ID: 1147623174

View in Genome Browser
Species Human (GRCh38)
Location 17:41881743-41881765
Sequence GTGTAGCCAGACGTGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16811
Summary {0: 1, 1: 0, 2: 26, 3: 901, 4: 15883}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623174_1147623177 -10 Left 1147623174 17:41881743-41881765 CCTGCCACCACGTCTGGCTACAC 0: 1
1: 0
2: 26
3: 901
4: 15883
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623174_1147623180 28 Left 1147623174 17:41881743-41881765 CCTGCCACCACGTCTGGCTACAC 0: 1
1: 0
2: 26
3: 901
4: 15883
Right 1147623180 17:41881794-41881816 TGTGCAAGCAGAGCTCACCCTGG 0: 1
1: 0
2: 0
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623174 Original CRISPR GTGTAGCCAGACGTGGTGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr