ID: 1147625744

View in Genome Browser
Species Human (GRCh38)
Location 17:41898711-41898733
Sequence GGCCATTGTGGGCATGGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 251}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147625744_1147625752 13 Left 1147625744 17:41898711-41898733 CCAGGGCCATGCCCACAATGGCC 0: 1
1: 0
2: 4
3: 31
4: 251
Right 1147625752 17:41898747-41898769 CTGTGCCAAAGACATGGATGGGG 0: 1
1: 0
2: 0
3: 9
4: 230
1147625744_1147625751 12 Left 1147625744 17:41898711-41898733 CCAGGGCCATGCCCACAATGGCC 0: 1
1: 0
2: 4
3: 31
4: 251
Right 1147625751 17:41898746-41898768 TCTGTGCCAAAGACATGGATGGG 0: 1
1: 0
2: 1
3: 14
4: 175
1147625744_1147625754 23 Left 1147625744 17:41898711-41898733 CCAGGGCCATGCCCACAATGGCC 0: 1
1: 0
2: 4
3: 31
4: 251
Right 1147625754 17:41898757-41898779 GACATGGATGGGGATCCCAGTGG 0: 1
1: 0
2: 0
3: 23
4: 239
1147625744_1147625750 11 Left 1147625744 17:41898711-41898733 CCAGGGCCATGCCCACAATGGCC 0: 1
1: 0
2: 4
3: 31
4: 251
Right 1147625750 17:41898745-41898767 CTCTGTGCCAAAGACATGGATGG 0: 1
1: 0
2: 2
3: 27
4: 227
1147625744_1147625749 7 Left 1147625744 17:41898711-41898733 CCAGGGCCATGCCCACAATGGCC 0: 1
1: 0
2: 4
3: 31
4: 251
Right 1147625749 17:41898741-41898763 GAGTCTCTGTGCCAAAGACATGG 0: 1
1: 0
2: 0
3: 19
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147625744 Original CRISPR GGCCATTGTGGGCATGGCCC TGG (reversed) Exonic
900697439 1:4021071-4021093 GGCCACTGTAGACATGGCCGGGG + Intergenic
901066236 1:6496034-6496056 GGCGAGTGTGACCATGGCCCTGG - Intronic
902332756 1:15738576-15738598 AGCCACTGTGGGGATGGCACAGG - Exonic
903549511 1:24148153-24148175 GGACATTGAGTACATGGCCCAGG + Intergenic
903774510 1:25783974-25783996 GGCCAGTGTGGCCATGGCCCTGG - Exonic
904962782 1:34347835-34347857 GCCCATGGTGGGCAAGGCCATGG + Intergenic
906109064 1:43311536-43311558 GACCATAGTGGCCAGGGCCCAGG - Intronic
906199352 1:43949097-43949119 GGCACTTGAGGGCAAGGCCCAGG - Intronic
912410528 1:109477969-109477991 GCCCATAGAGGGCGTGGCCCCGG - Exonic
918142724 1:181732579-181732601 GGCCATTGAGGGCCTGGCCCTGG + Exonic
921067374 1:211632468-211632490 GGCCTTTCTGAGCAAGGCCCCGG - Intergenic
921179931 1:212624369-212624391 GGGCATTGTGGCCCTGGCCTGGG + Intergenic
922573460 1:226646961-226646983 GGCCATCATGGGCAAAGCCCAGG + Intronic
1062884260 10:1004583-1004605 GACCATTCTGGGCATTTCCCAGG + Intronic
1063362561 10:5469944-5469966 CTCCCTTGTGGGCATGGTCCGGG - Intergenic
1067378542 10:45751314-45751336 GCCCACTGTGGGCAGGGCCAGGG + Intronic
1067448431 10:46367075-46367097 GGCCGTGGTGGGCCTGGCTCTGG + Intergenic
1067588944 10:47493691-47493713 GGCCATGGTGGGCCTGGCTCTGG - Intergenic
