203226057 22_KI270731v1_random:79116-79138 TGTCCCCACACGTGGTGGGAAGG - Intergenic
1203264770 22_KI270734v1_random:7670-7692 TGTCCCCACACGTGGTGGGAAGG + Intergenic
949137450 3:585250-585272 ATCAGCCAGGCGTGGTGGCAGGG - Intergenic
949757964 3:7435658-7435680 ACTAGCCGGATGTGGTGGCAAGG - Intronic
949937465 3:9127187-9127209 ATTAGCCAGGTGTGGTGGCATGG + Intronic
950679998 3:14578567-14578589 ATTAGCCAGGCATGGTGGCAGGG + Intergenic
950804818 3:15590931-15590953 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
950979252 3:17284263-17284285 ATTAGCCAGACATGGTGGCAGGG - Intronic
950989995 3:17424274-17424296 TGTAGTCATATGTGCTGGCAAGG + Intronic
951458879 3:22927139-22927161 ATTAGCCAGGCCTGGTGGCATGG + Intergenic
952356247 3:32587135-32587157 ATTAGCCAGATGTGGTGGCATGG - Intergenic
952618691 3:35308318-35308340 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
952758257 3:36891190-36891212 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
953486711 3:43305629-43305651 ATTAGCTAGGCGTGGTGGCAGGG - Intronic
953973478 3:47364956-47364978 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
954071940 3:48149447-48149469 ACTAGCCAGGCGTGGTGGCAGGG - Intergenic
954075173 3:48173069-48173091 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
954158636 3:48703567-48703589 ATTAGCCAGGCATGGTGGCAGGG + Intronic
954373538 3:50182812-50182834 TGAAGCCAGAACTGGTGGAAGGG - Intronic
954377557 3:50203133-50203155 TGTTAGCAGAGGTGGTGGCATGG + Intergenic
954585828 3:51735580-51735602 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
955445603 3:59006877-59006899 TGTAGGCAGACTGGGAGGCAAGG + Intronic
955758479 3:62251488-62251510 ATTAGCCAGGCATGGTGGCACGG + Intronic
956852365 3:73241410-73241432 ATTAGCCAGGTGTGGTGGCACGG - Intergenic
957657318 3:83097206-83097228 ATTAGCCAGGCATGGTGGCATGG - Intergenic
957895200 3:86412578-86412600 ATTAGCCAGGCATGGTGGCATGG - Intergenic
958487926 3:94735116-94735138 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
958501714 3:94919215-94919237 ATTAGCCAGCTGTGGTGGCATGG - Intergenic
959188820 3:103083269-103083291 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
959669268 3:108956224-108956246 ATTAGCCAGGCATGGTGGCACGG + Intergenic
959704720 3:109329385-109329407 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
960637902 3:119801943-119801965 GGTAGCCAGACTTTGTTGCATGG + Intronic
960959023 3:123056110-123056132 ATTAGCCAGACGAAGTGGCATGG + Intergenic
961431652 3:126888227-126888249 TGCAGGCAGTCCTGGTGGCATGG - Intronic
961600516 3:128057710-128057732 ATTAGCCAGGCGTGGTGACAAGG + Intronic
961952666 3:130766322-130766344 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
962518902 3:136179916-136179938 ACTAGCCAGGCGTGGTGGCGGGG + Intronic
965315901 3:167190526-167190548 ATTAGCCGGGCGTGGTGGCAGGG - Intergenic
966364818 3:179173872-179173894 ATTAGCCAGGTGTGGTGGCAGGG - Intronic
966523910 3:180900589-180900611 ATCAGCCAGGCGTGGTGGCACGG + Intronic
966789367 3:183651799-183651821 ATTAGCCAGGCATGGTGGCACGG + Intronic
966819897 3:183916045-183916067 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
966990157 3:185221718-185221740 AGTAGCCGGGGGTGGTGGCATGG - Intronic
967063787 3:185896061-185896083 ATTAGCCAGGAGTGGTGGCATGG - Intergenic
967073870 3:185984692-185984714 ATTAGCCAGACGTGGTGGCGGGG - Intergenic
967156838 3:186700639-186700661 ATTAGCCAGGCGTGGTAGCATGG - Intergenic
967585256 3:191206035-191206057 CTTAGCCAGACACGGTGGCAGGG + Intronic
