ID: 1147624835

View in Genome Browser
Species Human (GRCh38)
Location 17:41893255-41893277
Sequence CTGTGGACATGGGGCGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 260}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147624835_1147624844 4 Left 1147624835 17:41893255-41893277 CCCTCCACGCCCCATGTCCACAG 0: 1
1: 0
2: 0
3: 25
4: 260
Right 1147624844 17:41893282-41893304 ATGCCTCATCACAACCGTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 35
1147624835_1147624846 16 Left 1147624835 17:41893255-41893277 CCCTCCACGCCCCATGTCCACAG 0: 1
1: 0
2: 0
3: 25
4: 260
Right 1147624846 17:41893294-41893316 AACCGTAAAGGAATGTCAAGAGG 0: 1
1: 0
2: 0
3: 9
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147624835 Original CRISPR CTGTGGACATGGGGCGTGGA GGG (reversed) Intronic
900146142 1:1159608-1159630 CTGTGGACATGGAGAGTGGCGGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
904340396 1:29830409-29830431 CTGGGGACATGGGGGCAGGATGG - Intergenic
904475905 1:30764385-30764407 CTTTGGCCAAGGGGCTTGGAGGG + Intergenic
907262126 1:53227011-53227033 GTGTGGACATGGGGGGTGGGTGG - Exonic
907392470 1:54167209-54167231 ATGTGGTCATGGGGTGGGGAGGG + Intronic
910001207 1:82344475-82344497 CTGAGGAGGTGGGGCATGGAAGG - Intergenic
911149305 1:94581780-94581802 CTGTGGGAATGGGGCTTTGAAGG + Intergenic
917836812 1:178947533-178947555 CTGTGGACAGGGGGTGGGGGGGG + Intergenic
919614273 1:199785734-199785756 CTGTAGAGATGGGGATTGGAGGG + Intergenic
920113162 1:203601180-203601202 GTGTGGACTTGGGGGATGGATGG - Intergenic
923362653 1:233226800-233226822 GTGTGGGCATGGGGAGAGGAGGG - Intronic
923552780 1:234977511-234977533 CTGAGGACATGGGGTGAAGATGG - Intergenic
1063558667 10:7105746-7105768 CTGTGGGCATGGGGCTGGGCTGG - Intergenic
1063877272 10:10493271-10493293 CTGGGGAGAGGGGGCATGGATGG + Intergenic
1066047226 10:31604188-31604210 CTGTGGACTCGGGGAGGGGAGGG - Intergenic
1066300446 10:34091279-34091301 CTGTGTCCATGGGGCTTAGAAGG - Intergenic
1067287767 10:44920033-44920055 CTGATGACAATGGGCGTGGATGG - Intronic
1071260623 10:83915962-83915984 ATGTGGACTTTGGGCATGGAAGG - Intergenic
1072238461 10:93473315-93473337 CTGTGGCCAAGGGGCATGGAAGG - Intronic
1072750548 10:97975398-97975420 CTGGCTGCATGGGGCGTGGAGGG + Intronic
1074943759 10:118260440-118260462 CTGTGGACAGAGGCCGTGGACGG - Intergenic
1075465524 10:122647730-122647752 GTGTGGAGATGTGGTGTGGATGG - Intergenic
1076366712 10:129926057-129926079 CTGAGGACAGGGGGCGTGACTGG + Intronic
1076981594 11:207674-207696 CTGTGAACGTGGGGCGGGGCGGG + Intronic
1077159215 11:1105059-1105081 CTGGGGCCATGGGGTGGGGAAGG + Intergenic
1081547782 11:44083831-44083853 CTGTGGACCTGGGGCGTTCTGGG + Exonic
1081622018 11:44624265-44624287 GTGTGGAGGTGGGGAGTGGAAGG + Intergenic
1081760888 11:45575783-45575805 CTCTGCACATGGGTGGTGGAGGG - Intergenic
1083335606 11:61920013-61920035 CTCAGGACCTGGGGCATGGAGGG - Intronic
