ID: 1147623174 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:41881743-41881765 |
| Sequence | GTGTAGCCAGACGTGGTGGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 16811 | |||
| Summary | {0: 1, 1: 0, 2: 26, 3: 901, 4: 15883} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1147623174_1147623177 | -10 | Left | 1147623174 | 17:41881743-41881765 | CCTGCCACCACGTCTGGCTACAC | 0: 1 1: 0 2: 26 3: 901 4: 15883 |
||
| Right | 1147623177 | 17:41881756-41881778 | CTGGCTACACAGATCTACCAAGG | 0: 1 1: 0 2: 0 3: 8 4: 96 |
||||
| 1147623174_1147623180 | 28 | Left | 1147623174 | 17:41881743-41881765 | CCTGCCACCACGTCTGGCTACAC | 0: 1 1: 0 2: 26 3: 901 4: 15883 |
||
| Right | 1147623180 | 17:41881794-41881816 | TGTGCAAGCAGAGCTCACCCTGG | 0: 1 1: 0 2: 0 3: 11 4: 163 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1147623174 | Original CRISPR | GTGTAGCCAGACGTGGTGGC AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||