968033471 3:195524372-195524394 ATTAGCCAGGCTTGGTGGCATGG + Intronic
968196948 3:196714314-196714336 AGTAGCCAGGTGTGGTGGCGTGG + Intronic
969029424 4:4199558-4199580 ATTAGCCGGGCGTGGTGGCACGG - Intronic
969086622 4:4661526-4661548 CTTAGCCAGGCATGGTGGCATGG - Intergenic
969341180 4:6542545-6542567 ATTAGCCAGGCATGGTGGCATGG + Intronic
969851327 4:9959242-9959264 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
970492323 4:16586875-16586897 TGAAGGCAGACGTGGAGACAAGG - Intronic
970865080 4:20749008-20749030 TCTAGCTGGGCGTGGTGGCACGG + Intronic
971679723 4:29681576-29681598 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
972257683 4:37375714-37375736 ATTAGCCAGGCATGGTGGCAGGG - Intronic
972351639 4:38241839-38241861 TTTAGCCAGGCATAGTGGCAGGG + Intergenic
972433735 4:39011624-39011646 ATTAGCCAGGCATGGTGGCAAGG + Intronic
972469322 4:39388677-39388699 TGGAGCCAGATGTGGTGGCTCGG + Intergenic
972547584 4:40095226-40095248 ATTAGCCAGGCGTGGTGGCATGG - Intronic
972779134 4:42270704-42270726 ATTAGCCAGGTGTGGTGGCACGG + Intergenic
973268112 4:48231607-48231629 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
974511962 4:62854884-62854906 ATTAGCCAGACATGGTGGCATGG + Intergenic
975139419 4:70904128-70904150 ATTAGCCAGGCGTGGTGGCGCGG - Intronic
975657220 4:76653711-76653733 ATTAGCCAGGTGTGGTGGCATGG - Intronic
976084928 4:81398092-81398114 AATAGCCAGCCATGGTGGCATGG + Intergenic
976430914 4:84963274-84963296 ATTAGCCAGGCGTGGTGGCGAGG + Intronic
977195458 4:94053528-94053550 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
977605343 4:98978972-98978994 TGTATCCTCACGTGGTGGAAGGG + Intergenic
978062528 4:104355205-104355227 ATTAGCCAGGCATGGTGGCAGGG + Intergenic
978132317 4:105214004-105214026 GTTAGCCAGGCATGGTGGCATGG - Intronic
979081528 4:116349703-116349725 ATTAGCCAGGCGTGGTAGCAGGG + Intergenic
979492851 4:121348947-121348969 ATTAGCCAGGAGTGGTGGCAGGG + Intronic
980080813 4:128341944-128341966 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
980107703 4:128603591-128603613 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
980300346 4:130983159-130983181 AGTAGCTAGGCATGGTGGCATGG + Intergenic
980371285 4:131876674-131876696 CGTAGCCAGAAGTTGAGGCAAGG + Intergenic
980376502 4:131956509-131956531 ATTAGCCAGGCATGGTGGCATGG - Intergenic
981015482 4:139969570-139969592 TATTGCCAGAAGTGGTGTCAGGG - Intronic
981428489 4:144632687-144632709 TTTAGCCAGGCATTGTGGCATGG + Intergenic
982161025 4:152569515-152569537 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
982441429 4:155440725-155440747 ATTAGCTGGACGTGGTGGCACGG - Intergenic
982453801 4:155584110-155584132 ATTAGCCGGGCGTGGTGGCATGG + Intergenic
982541888 4:156682791-156682813 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
982711010 4:158758962-158758984 AGTAGCCAGACATGGTGGTGTGG - Intergenic
982979842 4:162118406-162118428 ATTAGCCAGGCGTGGTGGCGGGG - Intronic
983223587 4:165065832-165065854 TTTAGCTGGGCGTGGTGGCATGG + Intergenic
983271352 4:165565836-165565858 TTTAGCCAGGCGTGGTGGCATGG + Intergenic
983588784 4:169384501-169384523 TTTAGCCTGGTGTGGTGGCACGG + Intergenic
983730207 4:170983721-170983743 ATTAGCCTGGCGTGGTGGCAGGG + Intergenic
984082688 4:175267945-175267967 ATTAGCCAGGCATGGTGGCAAGG + Intergenic
984114362 4:175661284-175661306 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
984728953 4:183047865-183047887 ATTAGCCAGGCTTGGTGGCATGG - Intergenic