1084125908 11:67098879-67098901 CAGAGGACATGGGGTGTGGAGGG - Intergenic
1084494050 11:69493988-69494010 CTGTGTTCATGGCGTGTGGAGGG + Intergenic
1084689324 11:70715963-70715985 CTGTGGACAGGGCGTCTGGAGGG + Intronic
1089190737 11:116651471-116651493 CTCTAGACATGGGGAGTGGAGGG - Intergenic
1089300622 11:117496644-117496666 CTGTGGTCATGGGGACTGCAGGG + Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1090251648 11:125255872-125255894 CTGTGGGCAAGGGGCTGGGAAGG - Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092138451 12:6166418-6166440 CTGTGGAGAGGGAGCATGGAAGG - Intergenic
1093121113 12:15272864-15272886 CTGGGGACATGGAGTGGGGAAGG - Intronic
1093182651 12:15984336-15984358 CTGTGGACAGGATGGGTGGAGGG - Intronic
1094365435 12:29674809-29674831 CTGTGGGCATGAGGCATGGTGGG - Intronic
1096809939 12:54162802-54162824 CTTTGGCCATGGGGTGGGGAGGG - Intergenic
1097145388 12:56936191-56936213 CTGTGTGCATGGGGTGGGGATGG - Intergenic
1097802966 12:63935070-63935092 CTGTGAACATCGGGAGAGGAGGG + Intronic
1099061752 12:77919473-77919495 CTGTGGACATGGGGCTAGAAAGG + Intronic
1101191049 12:102332930-102332952 CTGGGGACAGGGTGCCTGGAAGG + Intergenic
1101655855 12:106719589-106719611 CTGCGGGCAAGGGGCATGGAAGG + Intronic
1103215273 12:119196928-119196950 GAGAGGACATGGGGCATGGAGGG - Intronic
1103551945 12:121744355-121744377 CTGTGGCCCTGGGCGGTGGAGGG + Intronic
1104055746 12:125228640-125228662 GTGGGGACATGGTGCATGGAGGG + Intronic
1104273990 12:127308250-127308272 CTGTGGACATCAGCAGTGGATGG - Intergenic
1110433037 13:75448042-75448064 CTGTGGACTGGTGGCGGGGATGG - Intronic
1111035299 13:82664466-82664488 CTGTGGATATGTGTAGTGGAAGG + Intergenic
1113787727 13:113011430-113011452 CGGTGGACAGGTGGTGTGGATGG + Intronic
1113787755 13:113011573-113011595 CAGTGGACAGGTGGTGTGGACGG + Intronic
1113787774 13:113011675-113011697 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113787783 13:113011716-113011738 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113787792 13:113011757-113011779 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113787800 13:113011798-113011820 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113787808 13:113011839-113011861 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113787816 13:113011880-113011902 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113787824 13:113011921-113011943 CGGTGGACAGGCGGTGTGGATGG + Intronic
1113787845 13:113012023-113012045 CAGTGGACAGGTGGTGTGGACGG + Intronic
1113787944 13:113012554-113012576 CAGTGGACAGGTGGTGTGGACGG + Intronic
1113787954 13:113012616-113012638 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113787962 13:113012657-113012679 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113787982 13:113012759-113012781 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113787990 13:113012800-113012822 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113787998 13:113012841-113012863 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113788006 13:113012882-113012904 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113788014 13:113012923-113012945 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113788022 13:113012964-113012986 CGGTGGACAGGCGGTGTGGACGG + Intronic
