ID: 1147623177

View in Genome Browser
Species Human (GRCh38)
Location 17:41881756-41881778
Sequence CTGGCTACACAGATCTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147623168_1147623177 17 Left 1147623168 17:41881716-41881738 CCTCCCGAGTAGCTGGCATTATA 0: 22
1: 4198
2: 66352
3: 238283
4: 260179
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623165_1147623177 27 Left 1147623165 17:41881706-41881728 CCTGCCTCAGCCTCCCGAGTAGC 0: 87862
1: 235715
2: 200111
3: 128617
4: 141401
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623173_1147623177 -9 Left 1147623173 17:41881742-41881764 CCCTGCCACCACGTCTGGCTACA 0: 1
1: 0
2: 5
3: 187
4: 842
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623169_1147623177 14 Left 1147623169 17:41881719-41881741 CCCGAGTAGCTGGCATTATATGC 0: 1
1: 88
2: 8468
3: 102120
4: 235377
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623167_1147623177 23 Left 1147623167 17:41881710-41881732 CCTCAGCCTCCCGAGTAGCTGGC 0: 677
1: 105064
2: 291600
3: 225942
4: 124342
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623172_1147623177 -8 Left 1147623172 17:41881741-41881763 CCCCTGCCACCACGTCTGGCTAC 0: 1
1: 4
2: 56
3: 431
4: 1460
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623174_1147623177 -10 Left 1147623174 17:41881743-41881765 CCTGCCACCACGTCTGGCTACAC 0: 1
1: 0
2: 26
3: 901
4: 15883
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96
1147623170_1147623177 13 Left 1147623170 17:41881720-41881742 CCGAGTAGCTGGCATTATATGCC 0: 1
1: 5
2: 237
3: 10428
4: 102793
Right 1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147623177 Original CRISPR CTGGCTACACAGATCTACCA AGG Intronic
900313905 1:2047826-2047848 CTGGCAGCACAGATCTCCCCAGG + Intergenic
907691315 1:56669507-56669529 CTGCCTACTGGGATCTACCATGG + Intronic
908139556 1:61170120-61170142 CTGGCTATATAGAGCTACCCTGG + Intronic
915254600 1:154616787-154616809 CTGGGTACACAGATCTATCTGGG - Intronic
918708739 1:187701570-187701592 CAGGGTAAACAGATCTACCCTGG - Intergenic
919081650 1:192874342-192874364 CTGGCTACTCAGAGCCACCCTGG + Intergenic
919638743 1:200029429-200029451 CTGGAAACACAGTTCTTCCAGGG - Intronic
922005710 1:221528685-221528707 TTAGCTACACAGATCAACCCTGG + Intergenic
1064247767 10:13682943-13682965 CTTTCTACACAGGTTTACCAGGG - Intronic
1067993571 10:51243360-51243382 CTGGCTTCACAGCTATTCCAGGG - Intronic
1076429679 10:130393028-130393050 CTGGCTACACAGATGTACTTGGG - Intergenic
1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG + Intronic
1077479828 11:2808317-2808339 CTGGCATCACAGAGCTACCCCGG + Intronic
1081236255 11:40650803-40650825 CTGGCCAAAGAGAACTACCATGG - Intronic
1081461685 11:43278310-43278332 CTGGCTACACAATTCACCCAGGG + Intergenic
1083696341 11:64445304-64445326 CTGGCTAGGCAGGTCTGCCAGGG - Intergenic
1089114414 11:116082734-116082756 CTGGCCCCACAGATCTTCCTGGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1096646147 12:53037397-53037419 CTGGCTTCACAGATGCACGAAGG + Exonic
1098587429 12:72170615-72170637 CTGGCTCCATAGATCTAGGATGG + Intronic
1099273712 12:80548541-80548563 CTGCCTACACCGCTCTACCTGGG - Intronic
1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG + Intronic
1103703168 12:122858427-122858449 CTGGCTACACTCACCTGCCAAGG - Exonic
1108726113 13:53183314-53183336 CTTGCTTCCCAGATTTACCAAGG + Intergenic
1109032835 13:57215878-57215900 CTGGCTATGCAGAGCTACAAAGG + Intergenic
1111975754 13:94965700-94965722 TTGGGTACACAGATGTATCAAGG + Intergenic
1112334774 13:98505168-98505190 CCGGAAACACAGATCCACCAAGG + Intronic
1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG + Intergenic
1121403470 14:93703225-93703247 CTGGCTTCCCAGGACTACCAAGG + Intronic
1122423370 14:101591096-101591118 CTGGCAAAACAGACCTACCTGGG - Intergenic
1122874577 14:104657941-104657963 CAGGAGACACAGATCTAGCAAGG + Intergenic
1131670623 15:94615923-94615945 ATGGCTACACTGATCTCACAGGG - Intergenic
1132143805 15:99415106-99415128 GTGGCTACTCTGTTCTACCAAGG - Intergenic
1134767912 16:16777869-16777891 CTGGATCTACAGATATACCAAGG - Intergenic
1134839385 16:17389531-17389553 CTGGCTAAACAGATCCACTCCGG - Intronic
1135481069 16:22821039-22821061 CTGGCTACAGAGATGAAGCAGGG - Intronic
1136654271 16:31700617-31700639 CAGGGTACACAGATCAAGCAGGG - Intergenic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1139271325 16:65686125-65686147 CTCTCTAAATAGATCTACCATGG - Intergenic