985275596 4:188234454-188234476 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
985892033 5:2723650-2723672 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
986390927 5:7287749-7287771 TGGTGGCAGACGTGGTGGCATGG - Intergenic
986401839 5:7389708-7389730 GTTAGCCAGGCGTGGTGGCAGGG - Intergenic
986719522 5:10551170-10551192 ATTAGCCAGGTGTGGTGGCAAGG - Intergenic
986964823 5:13257760-13257782 GTTAGCCAGGCCTGGTGGCAGGG - Intergenic
987302279 5:16607351-16607373 TTTGGCCAGGCGTGGTGGCTCGG + Intronic
987661619 5:20885758-20885780 ATTAGCCAGGCATGGTGGCATGG - Intergenic
987738809 5:21878593-21878615 ATTAGCCAGGCATGGTGGCATGG + Intronic
988201422 5:28074709-28074731 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
988929974 5:36028053-36028075 TGTTCTGAGACGTGGTGGCAAGG + Intergenic
988992045 5:36680767-36680789 ATTAGCCAGGCCTGGTGGCACGG + Intronic
989032019 5:37128709-37128731 ATTAGCCAGGTGTGGTGGCATGG + Intronic
989057244 5:37377556-37377578 ATTAGCCAGGGGTGGTGGCAGGG + Intergenic
989264256 5:39454934-39454956 ATTAGCCAGGCGTGGTGGCAGGG - Intronic
989414298 5:41155580-41155602 AGTAGCGAGAAGTGGTGGCATGG + Intronic
989416125 5:41178621-41178643 ATTTGCCAGACGTGGTGGCGGGG - Intronic
989672840 5:43938380-43938402 ATTAGCCAGGCGTGGAGGCAGGG + Intergenic
990019252 5:51105100-51105122 ATTAGCCAGGCATGGTGGCATGG - Intergenic
990019502 5:51107819-51107841 TGGAGCCAGTGATGGTGGCAGGG + Intergenic
990089900 5:52030118-52030140 ATTAGCCAGGCGTGGTGGCATGG + Intronic
990764103 5:59163086-59163108 AGTAGCCAGGCATGGAGGCATGG - Intronic
990782705 5:59384034-59384056 AATAGCCAGGTGTGGTGGCATGG - Intronic
990953400 5:61320424-61320446 TGTAGCCAGAAGTCTTGGAAAGG - Intergenic
991054205 5:62305039-62305061 ATTAGCCAGGCGTGGTGGCGCGG + Intergenic
991150661 5:63364646-63364668 AGTAGCTGGGCGTGGTGGCACGG + Intergenic
992555660 5:77900375-77900397 GTTAGCCAGGCATGGTGGCAAGG + Intergenic
992682444 5:79166633-79166655 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
992750602 5:79857251-79857273 TGTAGTTGGGCGTGGTGGCAGGG + Intergenic
993731505 5:91428386-91428408 TGAAGCCCGGCATGGTGGCATGG + Intergenic
995156386 5:108918632-108918654 ATTAGCCAGGCGTGGTGGCGGGG - Intronic
995209847 5:109525210-109525232 TGTAGACATAGGTGGTTGCATGG + Intergenic
995459449 5:112387479-112387501 ATTAGCCAGGCATGGTGGCAGGG + Intronic
995600533 5:113790736-113790758 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
996105621 5:119498730-119498752 ATTAGCCAGGCATGGTGGCACGG + Intronic
996370483 5:122747681-122747703 ATTAGCCGGGCGTGGTGGCATGG - Intergenic
996428855 5:123347790-123347812 TTTAGCCGGGTGTGGTGGCATGG - Intronic
996724152 5:126659311-126659333 ATTAGCCAAGCGTGGTGGCATGG + Intergenic
996726659 5:126678601-126678623 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
997344285 5:133175148-133175170 CTTAGCCGGGCGTGGTGGCAGGG - Intergenic
997461002 5:134052439-134052461 ATTAGCCAGGCGTGGTAGCATGG - Intergenic
997462804 5:134065939-134065961 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
997485168 5:134225484-134225506 TGGCGCCAGACGAGGTGGCAGGG - Intronic
997953647 5:138261544-138261566 ATTAGCCAGGCATGGTGGCAGGG + Intronic
998255526 5:140584409-140584431 ATTAGCCAGGCATGGTGGCAGGG + Intronic
998451958 5:142241631-142241653 AATAGCCAGGCGTGGTGGCAGGG + Intergenic
999103666 5:149049621-149049643 ATTAGCCAGACATGGTGGCCTGG + Intronic
999401567 5:151268300-151268322 ATTAGCCGGGCGTGGTGGCAGGG - Exonic