1113921536 13:113915852-113915874 CTGGGGCCATCGGGGGTGGATGG + Intergenic
1114598567 14:23935140-23935162 GTGTGGAGGTGGGGCCTGGAGGG - Intergenic
1116084660 14:40219363-40219385 CAGTGGAAATGTGGCGTGGAAGG + Intergenic
1117874172 14:60234305-60234327 CTCTGGAGATGGGGCTTTGAAGG + Intergenic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1122606215 14:102948623-102948645 CTGTGGAGAGGGGGAGTGGGGGG + Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122697514 14:103563137-103563159 CTGGGGACATTGGGCCGGGAGGG + Intronic
1122840754 14:104461588-104461610 CAGGGGACAAGGGGGGTGGACGG + Intergenic
1123662236 15:22574480-22574502 CGGTGGACATGGCGCAGGGATGG + Intergenic
1123685525 15:22794593-22794615 CTGTGGAGATGTGGAGGGGAAGG + Intronic
1124261982 15:28201027-28201049 CGGTGGACATGGCGCAGGGATGG - Intronic
1124440832 15:29685330-29685352 CTGTGGACAAGGGCGGTGAATGG + Intergenic
1126470874 15:49009379-49009401 CTGTGGAGATGTGGAGTGAAGGG + Intronic
1127034031 15:54895353-54895375 CTGTGGACCTGGGGCAGTGAAGG - Intergenic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1130069584 15:80635246-80635268 CTGTTGATATGGGTGGTGGATGG + Intergenic
1132594809 16:743880-743902 CTGGGGACATAGGGCGAGGCCGG + Intronic
1132615878 16:840872-840894 TGGTGGACACTGGGCGTGGAGGG + Intergenic
1132623569 16:879533-879555 CTGTGGACACGGGGCAGGGCGGG + Intronic
1132662079 16:1066071-1066093 CTGTTGGCCTGGGGCGGGGAAGG + Intergenic
1132970798 16:2687745-2687767 CTGCTTACCTGGGGCGTGGAGGG - Intronic
1132989600 16:2785993-2786015 CTGAGGACCTGGGGCCTGGGAGG + Intronic
1134089610 16:11384552-11384574 CTGAGGACATGGGGAGGGGACGG - Intronic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1134750881 16:16624081-16624103 ATGTGGACATCGGGATTGGATGG + Intergenic
1134994573 16:18729510-18729532 ATGTGGACATCGGGATTGGATGG - Intergenic
1136934231 16:34443953-34443975 GTGTGGACATGGGGCTGGGGTGG + Intergenic
1136970341 16:34967861-34967883 GTGTGGACATGGGGCTGGGGTGG - Intergenic
1138270510 16:55692523-55692545 CTCTGGACAGGGGGAGTGGTTGG - Intronic
1139670138 16:68487277-68487299 CTGGGGACATGGAGAGTGGGTGG - Intergenic
1139777276 16:69324361-69324383 CTGTTGACATGGGGAGTGCCTGG - Exonic
1139955618 16:70691661-70691683 CTGGGGAAATGGGGCAGGGAAGG + Intronic
1141063605 16:80896893-80896915 CTGGGGACAAGGGGTGTGGCAGG - Intergenic
1141677718 16:85526297-85526319 CTGTAGTGATGGGGCGTGCAAGG + Intergenic
1141787451 16:86211305-86211327 CTCAGGACATGGGGCCTGCACGG + Intergenic
1142032889 16:87847207-87847229 CTGTGGCTCTGGGGTGTGGAGGG - Intronic
1142290863 16:89193087-89193109 CAGTGGAGAAGGGGCGTGGCTGG - Intronic