1142863966 17:2779332-2779354 CTGGCCACACAGAAATACCCCGG - Intronic
1144220756 17:13097721-13097743 CTGGCTAAACTGACTTACCAGGG + Intergenic
1144599203 17:16598145-16598167 CTGGCCAAACTGATCTACCTTGG + Intergenic
1144838760 17:18172735-18172757 TTGGATACACAGAGATACCAGGG - Intronic
1146835929 17:36110647-36110669 CTGCCTAAACAGGTCTACCTTGG + Intergenic
1147511253 17:41070662-41070684 CTGGCTTCACATTGCTACCATGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1153643067 18:7172280-7172302 CTGGAGACACAGGGCTACCAGGG + Intergenic
1156223603 18:35079723-35079745 CTGGATACAGAAATCTAACAGGG - Intronic
1156498564 18:37542358-37542380 CTGGCTGCTCTGATCTTCCATGG + Intronic
1159169722 18:64750172-64750194 TTTGCTACACATTTCTACCAGGG + Intergenic
1160563929 18:79775342-79775364 CTGGCAATTCAGATCTGCCAAGG - Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1165123495 19:33578550-33578572 CTGTCTGCACAGATATTCCAGGG + Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG + Exonic
925679008 2:6397168-6397190 TTGGATACACAGAGATACCAGGG - Intergenic
928687044 2:33760498-33760520 ATGGCTACACCGAACTACAAAGG + Intergenic
939598887 2:144163841-144163863 CAGACTACCCAGGTCTACCATGG + Intronic
941895040 2:170620677-170620699 CTGTGTGCACAGATCTACCCGGG - Intronic
945858876 2:215098095-215098117 CTCTCTACACAGCTCTAACATGG - Intronic
1170204285 20:13781661-13781683 CTGGACACACAGAGCTCCCAGGG - Intronic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1181464545 22:23103834-23103856 CTGGCTACACAGGTCCTCCAGGG - Intronic
1181841418 22:25665590-25665612 CTGGCTAAACAGATATAGAATGG + Intronic
1182071164 22:27464741-27464763 CTGGCCACACTGAGCTACAAGGG + Intergenic
1185175751 22:49325571-49325593 CTGGCTACACTGACCCAACAGGG - Intergenic
1203292563 22_KI270736v1_random:9576-9598 CTGGGTCCACAAATCTAACATGG - Intergenic
949178042 3:1090717-1090739 CAGGCTACACAGAATTACTAAGG - Intergenic
951673865 3:25215211-25215233 CTGGCTACAGAGAACCACCTGGG - Intronic
959929165 3:111959758-111959780 CTTGCTCCTCAGATCTTCCAAGG - Intronic
979357415 4:119721406-119721428 CTAGCTACACACACATACCATGG + Intergenic
981276612 4:142906041-142906063 TTGGTAACACAGATATACCAAGG - Intergenic
981429188 4:144640902-144640924 CTATCTACACAGCTCTACAAGGG + Intergenic
982372068 4:154644752-154644774 CTGGTAACCCAGGTCTACCAGGG + Intronic
984270845 4:177547345-177547367 CTCGCTGCACAGAACTGCCAGGG + Intergenic
984452450 4:179919944-179919966 CTGGTTACTCAGATTTTCCATGG + Intergenic
993953361 5:94202048-94202070 CTGGCTAAACTGATTTAGCAAGG + Intronic
997242205 5:132315655-132315677 CTGGCTTGACTGATCTTCCATGG - Intronic
999050871 5:148522784-148522806 CTGGCTAAACAAACCTAGCAGGG + Intronic
1000299238 5:159940416-159940438 CTGGCTAAACCGAACTAACAGGG - Intronic
1012290083 6:97443630-97443652 CTGGCTCCCCAGATGTAGCATGG + Intergenic
1013362962 6:109411519-109411541 CTGGTTACACAGATATAACCAGG + Intronic
1014573708 6:123044210-123044232 CTGGCTACACAGTTCTTCACTGG - Intronic
1019906929 7:4071879-4071901 CTGTGTACACACATCTACCAAGG - Intronic
1021577091 7:22114772-22114794 CTGACTCCACAGTCCTACCAGGG - Intergenic
1026580064 7:71608335-71608357 CTGGCTCCATCCATCTACCAGGG + Intronic
1027662743 7:81006532-81006554 CTGGCTACACAGGTCCAACTCGG + Intergenic
1031855103 7:126912611-126912633 CTGGCTACAGAGAGCTGCCTTGG - Intronic
1033267936 7:139902172-139902194 GGGGTTACACAGATCTACAAAGG - Intronic
1034564487 7:151902276-151902298 CTGGCTCCACGGATCTATCTTGG - Intergenic
1045113946 8:98961981-98962003 CTAGCTTCACACATCAACCAAGG - Intergenic
1045531728 8:102991395-102991417 CCGGGAACACAGAGCTACCAGGG - Intergenic
1047944125 8:129858020-129858042 CTTTCAACATAGATCTACCATGG - Intronic
1052995382 9:34549306-34549328 CTGGCTCCCCAGAACCACCATGG + Intergenic
1058041521 9:100307344-100307366 ATGGCTACTCAGCACTACCACGG - Intronic
1059306917 9:113360957-113360979 CTGGCTACACTGACTTAGCAGGG - Intronic
1059476798 9:114553858-114553880 CTGGCTAAACAGATGTCCAACGG - Intergenic
1062104881 9:134749913-134749935 CTGGCCACACAGACATACCTAGG - Intronic
1186979072 X:14939702-14939724 TTGGCTACACAGAATTACCTGGG - Intergenic
1187617242 X:21010193-21010215 CTGGCAAAACAGATTCACCAAGG + Intergenic
1193326311 X:80181898-80181920 CTAGTTACACAGATATAACAAGG + Intergenic
1194205803 X:91009688-91009710 ATGACTACAGAGATCTAACATGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1200551561 Y:4584499-4584521 ATGACTACAGAGATCTAACATGG - Intergenic