999933772 5:156463185-156463207 ATTAGCCAGACGTGGTGGCCTGG - Intronic
1000602890 5:163296262-163296284 ATTAGCCAGGCCTGGTGGCAGGG - Intergenic
1000685184 5:164239564-164239586 AATAGCCAGGTGTGGTGGCAGGG + Intergenic
1001318650 5:170662586-170662608 TGTAGCCTGGGGAGGTGGCAAGG - Intronic
1001886806 5:175299589-175299611 TATAGCCACACATGGTGGAAGGG - Intergenic
1002029633 5:176418286-176418308 ATTAGCCAGACATGGTGGTATGG + Intergenic
1002141704 5:177145424-177145446 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1002157000 5:177290553-177290575 ATTAGCCAGGTGTGGTGGCAGGG - Intronic
1002417209 5:179126822-179126844 GGGAGGCTGACGTGGTGGCAGGG + Intronic
1002476027 5:179466780-179466802 ATTAGCCACGCGTGGTGGCAGGG + Intergenic
1002539584 5:179897463-179897485 AGTAGCTGGGCGTGGTGGCATGG - Intronic
1004047639 6:12041805-12041827 ATTAGCCAGGCATGGTGGCATGG - Intronic
1004222291 6:13757151-13757173 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1004629320 6:17406539-17406561 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1004660070 6:17702357-17702379 ATTAGCCGGACGTGGTGGCAAGG + Intronic
1004858060 6:19771450-19771472 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1004904880 6:20228149-20228171 ATTAGCCGGGCGTGGTGGCATGG + Intergenic
1005324623 6:24687215-24687237 GGTAGCCAGAGCTGGGGGCAAGG - Intronic
1005726191 6:28651099-28651121 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
1005751941 6:28891707-28891729 ATTAGCCGGGCGTGGTGGCACGG + Intergenic
1006199040 6:32269825-32269847 ATTAGCCGGGCGTGGTGGCAGGG - Intergenic
1006485363 6:34335868-34335890 TATAGCCAGGCCTGGTGGTATGG - Intronic
1006853964 6:37119858-37119880 ATTAGCCAGGCGTGGTGGCGTGG + Intergenic
1007105269 6:39279468-39279490 TGTAGCCTGAGGTCCTGGCATGG - Intergenic
1007106726 6:39288477-39288499 TGTGGCCAGACGAGGAAGCAGGG + Intergenic
1007196785 6:40068190-40068212 GGAAGCCAGGTGTGGTGGCATGG + Intergenic
1007566602 6:42856167-42856189 ATTAGCCAGGCGTGGTGGTACGG + Intronic
1008085946 6:47244174-47244196 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
1010210596 6:73360239-73360261 ATTAGCGAGATGTGGTGGCAGGG - Intergenic
1011293557 6:85803254-85803276 ATTAGCTAGATGTGGTGGCATGG + Intergenic
1011452805 6:87513449-87513471 AGTAGCCAGGCGTGGTGGCGGGG - Intergenic
1012375399 6:98555960-98555982 TCTGGCCAGATGAGGTGGCAGGG - Intergenic
1012683489 6:102212418-102212440 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
1012857390 6:104518455-104518477 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
1012883209 6:104815923-104815945 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1013517433 6:110901122-110901144 TTTAGCCAGGCATGGTGGCAGGG + Intergenic
1013584030 6:111562695-111562717 ATTAGCCAGGCTTGGTGGCAGGG + Intronic
1013662334 6:112310237-112310259 ATTAGCCAGGCATGGTGGCATGG - Intergenic
1014453518 6:121610449-121610471 ATTAGCCAGGCATGGTGGCATGG - Intergenic
1015161537 6:130157474-130157496 ATTAACCAGATGTGGTGGCATGG - Intronic
1015171093 6:130254340-130254362 ATTAGCCAGGTGTGGTGGCAGGG - Intronic
1015369003 6:132429462-132429484 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1016132560 6:140494246-140494268 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1016150506 6:140735617-140735639 ATTAGCCAGGCGTGGTGGCGCGG - Intergenic
1016926536 6:149355517-149355539 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
1017195363 6:151694637-151694659 ATTAGCCAGGAGTGGTGGCATGG + Intronic