1067636070 10:48001782-48001804 GGCCGTGGTGGGCCTGGCTCTGG - Intergenic
1067886237 10:50091994-50092016 GCCCACTGTGGGCAGGGCCAGGG + Intronic
1069868504 10:71518928-71518950 GCCCATTGGGGGCGTGGCCAAGG + Intronic
1070576242 10:77681211-77681233 GCCTGTTGTGTGCATGGCCCCGG + Intergenic
1071425245 10:85542976-85542998 TGCCATTGTGAGCAGAGCCCAGG + Intergenic
1074457116 10:113604719-113604741 GGGCATTCTTGGCATGGACCAGG + Exonic
1075811449 10:125227604-125227626 GACCTTTGTGGGCTTGGCCAAGG + Intergenic
1076166677 10:128287704-128287726 GGGCACTGGGGGCTTGGCCCAGG - Intergenic
1076501694 10:130942197-130942219 CGGCATTGTGGGCAAGACCCTGG - Intergenic
1076909505 10:133379911-133379933 GGCCAGCGTGGGCGTGGCCCAGG + Intronic
1077234238 11:1472246-1472268 GGCCGCTGTGGGCATGGCCTTGG - Intronic
1077305999 11:1868929-1868951 GGCCAGAGGGAGCATGGCCCCGG + Intronic
1077431427 11:2517704-2517726 GGCCAGTGGGACCATGGCCCTGG + Intronic
1077516727 11:3006717-3006739 GGCCAGCGTGGGAATGGCGCCGG + Intronic
1079645520 11:22860294-22860316 GGCCACTGTGGCCTTGGCCATGG - Intronic
1079689444 11:23403640-23403662 GGCAATGGTGGCCATGGACCTGG + Intergenic
1080909729 11:36583468-36583490 GGGCAATGTGGGCTTGGCACAGG + Intronic
1082001354 11:47395162-47395184 GGCCAAAGTAGGCCTGGCCCTGG - Intergenic
1083222813 11:61264628-61264650 GGCCCTTGAGGGCACTGCCCAGG - Intronic
1083275606 11:61595417-61595439 GGCCAGTGTGGTCCTGGCCTTGG - Intergenic
1083886900 11:65577355-65577377 GCCCAGTGTGGGCAAGGCCAAGG - Intronic
1084195393 11:67521650-67521672 GCCCACTGTGTGCCTGGCCCTGG - Intronic
1084380027 11:68805865-68805887 GCCCATTGTAGTCATGGCCCTGG - Intronic
1084963160 11:72727749-72727771 GGCCTCTGGGGGCCTGGCCCTGG + Intronic
1084971092 11:72772404-72772426 TGTCATAGTGGGCATGGCTCTGG + Intronic
1086244963 11:84740928-84740950 CACCACTGTGGGCATGGCCCTGG + Intronic
1089098335 11:115938374-115938396 GGCCATGGTGGTCAGGGCACTGG + Intergenic
1090023561 11:123148763-123148785 GTCAATTGCGTGCATGGCCCAGG + Intronic
1090208159 11:124897025-124897047 GGCCATCGTGGGCATGTCCCCGG + Exonic
1091290608 11:134437407-134437429 GGTCAGTGTGGCCATGGCCCTGG - Intergenic
1094525660 12:31229158-31229180 GGTTGTTTTGGGCATGGCCCAGG - Intergenic
1094851120 12:34382829-34382851 GGCCCTCGTGGGCATGAACCAGG + Intergenic
1098485261 12:71013910-71013932 GGCCATTTTGGTCATGGCCAAGG - Intergenic
1103701072 12:122849006-122849028 TGCCTTTGAGGGCCTGGCCCAGG + Intronic
1103774449 12:123356059-123356081 TGCTATTGTGGACATGTCCCTGG - Intronic
1104955833 12:132465432-132465454 GGCCGTTCTGGGGATGGGCCAGG + Intergenic
1106178563 13:27351668-27351690 GTCCAGTGGGGGCATGGCCTGGG + Intergenic
1107711837 13:43158245-43158267 CTCCATGGTGGCCATGGCCCAGG + Intergenic