1142298613 16:89243169-89243191 GTGTTGACCTGGGGCGTTGAGGG + Intergenic
1143481121 17:7227888-7227910 CTGTGGTCATGGGGAATGGGTGG - Intronic
1143884409 17:10055241-10055263 CTGGGAACATGGGGCATGGTGGG + Intronic
1144702511 17:17348539-17348561 CTGGGGTTATGGGGCCTGGAGGG - Intergenic
1144834842 17:18151372-18151394 CTGTGGGCAAGGGGCGCGGTGGG - Intronic
1147428190 17:40356227-40356249 CTGTGTCCATGTGGCGTGGGCGG - Exonic
1147624835 17:41893255-41893277 CTGTGGACATGGGGCGTGGAGGG - Intronic
1147669863 17:42170744-42170766 TTCTGGACATGGTGCCTGGAAGG + Intronic
1148536344 17:48442190-48442212 TTGTGGCCATGGGGTGTGGTGGG + Intergenic
1148744060 17:49908657-49908679 CTGTGGGAATGGGGAGTGGGCGG + Intergenic
1151929943 17:77225974-77225996 CAGTGGACATGAGGGCTGGAGGG - Intergenic
1152248513 17:79199152-79199174 CTGTGGTCATAGGGTGGGGATGG + Intronic
1152585592 17:81188168-81188190 TTGTGGACCTGGGGCGTGGCGGG - Intergenic
1152966697 18:122644-122666 CTGCCCACATGGGGCTTGGAGGG + Intergenic
1155380009 18:25210373-25210395 CTGTGGGCATGGGGAGTTTAAGG - Intronic
1158427612 18:57353395-57353417 CTGCGGACAGGGCGCGGGGAGGG - Intronic
1158645366 18:59241154-59241176 CTGTGGTCCTGGGGCGTGTGGGG - Intergenic
1159653021 18:70999940-70999962 GTGTGAACAGGGGGTGTGGATGG + Intergenic
1160953190 19:1677285-1677307 CTGAGGATCTGGGGGGTGGAGGG + Intergenic
1160975548 19:1790589-1790611 GTGTGGTAATGGGGAGTGGAGGG - Intronic
1161237059 19:3203578-3203600 CTGTGGACACTGGGGCTGGATGG - Intronic
1161480285 19:4506954-4506976 CTGTGGACACGGGGGCTAGATGG + Intronic
1162461413 19:10816242-10816264 CTGAGGACATTGGGGGTGAAAGG + Intronic
1162552154 19:11363964-11363986 CTGTGGACATAGGTCCTGGGCGG + Intronic
1162917618 19:13882752-13882774 CTGCGGACATGGGGGCTGGGTGG + Exonic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1165395448 19:35561273-35561295 CAGTGGACATGGGGAATGCAAGG - Intronic
1165745957 19:38229523-38229545 GTCTGGACAGGGGGCGGGGACGG + Intronic
1165799120 19:38536846-38536868 CTGAGGATCTGGGACGTGGAGGG + Intronic
1167452420 19:49579917-49579939 CTGTGAACTTGGGGCTTGAACGG - Intronic
925154495 2:1639200-1639222 CTGTGGGCCTGTGGCGAGGATGG - Intronic
926730843 2:16034375-16034397 GTGTGGTCCTGGGGGGTGGAGGG + Intergenic
927256248 2:21043483-21043505 ATCTGCGCATGGGGCGTGGAAGG - Intronic
927494065 2:23540799-23540821 CTCTGGTCATGGGGAGGGGACGG - Intronic
927857411 2:26536121-26536143 CTGAGGAAATGGGGAGGGGAGGG + Intronic
928029797 2:27768550-27768572 CTGGGAACATGGGCAGTGGAAGG - Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
936233927 2:110726716-110726738 TTGTGGAGATGGGGGGTGGGGGG + Intergenic
936403232 2:112181915-112181937 GGGAGGACATGGGGCGGGGAAGG + Intronic
937122817 2:119452446-119452468 CTGGGGACATCAGGCCTGGAGGG + Intronic
937530073 2:122817543-122817565 CTGAGGACAGGGGGCGAGGCAGG + Intergenic
941269580 2:163408631-163408653 CTGAGAACATGGGGTTTGGAGGG + Intergenic