1017489864 6:154935574-154935596 TGTGGCCAGGCGTGGTGGCGCGG + Intronic
1017807450 6:157958040-157958062 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1017833036 6:158149137-158149159 ATTAGCCAGGCGTGGTGGCGAGG - Intronic
1018803847 6:167243526-167243548 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
1019478735 7:1256377-1256399 AGTAGGCAGAAGTGCTGGCAAGG - Intergenic
1020065903 7:5188569-5188591 ATTAGCCAGTTGTGGTGGCACGG - Intergenic
1020416262 7:7949482-7949504 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1020424861 7:8053468-8053490 ATTAGCCAGACGTGGTGGTGTGG - Intronic
1020476137 7:8597315-8597337 GGTGGACAGACGTGGTGGCTGGG + Intronic
1020885604 7:13815800-13815822 ATTAGCCAGGCGTGGTGGCTGGG + Intergenic
1020887980 7:13843357-13843379 ATTAGCCAGGTGTGGTGGCACGG + Intergenic
1022084445 7:27052965-27052987 ATTAGCCAGGCGTGATGGCAGGG - Intergenic
1022492653 7:30832655-30832677 ATTAGCCAGGTGTGGTGGCACGG - Intronic
1022885543 7:34639756-34639778 ATTAGCCAGGCGTGGGGGCAGGG - Intergenic
1022997392 7:35770954-35770976 ATTGGCCAGGCGTGGTGGCATGG + Intergenic
1023394134 7:39736688-39736710 ATTAGCCAGGCATGGTGGCATGG - Intergenic
1023410582 7:39885660-39885682 ATTAGCCGGGCGTGGTGGCAAGG + Intergenic
1024143932 7:46491868-46491890 ATTAGCCAGATGTGGTGGCGGGG + Intergenic
1025127952 7:56360055-56360077 ATTAGCCAGGCGTGGTGGCCGGG - Intergenic
1025135641 7:56409540-56409562 ATTAGGCAGGCGTGGTGGCAGGG + Intergenic
1025165171 7:56706001-56706023 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1026178557 7:68018807-68018829 ATTAGCAGGACGTGGTGGCAGGG + Intergenic
1026327822 7:69325931-69325953 ATTAGCCGGGCGTGGTGGCAAGG + Intergenic
1026594871 7:71726089-71726111 ATTAGCCAGGCGTGGTGGCGGGG + Intergenic
1026636447 7:72086579-72086601 TGTAGCCAGGCATGGTGGCACGG - Intronic
1026737000 7:72955242-72955264 ATTAGCCGGGCGTGGTGGCACGG - Intergenic
1026797304 7:73374618-73374640 ATTAGCCAGGCGTGGTGGCTGGG + Intergenic
1026941999 7:74292532-74292554 ATTAGCCAGTCTTGGTGGCATGG - Intronic
1027106732 7:75409826-75409848 ATTAGCCGGGCGTGGTGGCACGG + Intronic
1027795428 7:82687334-82687356 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1028431155 7:90748728-90748750 AATAGCCAGACATGATGGCATGG - Intronic
1028434534 7:90786769-90786791 ATTAGCCTGACGTGATGGCATGG + Intronic
1028703918 7:93815750-93815772 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1028767028 7:94571189-94571211 ATTAGCCAGGCATGGTGGCATGG - Intergenic
1029098644 7:98109007-98109029 ATTAGCCGGACATGGTGGCAGGG - Intronic
1029137597 7:98385158-98385180 ATTAGCCAGGCATGGTGGCAGGG + Intronic
1029207338 7:98877874-98877896 TGGAGCCAGGGGAGGTGGCATGG - Intergenic
1029248755 7:99221224-99221246 AGTAGCCAGGCGTGGTGGCGGGG + Intergenic
1029442280 7:100593647-100593669 ATTAGCCGGACGTGGTGGCATGG + Intronic
1029997888 7:105027228-105027250 ATTAGCCAGACATGGTGACATGG - Intronic
1030022656 7:105291189-105291211 TGAAGCCAGAGATGATGGCAGGG + Intronic
1030097823 7:105916821-105916843 TGGAGCCTGTAGTGGTGGCAAGG + Intronic
1030199491 7:106888086-106888108 ATTAGCCAGGCATGGTGGCACGG - Intronic
1030631407 7:111899773-111899795 ATTAGCCAGGCGTGGTGGCCGGG + Intronic
1030664067 7:112254821-112254843 ATTAGCCGGGCGTGGTGGCATGG + Intronic
1031000233 7:116406787-116406809 TTTAGCCAGGCATGGTGGCCAGG - Intronic
1031469019 7:122147052-122147074 ATTAGCCAGGCATGGTGGCAAGG + Intergenic
1032157675 7:129482523-129482545 ATTAGCCAGGCGTGGTGGCATGG - Intronic