1110666050 13:78118556-78118578 GGCCATTCGGGGCATGGGCCTGG + Intergenic
1111050632 13:82879470-82879492 GGCCAGTTTGGGTATGACCCAGG + Intergenic
1113784881 13:112997206-112997228 GACCACTGTGGGTCTGGCCCAGG + Intronic
1114398144 14:22385258-22385280 GTCCATAGTAGGCATTGCCCAGG - Intergenic
1118823749 14:69362190-69362212 GGCCATGCTGGACATAGCCCTGG - Intergenic
1119400389 14:74358628-74358650 GCCCACTGTGGGGCTGGCCCTGG - Exonic
1121694665 14:95903112-95903134 GGCCATTTAGAGCATGGCCTTGG + Intergenic
1122114059 14:99518865-99518887 TGCCAGCGAGGGCATGGCCCGGG + Intronic
1122124159 14:99570289-99570311 GGCCACTGTGAGCCAGGCCCTGG + Intronic
1122284407 14:100642222-100642244 GGGCATTGAGGTCATGGGCCTGG + Intergenic
1122904623 14:104795959-104795981 GGCCAGAGAGGGCGTGGCCCCGG - Intergenic
1202835709 14_GL000009v2_random:76243-76265 GGTCATTGTGGGCCTGGCAGCGG + Intergenic
1123888170 15:24748654-24748676 GGCCACTGTGGGGAGGGCACAGG + Intergenic
1123921090 15:25070339-25070361 GGCCATTAAGGGCATGGCTGTGG + Intergenic
1124155977 15:27225654-27225676 GGCTATTGAGGGCATGGCCCAGG + Intronic
1124638864 15:31382608-31382630 GGCCAGTGTGGGCCTGCACCTGG + Intronic
1125541288 15:40471285-40471307 GGCCCCTCTGGGCAGGGCCCGGG + Exonic
1126268075 15:46778471-46778493 GGCCTTTCTGTGCATGTCCCTGG + Intergenic
1127044234 15:55009266-55009288 GGTCATTGTGGATATGGCCATGG - Intergenic
1129312529 15:74722674-74722696 GGCCATTCTGGGCCAGGCGCCGG + Exonic
1129689714 15:77706274-77706296 GGCCGTGGTGGGCCTGGCCCAGG - Intronic
1129771591 15:78206495-78206517 GGCCAAGGTGGGCGTGCCCCAGG - Intronic
1130064988 15:80595778-80595800 GCCCATTCTGGGGCTGGCCCTGG - Exonic
1131467510 15:92667606-92667628 GGTCAGTTTGGGGATGGCCCCGG + Intronic
1132626080 16:892311-892333 GGCCCGTGTGGTCATGGCCACGG - Intronic
1132944839 16:2527203-2527225 GCTCAGTGTGGGCATGGCCAGGG - Intronic
1133270073 16:4606888-4606910 GGCCACTGTGGGCTGGGCCTGGG - Intergenic
1134450248 16:14358896-14358918 GCCCATTTTGGGCAGGGCCCTGG + Intergenic
1135327290 16:21534805-21534827 GCACACTGTGGTCATGGCCCAGG - Intergenic
1136337639 16:29620828-29620850 GCACACTGTGGTCATGGCCCAGG - Intergenic
1137036053 16:35570917-35570939 GCCCACTGTAGGCAAGGCCCAGG + Intergenic
1137262419 16:46842645-46842667 GGCCATAGGTGGCCTGGCCCTGG + Intergenic
1137404510 16:48179088-48179110 AGCCTTTGAGGGCATGGTCCTGG + Intronic
1137604565 16:49778893-49778915 GGCCATTGTGAGGATGGCACGGG - Intronic
1139432414 16:66918235-66918257 GGCCTTGGTGGGCCTGGCCGAGG - Intronic
1139960846 16:70716469-70716491 GGCCCATGTTGGCCTGGCCCAGG + Intronic
1140069224 16:71634704-71634726 GGGCATTGTGGTCTTTGCCCTGG + Intronic