945396560 2:209325337-209325359 GTGTGGAAATGGGGAGAGGAGGG - Intergenic
946311673 2:218885422-218885444 CTGTGGACATGAGGACAGGAGGG + Intronic
1169146397 20:3255285-3255307 CTGCAGAGATGGGGAGTGGAGGG + Intronic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169244380 20:4014830-4014852 CTGTGGGCAGGGGGCGTGTGTGG - Intronic
1170007324 20:11683693-11683715 CTCTGGAAATGGGACCTGGAGGG - Intergenic
1170906920 20:20524462-20524484 CTGTGGACACGGGGTGGAGAAGG + Exonic
1171373779 20:24678150-24678172 GTGTGGTCATGGGCCGTGCATGG - Intergenic
1174061200 20:47834195-47834217 CTGTGGACCTGGGGTGGGGCCGG - Intergenic
1174070576 20:47896504-47896526 CTGTGGACCTGGGGTGGGGCCGG + Intergenic
1175391660 20:58631453-58631475 CTGGGGACAAGGGGAGTGGAGGG - Intergenic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1176161140 20:63649449-63649471 CTGTGGAGAGGTGGCCTGGATGG - Intronic
1180558336 22:16595479-16595501 CTGTGGCCATGGTGGGTGCAGGG + Intergenic
1180818495 22:18808481-18808503 CTGAGGACAAGGGTCCTGGAGGG + Intergenic
1180910563 22:19447294-19447316 CGCGGGGCATGGGGCGTGGAGGG + Intronic
1181204718 22:21242936-21242958 CTGAGGACAAGGGTCCTGGAGGG + Intergenic
1181627380 22:24131031-24131053 CTGTGGCCATGGGACGGGAATGG - Intronic
1181629714 22:24144253-24144275 CTGTGGACATGTGATGGGGAGGG + Intronic
1182422859 22:30257020-30257042 CTCTGGACATGGTGGCTGGAAGG - Intergenic
1182798136 22:33006394-33006416 CTTTGAACAATGGGCGTGGAGGG + Exonic
1182939551 22:34262256-34262278 CTGTGGGCATAGGGAGTGGAGGG + Intergenic
1183094133 22:35542086-35542108 CTGGGGACAAGGGGAGGGGAGGG - Intronic
1184251184 22:43261240-43261262 GTGTGGAGACGGGGCCTGGATGG + Intronic
1184438453 22:44494694-44494716 GTGTGGACAGGGAGCGTGGCCGG + Exonic
1184757445 22:46524991-46525013 CTGTGGACCTGGGGCCTGGTAGG - Intronic
1185332818 22:50259268-50259290 CTGTGGACATGAGAGCTGGAGGG + Intronic
1185338115 22:50279808-50279830 CAGGGGACTTGGGGCCTGGAAGG + Intronic
1203222207 22_KI270731v1_random:52479-52501 CTGAGGACAAGGGTCCTGGAGGG - Intergenic
1203268624 22_KI270734v1_random:34335-34357 CTGAGGACAAGGGTCCTGGAGGG + Intergenic
950256446 3:11510523-11510545 CTTTGGAGATGGGGGGTTGAGGG - Intronic
950365136 3:12477781-12477803 CTGTGGCAATGTGGCGTGGTAGG - Intergenic
952822336 3:37496023-37496045 CATGGGACATGGGGGGTGGAGGG + Intronic
953152069 3:40333787-40333809 CTGTGTAGTTGGGGCGGGGAGGG - Intergenic
954316543 3:49804570-49804592 GGGTGGACTTGGGCCGTGGATGG - Exonic
955047404 3:55373038-55373060 CTGTGGAAAGGGGGCATTGAAGG - Intergenic
956339295 3:68203953-68203975 ATGTGGTCATGGGGGGTGGGGGG - Intronic
956339359 3:68204418-68204440 CTGTGGACAAAGGGGTTGGAAGG - Intronic
956808140 3:72837238-72837260 CTCTGGGTATGGGGAGTGGAGGG + Intronic
962053238 3:131841626-131841648 CCATGGACATGGGGTGGGGAAGG - Intronic
962238723 3:133732077-133732099 CTGTGCACATGGGACTTAGAAGG + Intergenic
964706536 3:159624627-159624649 CCGTGGAGATTGGGGGTGGAAGG + Intronic