1032742490 7:134752852-134752874 ATTAGCCAGGCGTGGTGGCATGG + Intronic
1032833782 7:135654711-135654733 ATTAGCCCGGCGTGGTGGCAGGG + Intergenic
1033204494 7:139406197-139406219 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1033304822 7:140217338-140217360 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1034183984 7:149160281-149160303 AGTAGCCAGATGTGGTGGTGGGG + Intronic
1034623173 7:152471950-152471972 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1035158940 7:156936874-156936896 ATTAGCCAGGTGTGGTGGCATGG - Intergenic
1035356261 7:158277667-158277689 TGGAGACAGACTTGGAGGCAAGG - Intronic
1035856561 8:2982206-2982228 ATTAGCCAGGCATGGTGGCAGGG + Intronic
1035863539 8:3056514-3056536 AATAGCCAGGCGTGGTGGCCTGG - Intronic
1036774767 8:11603410-11603432 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1036805175 8:11826665-11826687 ATTAGCCGGGCGTGGTGGCAAGG + Intronic
1037377334 8:18245066-18245088 ATTAGCCAGGTGTGGTGGCATGG + Intergenic
1037672938 8:21030692-21030714 ATTAGCCAGGCCTGGTGGCAGGG - Intergenic
1037934716 8:22907786-22907808 GGCAGGCAGAGGTGGTGGCAGGG + Intronic
1038003164 8:23407511-23407533 ATTAGCCAGGCGTGGTGGTATGG + Intronic
1038636375 8:29290939-29290961 ATTAGCCAGGCATGGTGGCACGG - Intergenic
1039494858 8:37973173-37973195 ATTAGCCGGGCGTGGTGGCACGG - Intergenic
1040402583 8:47066896-47066918 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1040676396 8:49756233-49756255 ATTAGCCAGACATGGTGGCATGG - Intergenic
1040758763 8:50812575-50812597 GTTAGCCAGACAGGGTGGCATGG + Intergenic
1041683820 8:60623852-60623874 AGTAGCCGGGCGTGGTGGCAGGG - Intergenic
1042169934 8:65981345-65981367 GGCAACCAGACGTGGTGACATGG - Intergenic
1042317368 8:67438063-67438085 ACTAGCCAGGTGTGGTGGCAGGG - Intronic
1042692858 8:71522755-71522777 ATTAGCCAGGTGTGGTGGCATGG - Intronic
1043680473 8:83018786-83018808 AGTAGCCAGGCATGGTGGCATGG + Intergenic
1043699147 8:83262188-83262210 ATTAGCCAGGCGTGGTGGCATGG + Intergenic
1043828555 8:84960036-84960058 ATTAGCCAGATGTGGTGGCACGG + Intergenic
1044280295 8:90346761-90346783 ATTAGCCGGGCGTGGTGGCATGG - Intergenic
1044515394 8:93132104-93132126 TGCATCCTCACGTGGTGGCAAGG - Intergenic
1044583881 8:93850717-93850739 ATTAGCCGGGCGTGGTGGCATGG + Intergenic
1045158664 8:99510656-99510678 ATTAGCCAGATGTGGTGGCATGG - Intronic
1045162831 8:99568436-99568458 GTTAGCCAGGCGTGGTGGCGTGG - Intronic
1045262502 8:100589151-100589173 ATTAACCAGGCGTGGTGGCAGGG + Intronic
1045288815 8:100814266-100814288 AATAGCCAGGCATGGTGGCATGG + Intergenic
1045662015 8:104448006-104448028 TAGAGCCAGCCGTGGTGGCATGG + Intronic
1046055960 8:109078781-109078803 ACTAGCCAGGCATGGTGGCACGG + Intergenic
1046408810 8:113812230-113812252 ATTAGCTCGACGTGGTGGCACGG - Intergenic
1048036667 8:130683656-130683678 ATTAGCCGGGCGTGGTGGCATGG - Intergenic
1048148203 8:131866233-131866255 ATTAGCCAGGTGTGGTGGCACGG - Intergenic
1049980696 9:901472-901494 ATTAGCCAGGCATGGTGGCAGGG - Intronic
1050324195 9:4484563-4484585 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1050427677 9:5528446-5528468 ATTAGCCAGGCATGGTGGCATGG - Intronic
1050529579 9:6576612-6576634 ATTAGCCAGGTGTGGTGGCAGGG - Intronic
1050560121 9:6826717-6826739 ATTAGCCAGGCATGGTGGCAGGG + Intronic
1050692889 9:8248487-8248509 TGGAGGGAGAAGTGGTGGCAAGG - Intergenic
1051024144 9:12586796-12586818 TGTAGCCTGTCGTGGTCTCAAGG + Intergenic
1051423603 9:16913315-16913337 ATTAGCCAGGCGTGGTGGCATGG - Intergenic