1140653840 16:77118965-77118987 GACCACTGTTGTCATGGCCCAGG + Intergenic
1141089759 16:81122048-81122070 AGCCATTTTGGGCCGGGCCCAGG + Intergenic
1141734304 16:85841968-85841990 GGCCATGTTGGGCATGGGCGAGG + Intergenic
1142010695 16:87712342-87712364 GCCCAGTGTGGGCGTGGCTCTGG + Intronic
1145016883 17:19404860-19404882 TGGCACTGTGGGCATTGCCCTGG - Intergenic
1145732263 17:27199736-27199758 GGCTATTCTGGGCAAAGCCCTGG + Intergenic
1146214856 17:30971070-30971092 GGCCATGGCGGGCCTGGGCCTGG + Exonic
1146407917 17:32555712-32555734 GGCTATTGTGGGCAAGGGTCTGG - Intronic
1146661551 17:34668166-34668188 GGCCTTGGTGGGAATGGTCCAGG + Intergenic
1147578155 17:41614238-41614260 GCCCATGGTGGGCATGGCCTTGG + Intronic
1147625744 17:41898711-41898733 GGCCATTGTGGGCATGGCCCTGG - Exonic
1148755167 17:49969452-49969474 GGTCATTGTGGCCAGGGCCCGGG - Exonic
1149492888 17:57097829-57097851 GCCCAATGTGGGCTTGGGCCTGG - Intronic
1149610088 17:57953694-57953716 GGCCCTAGTTGGCCTGGCCCAGG + Intronic
1151818112 17:76481519-76481541 GGCCATTGTGGGCAGGAGGCGGG + Exonic
1152855508 17:82663099-82663121 GCCCAGCGAGGGCATGGCCCCGG + Intronic
1203163827 17_GL000205v2_random:75927-75949 GGCCATTGTGGCCTGGGCACCGG + Intergenic
1160571130 18:79818342-79818364 GGCCAAGGTGGGCATGGGCCGGG - Intergenic
1160903766 19:1442272-1442294 GGCCACTGAGGGCCTGGACCTGG + Intergenic
1161054163 19:2181577-2181599 GGCCAGGGTGGGCCTGACCCAGG + Intronic
1161156244 19:2733131-2733153 GGTCTTTGAGGGCCTGGCCCTGG - Exonic
1161314667 19:3612351-3612373 GGCCAAGGAGGGCATGGGCCAGG - Exonic
1161489913 19:4556184-4556206 GTCTGTTGTGGGCATGGCCAAGG + Intronic
1161801844 19:6420645-6420667 GGGCATTGTGGGCCTTGGCCTGG + Intronic
1162573691 19:11486724-11486746 GGGCCTTGTGGGCCTGGCCCAGG + Intronic
1162612513 19:11767389-11767411 GGCCACTGCGGCCCTGGCCCTGG + Intronic
1163134452 19:15299513-15299535 GGCCATGGCGGGGATGTCCCAGG - Intronic
1163712539 19:18855256-18855278 GGCCCTTGCGGGCAAGACCCGGG + Intronic
1163987922 19:20970509-20970531 GCCCTGTGTGGGCAGGGCCCAGG - Intergenic
1164052362 19:21594242-21594264 GCCCAGTGTGGGCAGGGTCCAGG - Intergenic
1164052720 19:21596860-21596882 CCCTTTTGTGGGCATGGCCCAGG - Intergenic
1164099945 19:22045750-22045772 GGCCCATGTGGGCAAGGCACAGG + Intergenic
1164126954 19:22327192-22327214 GGCCCATGTGGGCAGGGCACAGG - Intergenic
1164129236 19:22346776-22346798 GCCCCCTGTGGGCAAGGCCCAGG - Intergenic
1164181078 19:22819349-22819371 CCCTTTTGTGGGCATGGCCCAGG - Intergenic
1164181637 19:22824193-22824215 GCCCACTGTGGGCAAGGCCCAGG - Intergenic
1164242824 19:23405056-23405078 GGTCACTGTGGGCACAGCCCAGG + Intergenic
1164249174 19:23461951-23461973 GCCCCCTGTGGGCAGGGCCCAGG - Intergenic