964758824 3:160114508-160114530 CAGTGGACCTGGGGTGTGGAAGG + Intergenic
967136790 3:186519471-186519493 CAGTGGCCATGGGTGGTGGATGG - Intergenic
967934294 3:194714526-194714548 ATGGTGACATGGGGCGTGGAGGG + Intergenic
968524916 4:1051696-1051718 CTGTGGACGTGGTGCTTGGATGG + Intergenic
968578537 4:1379058-1379080 CTGTGGACCTGGGGTGAGGGCGG + Intronic
968595281 4:1479132-1479154 CTGTGGACAAGAGCCCTGGAAGG - Intergenic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
969898634 4:10328133-10328155 CTGTGACCATGAGGGGTGGAAGG - Intergenic
970219678 4:13797840-13797862 CTATGGACATGGGGGATGGAGGG + Intergenic
971756660 4:30717177-30717199 CTGCGGAAATGGGGCGGGGGTGG + Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
979765450 4:124460142-124460164 TTGTAAACATGTGGCGTGGAAGG + Intergenic
982073132 4:151713319-151713341 CTGTGGACTTGGGGGGCCGAAGG - Intronic
982899650 4:160981838-160981860 CTGTGGGCATTGGGGGTGGAGGG + Intergenic
985544110 5:500642-500664 GTGTGGACATGGGGCTAGTATGG + Intronic
985725157 5:1512247-1512269 GATTGGACATGGGGCATGGAGGG - Intronic
986353740 5:6904108-6904130 CTGGGGACATGGGGTCTGGATGG + Intergenic
986516780 5:8572937-8572959 ATGTGGAGATGGGGCTTGCAGGG - Intergenic
986739248 5:10691679-10691701 CTGAGGATATGGGGCGGGCAGGG - Intronic
988702570 5:33689898-33689920 CTGGGGTCATGGGGTGTGGTGGG + Intronic
997263048 5:132478288-132478310 CTGTGAACAAGGGCCGTGGTGGG + Intergenic
997574455 5:134963303-134963325 CTGTGGACATGTGGTGTGCAGGG + Intronic
998368346 5:141645263-141645285 TTGTGTACATGGTGAGTGGATGG - Intronic
999322252 5:150622779-150622801 CTGTGGAGCAGGGGAGTGGAGGG - Intronic
999779980 5:154841394-154841416 CTGTGGACTTGGGGGTTAGAGGG + Intronic
1001603849 5:172946311-172946333 CTGTGGGGATGGGGCCTGGGAGG - Intronic
1001910985 5:175517590-175517612 CTGTGAACTTGGGGAGTGGTAGG - Intronic
1002449355 5:179310146-179310168 GTGGGGACATGGGACGTGCAGGG - Intronic
1003213324 6:4087481-4087503 CTGAGAACATGAGGAGTGGATGG - Exonic
1004541389 6:16553729-16553751 CTGTGGCCATGGGCTGTTGAGGG - Intronic
1004792065 6:19037503-19037525 ATTTGGAGATGGGGCGTGTAAGG - Intergenic
1005891079 6:30138950-30138972 CTGTGGACATTGCACCTGGAGGG - Intronic
1007075672 6:39064707-39064729 AGGTGGACATGGGGCATGGTGGG + Intronic
1007790575 6:44306082-44306104 CTGTGGACATGGGGAGAGGCAGG + Intronic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1008342758 6:50387682-50387704 CTGTAGACATGGTGAGAGGAGGG - Intergenic
1010814658 6:80343114-80343136 CTGTGGACTTGGGGTGTGAGTGG + Intronic
1012578818 6:100837723-100837745 CTGGGGAGATTGGGGGTGGAGGG + Intronic
1016618462 6:146079954-146079976 CAGTGAAAATGGGGCTTGGAAGG + Intronic
1016886948 6:148967692-148967714 CTGTGGGCATGCGGTGTGCAGGG - Intronic
1021593658 7:22292081-22292103 CTGTGGACAGGGGGCGGAGGGGG + Intronic
1022469571 7:30674067-30674089 CTGTGGAAATAGGGAGTTGAGGG - Intronic
1022656960 7:32328503-32328525 CAGTGAACATGGAGCGTGGTTGG - Intergenic