1052193026 9:25679651-25679673 ATTAGCCGGGCGTGGTGGCACGG + Intergenic
1052205622 9:25836068-25836090 ATTAGCCGGGCGTGGTGGCAGGG + Intergenic
1052299648 9:26939238-26939260 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
1052693725 9:31849601-31849623 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1052725523 9:32224159-32224181 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
1052948733 9:34190435-34190457 TTTAGCCAGGCATGGTGGCAAGG - Intronic
1052951632 9:34218102-34218124 ATTAGCCAGGCGTGGTGGCGGGG + Intronic
1052981853 9:34456043-34456065 ATTAGCCATGCGTGGTGGCAGGG + Intronic
1052989572 9:34511213-34511235 TGTTGCCAGATGTGGAGGCCTGG - Intronic
1053205024 9:36178949-36178971 AATTGCCAGGCGTGGTGGCAGGG - Intergenic
1053641549 9:40087190-40087212 ATTAGCCAGGCATGGTGGCACGG - Intergenic
1053764585 9:41378274-41378296 ATTAGCCAGGCATGGTGGCACGG + Intergenic
1053791559 9:41689835-41689857 TACAGCCAGGCCTGGTGGCATGG + Intergenic
1054153598 9:61624935-61624957 TACAGCCAGGCCTGGTGGCATGG - Intergenic
1054179965 9:61901850-61901872 TACAGCCAGGCCTGGTGGCATGG + Intergenic
1054322434 9:63684574-63684596 ATTAGCCAGGCATGGTGGCACGG - Intergenic
1054473380 9:65556063-65556085 TACAGCCAGGCCTGGTGGCATGG - Intergenic
1054657628 9:67679291-67679313 TACAGCCAGGCCTGGTGGCATGG - Intergenic
1054675032 9:67849150-67849172 ATCAGCCAGGCGTGGTGGCAGGG - Intergenic
1054735125 9:68743349-68743371 ATTAGCCAGGCATGGTGGCATGG - Intronic
1054781114 9:69166787-69166809 ATTAGCCAGGCCTGGTGGCATGG + Intronic
1054895705 9:70308443-70308465 ATTAGCCGGGCGTGGTGGCAGGG + Intronic
1055016143 9:71620143-71620165 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1055026484 9:71727911-71727933 ATTAGCCAGCCGTGGTGGCAGGG + Intronic
1055528915 9:77163791-77163813 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1055554915 9:77464146-77464168 ATTAGCCGGACTTGGTGGCAAGG - Intronic
1055595572 9:77861850-77861872 ATTAGCCGGGCGTGGTGGCATGG + Intronic
1055681476 9:78720265-78720287 TGTAACCTCACGTGGTGGAAGGG + Intergenic
1056409053 9:86307123-86307145 ATTAGCCAGGCGTGGTGGCACGG + Intronic
1056566180 9:87774672-87774694 ATTAGCCGGGCGTGGTGGCAGGG - Intergenic
1056687997 9:88782634-88782656 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1057023127 9:91716086-91716108 ATTAGCCAGGCATGGTGGCATGG + Intronic
1057080538 9:92171574-92171596 TGTAGTAAGGGGTGGTGGCATGG - Intergenic
1057157132 9:92852682-92852704 ATTAGCCAGGCGAGGTGGCAGGG - Intronic
1057946288 9:99331995-99332017 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1058454302 9:105125041-105125063 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1058485008 9:105434997-105435019 TGTAACCAGGTGTGGTGGCACGG + Intronic
1058690539 9:107516808-107516830 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1058740701 9:107939511-107939533 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1058785126 9:108379375-108379397 TGTGGCCTCACGTGGTGGAAGGG - Intergenic
1058849192 9:108994082-108994104 ATTAGCCAGGTGTGGTGGCAGGG + Intronic
1059946223 9:119411072-119411094 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1060277777 9:122194870-122194892 ATTAGCCAGGTGTGGTGGCACGG + Intronic
1060546407 9:124463983-124464005 ATTAGCCAGGCGTGGTGGTATGG - Intronic
1060972518 9:127746788-127746810 ATTAGCCAGGCGTGGTGGCAGGG + Intronic
1061212274 9:129200824-129200846 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1062563467 9:137152052-137152074 AGTAGCAGGGCGTGGTGGCAGGG - Intronic