1164314226 19:24072554-24072576 GCCTCTTGTGGGCAGGGCCCAGG - Intronic
1165167740 19:33869015-33869037 GAGCAGTGTGGGCAGGGCCCAGG + Intergenic
1165806716 19:38584814-38584836 GCCCTTTGAGGGCAGGGCCCAGG + Intronic
1166571550 19:43799865-43799887 GGCCAGTGTGAGCCTGTCCCAGG + Intronic
1167386332 19:49166224-49166246 GGCCTCTGTGGGCGGGGCCCGGG + Intronic
1167881799 19:52465308-52465330 GGCCATTCTGGGCATTCCTCTGG + Intronic
1168043008 19:53773931-53773953 AGCCAATGTGTGCACGGCCCAGG + Intergenic
1202636931 1_KI270706v1_random:51120-51142 GGTCATTGTGGGCCTGGCAGCGG - Intergenic
926120674 2:10239756-10239778 GGCCATTGCCTGCATGCCCCCGG - Intergenic
927511816 2:23648684-23648706 GGCCATGGAGGACCTGGCCCCGG - Intronic
930156500 2:48112123-48112145 GGCCAGTCTGGCCAGGGCCCAGG - Intergenic
930507707 2:52305208-52305230 TGGTTTTGTGGGCATGGCCCAGG + Intergenic
931460144 2:62443335-62443357 GGCCATTGTCAGCATCACCCTGG - Intergenic
931670147 2:64640408-64640430 GGCCTTTCTGGGCCTGGCTCAGG + Intronic
932489716 2:72113047-72113069 GCCTATTTTGGGCATGGGCCTGG + Intergenic
934752503 2:96802503-96802525 GGCCATGAGGGGCATGGCCCCGG + Intronic
938365069 2:130727766-130727788 GGCTGTGGTGGGCGTGGCCCCGG + Intergenic
938795338 2:134714114-134714136 GGCAGTTGTGGGCATTGCCTGGG - Intronic
939078752 2:137634549-137634571 GGCCAATTTGGATATGGCCCAGG - Intronic
944452789 2:199859899-199859921 GGCCACTCTGGGAAGGGCCCTGG - Intergenic
947909025 2:233789679-233789701 GGCCACGGGGGGCCTGGCCCAGG + Intronic
948882895 2:240869373-240869395 GGCCCAGGTGGGGATGGCCCTGG + Intronic
1169072124 20:2739083-2739105 GGCCCATGTGGGGTTGGCCCAGG - Intronic
1169118284 20:3081280-3081302 GGGCATTGGGGTCAGGGCCCAGG + Intergenic
1170797993 20:19566415-19566437 GGCAGTTGAGGTCATGGCCCAGG + Intronic
1170892919 20:20391369-20391391 GGCCGTTTTGGGAAGGGCCCAGG - Intronic
1171249557 20:23637805-23637827 GGCCATCCTGGCCGTGGCCCTGG - Exonic
1171782959 20:29437816-29437838 GCCCCTTGTAGGCAGGGCCCAGG + Intergenic
1171883057 20:30632050-30632072 GGTCATTGTGGGCCTGGCAGCGG - Intergenic
1174106390 20:48165357-48165379 GGCCTTTGGGGGGATGGCTCTGG + Intergenic
1174292353 20:49518067-49518089 GGCCATTGTAGTCATCCCCCAGG + Intronic
1176074652 20:63242925-63242947 GGCCTATGTGGGGATGGCCTCGG + Intronic
1176298968 21:5089566-5089588 GGCATTTGTGGACATGGCGCTGG - Intergenic
1176337779 21:5615027-5615049 GGCCATTGTGGACTGGGCACAGG - Intergenic
1176339187 21:5678100-5678122 GGCCATTGTGGACTGGGCACAGG - Intergenic
1176471441 21:7110253-7110275 GGCCATTGTGGACTGGGCACAGG - Intergenic
1176495002 21:7492031-7492053 GGCCATTGTGGACTGGGCACAGG - Intergenic
1176505640 21:7646356-7646378 GGCCATTGTGGACTGGGCACAGG + Intergenic