1024949062 7:54839622-54839644 CTGGGGACACAGGGCGTGGGTGG - Intergenic
1025099594 7:56123686-56123708 CTGAGGAGATGGGGCATGCAGGG + Intergenic
1028874310 7:95803267-95803289 TTGTGGACATGCAGTGTGGATGG - Intronic
1034213772 7:149387370-149387392 CTGTGGAGGTGGGGCGTGGCAGG - Intergenic
1034618980 7:152442530-152442552 CTGTGGCCATGGTGGGTGCAGGG - Intergenic
1035248569 7:157581379-157581401 CTGTGGGCCTGGGGTGGGGAGGG + Intronic
1035690720 8:1557732-1557754 ATGAGGACATGGGGAGAGGACGG - Intronic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1040934765 8:52770999-52771021 ATGTTGAAATGGGGCGTGGTGGG + Intergenic
1045552585 8:103185851-103185873 CTGTGGCCATGGGCCTTGTAGGG + Intronic
1047213978 8:122862305-122862327 CTGTGGACCTGGTGAGTGGTCGG - Intronic
1049159597 8:141088900-141088922 CTGGGTACATGTGGGGTGGATGG + Intergenic
1049247751 8:141571794-141571816 CATGGGGCATGGGGCGTGGAGGG - Intergenic
1049320365 8:141993009-141993031 CTGTGCATATGTGGGGTGGAAGG - Intergenic
1050162831 9:2735767-2735789 CTGTGGACATAGGGAGTGGGTGG - Intronic
1053074876 9:35124327-35124349 CTGAGGACATTGGGAGTGTAAGG + Intergenic
1053280403 9:36816734-36816756 CTGGGGACATGGGATGTGCAGGG + Intergenic
1053365989 9:37522925-37522947 GTGTGGACATCCGCCGTGGAGGG - Exonic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1059448957 9:114358019-114358041 CTGCGGACTTGGTGCCTGGAGGG + Exonic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1061076512 9:128344707-128344729 CTGTGGTCATGGTGGGTCGAGGG + Intronic
1061284281 9:129613367-129613389 CTGTAGGCAAGGGGGGTGGAGGG + Intronic
1061489585 9:130937833-130937855 CAGTGGAGGTGGGGCTTGGAGGG - Intronic
1061682562 9:132250185-132250207 CTGGGGAGGTGGGGCGTGAATGG + Intergenic
1061746742 9:132745709-132745731 CTGGGGACATTGGGCTTCGAGGG - Intronic
1061841758 9:133362614-133362636 CTGTGGGCAGGGGGTGTGGCAGG - Exonic
1062210351 9:135360270-135360292 CTGAGGCCGTGGGGTGTGGATGG - Intergenic
1062365691 9:136207969-136207991 CTGTGGACCTGGGGGTTGGAAGG - Exonic
1062417220 9:136457739-136457761 CTGTGGTCAGCGGGCGTGGTGGG - Intronic
1062467508 9:136687647-136687669 CTGTGGGGAGGGAGCGTGGAGGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188721642 X:33529457-33529479 CTGTAGCCGTGTGGCGTGGAGGG - Intergenic
1189866058 X:45328488-45328510 GGGTGGAGATGGGGCATGGAAGG - Intergenic
1192142786 X:68659741-68659763 CTGTGGACATGAGGACTGTAGGG + Intronic
1195423283 X:104699162-104699184 CTGTGGACTTGGTGGGGGGATGG + Intronic
1195790750 X:108582455-108582477 CTCTGGATATGGGGCTTTGAAGG + Intronic
1198960984 X:142182956-142182978 TTGTGGACATAGAGTGTGGAAGG + Intergenic
1200039668 X:153355991-153356013 CTGGGGAGTTGGGGAGTGGAGGG - Intronic
1200135521 X:153872795-153872817 CTGTGGCCATGGGGCCTCCAGGG - Intronic
1201774527 Y:17648687-17648709 CTGGAGACATGGGACGTGGTTGG - Intergenic
1201827029 Y:18257302-18257324 CTGGAGACATGGGACGTGGTTGG + Intergenic