1202789324 9_KI270719v1_random:70275-70297 ATTAGCCAGGCATGGTGGCACGG - Intergenic
1203619854 Un_KI270749v1:115103-115125 ATTAGCCAGGCGTGGTGGCAGGG + Intergenic
1185482556 X:458722-458744 TGCGGCCAGGCGTGGTGGCTCGG - Intergenic
1185552210 X:992240-992262 ATTAGCCAGGTGTGGTGGCAGGG - Intergenic
1185623989 X:1469750-1469772 ATTAGCCGGGCGTGGTGGCATGG + Intronic
1185742188 X:2542537-2542559 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1186499118 X:10037026-10037048 TTTAGCCAACAGTGGTGGCATGG - Intronic
1187688952 X:21844363-21844385 CTTAGCCAGGCGTGGTGGTATGG + Intronic
1187696922 X:21932128-21932150 AGTAGCCAGGCGTGGTGGCATGG - Intergenic
1188844024 X:35051553-35051575 ATTAGCTAGGCGTGGTGGCAGGG - Intergenic
1189191032 X:39106080-39106102 ATTAGCCAGGCGTGGTGGCGGGG - Intergenic
1189526378 X:41826617-41826639 CTTAGCCAGGCATGGTGGCATGG - Intronic
1189831601 X:44980142-44980164 ATTAGCCAGGCGTGGTGGCGTGG - Intronic
1189913969 X:45838763-45838785 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1190089152 X:47422307-47422329 ATTAGACAGGCGTGGTGGCATGG + Intergenic
1190192382 X:48288260-48288282 AGTAGCCCGGCATGGTGGCATGG - Intergenic
1190309605 X:49107504-49107526 ATTAGCCAGGTGTGGTGGCAGGG + Intergenic
1190367974 X:49715426-49715448 TTTAGCTGGATGTGGTGGCAGGG - Intergenic
1190573498 X:51809260-51809282 ATTAGCCAGGCATGGTGGCAGGG - Intronic
1190972531 X:55365488-55365510 ATTAGCCAGGCATGGTGGCATGG - Intergenic
1192153428 X:68726036-68726058 TGCAGCCAGACATGGTGGTGGGG + Intergenic
1192275269 X:69623367-69623389 TGTATCCTCACGTGGTGGAAGGG + Intronic
1192306569 X:69966430-69966452 ATTAGCCAGGTGTGGTGGCATGG + Intronic
1192445267 X:71206438-71206460 ATTAGCCAGGCGTGGTGGCGTGG + Intergenic
1192561468 X:72130827-72130849 TTTAGCCACACGTGGGGGGATGG + Exonic
1192776206 X:74248213-74248235 ATTAGCCAGGCGTGGTGGCACGG + Intergenic
1192805764 X:74507092-74507114 ATTAGCCAGGTGTGGTGGCACGG - Intronic
1192965568 X:76173366-76173388 TGTAGCTGGGCGTGGTGGCACGG - Intronic
1193278022 X:79613406-79613428 ATTAGCCAGGCTTGGTGGCACGG - Intergenic
1193875565 X:86858277-86858299 ATTAGCCGGGCGTGGTGGCAGGG - Intergenic
1194284719 X:91995986-91996008 ATTAGCCAGGCGTGGTGGCGGGG - Intronic
1194481638 X:94433668-94433690 ATTAGCCAGGCGTGGTGGCAGGG - Intergenic
1194714926 X:97277188-97277210 AGTAGCCAGGCATGGTGGCGTGG + Intronic
1195532101 X:105969039-105969061 TCCAGCCAGCAGTGGTGGCATGG + Intergenic
1195700016 X:107697928-107697950 ATTAGCCAGGTGTGGTGGCACGG - Intergenic
1196248654 X:113430831-113430853 ATTAGCCAGGCATGGTGGCACGG + Intergenic
1196596136 X:117547820-117547842 TATAGCCAGACGTGGGTGCTAGG + Intergenic
1196971677 X:121116385-121116407 ATTAGCCAGGCGTGGTGGCCAGG + Intergenic
1197792140 X:130266951-130266973 ATTAGCCGGGCGTGGTGGCAAGG + Intronic
1198128162 X:133668048-133668070 ATTAGCCAGGTGTGGTGGCAGGG - Intronic
1200602283 Y:5220556-5220578 ATTAGCCAGGCGTGGTGGCGGGG - Intronic
1200893342 Y:8346973-8346995 ATTAGCCAGGCATGGTGGCAGGG - Intergenic
1201221618 Y:11776497-11776519 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1201225311 Y:11812861-11812883 ATTAGCCAGGAGTGGTGGCAGGG + Intergenic
1201686793 Y:16713600-16713622 ATTAGCCAGGCATGGTGGCATGG + Intergenic
1202175180 Y:22092227-22092249 ATTAGCCAGCTGTGGTGGCATGG - Intronic
1202216182 Y:22494156-22494178 ATTAGCCAGCTGTGGTGGCATGG + Intronic
1202327004 Y:23701908-23701930 ATTAGCCAGCTGTGGTGGCATGG - Intergenic