1179858058 21:44172383-44172405 GGCATTTGTGGACATGGCGCTGG + Intergenic
1180083186 21:45496064-45496086 GGGCATGGAGGGCATGGCCCAGG - Intronic
1180869810 22:19139771-19139793 GGGCATTGTACCCATGGCCCTGG + Intronic
1180956579 22:19743936-19743958 GACCAGTGTGGGCAGGGCCTTGG + Intergenic
1181323447 22:22026059-22026081 GGCCATGGTGGAGATGCCCCAGG - Intergenic
1181325649 22:22043739-22043761 GGTGTTTGGGGGCATGGCCCTGG - Intergenic
1181461146 22:23086633-23086655 GGCAACTGTGGGCTGGGCCCCGG - Intronic
1181802178 22:25354846-25354868 GGCTCTCGTTGGCATGGCCCTGG - Intronic
1181854527 22:25772520-25772542 GACCATTGTGGGCAGGGCTGAGG + Intronic
1182422432 22:30254913-30254935 GGCCAAGGTGGGCCTGGACCTGG - Intergenic
1183668886 22:39260535-39260557 GACCATGGTGAGCCTGGCCCAGG + Intergenic
1184839776 22:47045969-47045991 GGTCTTAGTGGGGATGGCCCTGG + Intronic
1184890031 22:47373865-47373887 GGCCATGGGTGCCATGGCCCAGG - Intergenic
1185239992 22:49737267-49737289 GGGCAGGGTGGGCATGGCACGGG - Intergenic
950040772 3:9917794-9917816 GGGCATGGAGGGCATGGGCCTGG - Intronic
950090460 3:10290972-10290994 GCCCCAAGTGGGCATGGCCCTGG + Exonic
950423158 3:12910498-12910520 GGACAATGTGGGGATGGCACTGG + Intronic
950670480 3:14522564-14522586 GGCCCTTCTGGGCTGGGCCCAGG + Intronic
952276244 3:31880038-31880060 GGCACTTGTGGGCAAGGGCCAGG + Intronic
953515383 3:43586064-43586086 GCCCTTTGTGTGCTTGGCCCAGG - Intronic
954223953 3:49171165-49171187 GGCCACTGGGGACATGGCCTGGG - Intergenic
954748960 3:52803053-52803075 GCCCACACTGGGCATGGCCCAGG + Intronic
954880868 3:53835287-53835309 GCCCATTGTGGACAAGGCTCAGG + Intronic
956742537 3:72286524-72286546 TGCCATTGTGGGAAGGGCCCTGG - Intergenic
957082526 3:75648776-75648798 GCCCCTTGTAGGCAGGGCCCAGG - Intergenic
960869264 3:122232609-122232631 GGCCAGTGTATGCAGGGCCCAGG + Intronic
961111998 3:124292262-124292284 GTCCTTTGTGAACATGGCCCAGG - Intronic
961476559 3:127150390-127150412 GGCCAAGGAGGCCATGGCCCTGG - Intergenic
961492294 3:127264301-127264323 GGGCAGGGTGGGCATCGCCCAGG + Intergenic
961509859 3:127394155-127394177 GGGCATTATGGGCTTGGCCCTGG - Intergenic
961537130 3:127577043-127577065 GGCGCTGGTGGGCATTGCCCGGG - Exonic
965763916 3:172109958-172109980 GGCCTTTGTGGGCCTGGGTCTGG + Intronic
966863732 3:184244760-184244782 GGGTGTTGTGTGCATGGCCCTGG - Intronic
967917573 3:194590154-194590176 GGCCATTGTGTCAATGGCTCAGG - Intronic
968625293 4:1624160-1624182 TGGCATTGTGGGCATGGGCATGG + Intronic
968904613 4:3445593-3445615 GGCCATCCTGGGCATGGTCCAGG - Intronic
968910180 4:3473539-3473561 GGCCATTGTCTGCCTGTCCCAGG + Exonic
968955176 4:3715409-3715431 GGCCGGTGGGGGCAAGGCCCAGG + Intergenic
969578000 4:8047540-8047562 GGCCATCGTGGGCATGACTGAGG - Intronic
969695554 4:8732227-8732249 GGCCATTGTGTGCAGGGGGCAGG + Intergenic
969710220 4:8839051-8839073 GGCCATCGTGGACATGGCAGCGG - Intergenic
970508285 4:16755076-16755098 GGCCATTGTGGACCTGGACCTGG + Intronic
973366717 4:49214366-49214388 GGACATTGTGGGCCTGGCAGTGG - Intergenic
973393874 4:49577945-49577967 GGTCATTGTGGGCCTGGCAGCGG + Intergenic
974023107 4:56709071-56709093 GGCCAATGTGGGCATGTGCAGGG + Intergenic
975710896 4:77158358-77158380 GGCCGTGGTGGGGATTGCCCTGG + Intronic
978159211 4:105526533-105526555 GGTCCTTGTTAGCATGGCCCAGG + Intergenic
979420773 4:120502617-120502639 TGCTTTTGTGGGCAGGGCCCAGG - Intergenic
981578646 4:146230285-146230307 AGCCACCCTGGGCATGGCCCTGG + Intergenic
981914184 4:150015761-150015783 GGTTTTTGTGGGCTTGGCCCAGG - Intergenic
985303597 4:188514997-188515019 GGCCATTGGCGGCGTGGCCGTGG + Intergenic
1202764245 4_GL000008v2_random:136991-137013 GGACATTGTGGGCCTGGCAGCGG - Intergenic
985752238 5:1687216-1687238 GGCCATTCTGGGAGTGGGCCTGG + Intergenic
985802633 5:2015299-2015321 GGCCATTGTGGGGACGCCTCAGG + Intergenic
985928442 5:3035804-3035826 GGCCATTGTGGAAATAGACCAGG + Intergenic
995109441 5:108412523-108412545 GGCCAAGGTGGGCAGAGCCCAGG - Intergenic
997474346 5:134133995-134134017 GGCCATGCTGGGCCTGGCCCAGG - Intronic
997786790 5:136720935-136720957 AACCATTGTGTGCATAGCCCTGG + Intergenic
999489985 5:152040188-152040210 GGTCATTGTGGGCCTTGACCTGG + Intergenic
1001716254 5:173818707-173818729 GGACCTTGAGGACATGGCCCTGG + Intergenic
1002103840 5:176870219-176870241 GTGCATCGTGGGCCTGGCCCTGG + Intronic
1002594204 5:180311787-180311809 GGCCTCTGTGAGCATGGCCAGGG + Intronic
1005379566 6:25219122-25219144 GGCCACACTAGGCATGGCCCAGG + Intergenic
1005423657 6:25678743-25678765 GGCAGTGGTGGGCAGGGCCCAGG + Intronic
1005988786 6:30890878-30890900 GGCCACTGTGGGCTGGGCCAGGG + Intronic
1006840130 6:37023105-37023127 GTGCATAGTGGGCATGGGCCTGG - Intronic
1007342039 6:41197182-41197204 GGCCATTGTGGGCATCTGGCTGG - Intronic
1019176987 6:170165077-170165099 GGTCACTGTGGGGATGGCCCCGG - Intergenic
1019352625 7:562117-562139 GGGCATTGAGGGCAAGGCCCGGG - Intronic
1022321593 7:29293242-29293264 GGCCATTGTCAGCAGGGCCAAGG - Intronic
1022465308 7:30649400-30649422 GGCCACTGTGGGCATGGACTAGG + Intergenic
1025161227 7:56662935-56662957 GCTCCTTGTGGGCAGGGCCCAGG - Intergenic
1025223884 7:57139934-57139956 GCCCCTTGTGGGCAGGGCCAAGG - Intergenic
1025722154 7:64026840-64026862 GCCCTCTGTGGGCAGGGCCCAGG + Intergenic
1025722193 7:64027060-64027082 TGCCTCTGTGGGCAGGGCCCAGG + Intergenic
1025744357 7:64230006-64230028 TCCCACTGTCGGCATGGCCCAGG + Intronic
1025749969 7:64285124-64285146 GCCTCTTGTGGGCAGGGCCCAGG + Intergenic
1025750924 7:64293382-64293404 TGCCTCTGTGGGCAGGGCCCAGG + Intergenic
1025751160 7:64294932-64294954 GGCCCTCATGGGCATGGCCAAGG + Intergenic
1025751588 7:64298544-64298566 TCCCACTGTTGGCATGGCCCAGG + Intergenic
1025780699 7:64599439-64599461 GGCCACTATGAGCAGGGCCCAGG - Intergenic
1025782942 7:64617863-64617885 GTCCCTTGTGGGCAGGGCCCAGG - Intergenic
1025785287 7:64638308-64638330 GGCCCATGTGGGCAAGGCACAGG + Intergenic
1025787254 7:64654939-64654961 GGTCAATGTGGGCAGGGCACAGG - Intergenic
1026823334 7:73564628-73564650 TGCCACTGTGGGCAAGTCCCTGG + Intergenic
1029283272 7:99450217-99450239 AGCCAAGGTGGGCCTGGCCCCGG + Intronic
1030267077 7:107631729-107631751 GGCAATTCTGGGCAGGGCCGAGG - Intergenic
1031535924 7:122932608-122932630 GGCCATGGTGGGCAGGGGCAGGG - Intergenic
1032076430 7:128838314-128838336 GGTGAACGTGGGCATGGCCCTGG + Exonic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1034957414 7:155343702-155343724 GGCCATCGTGTGCATGGCGGTGG + Intergenic
1035270372 7:157716143-157716165 GGACACTGTGGGCATCGCCTTGG + Intronic
1040104850 8:43535771-43535793 GGTCATTGTGGGCCTGGCAGTGG + Intergenic
1041128805 8:54673907-54673929 GGCCATGATGGACTTGGCCCAGG + Intergenic
1045554355 8:103201215-103201237 GGCCATGATGGGCAGGGCCTTGG + Intronic
1048068297 8:130994887-130994909 GAACATTGTGGGCATGTTCCTGG + Intronic
1051356101 9:16240797-16240819 GGCCTTTGTGGTCATTGCACGGG + Intronic
1051496296 9:17727488-17727510 GGGCATGGAGGGCATGGCCCTGG - Intronic
1052228270 9:26116309-26116331 GGCCTTTGTGGGCGTGGCAGGGG + Intronic
1055985703 9:82055545-82055567 GGTCATTGTGGGCCTGGCAGTGG + Intergenic
1060268195 9:122124475-122124497 GGCCATGGTGGGCATGGAGCCGG - Intergenic
1061210540 9:129189836-129189858 GGGCATGGCGGGCATGCCCCGGG - Intergenic
1061670798 9:132187134-132187156 GGCCACAGTGGGCATGGCCTGGG - Intronic
1203423889 Un_GL000195v1:19889-19911 GGCCATTGTGGACTGGGCACAGG + Intergenic
1203544994 Un_KI270743v1:121864-121886 GGTCATTGTGGGCCTGGCAGCGG - Intergenic
1185462958 X:340737-340759 GCCCCGTGAGGGCATGGCCCAGG - Intronic
1189487964 X:41447176-41447198 GGCCAGGGTGGTCAAGGCCCGGG + Intergenic
1195328184 X:103775066-103775088 GGTCACTGTCGGAATGGCCCTGG - Intronic
1199600871 X:149540436-149540458 AACCATTGTGGGCAGGGCCGTGG - Intronic
1200251082 X:154554109-154554131 GGCCCTTAGGGGCTTGGCCCAGG - Intronic
1200890333 Y:8316851-8316873 GTCCCCTGTGGGCAGGGCCCTGG - Intergenic
1202080154 Y:21075826-21075848 CACCATAGTGGGCATGGCCCAGG - Intergenic
1202261860 Y:22978645-22978667 GCCCTTTTTGGGCATGGCGCTGG - Intronic
1202265081 Y:23009717-23009739 GTCCTTTGTGGGCAGGGCACTGG - Intergenic
1202414848 Y:24612386-24612408 GCCCTTTTTGGGCATGGCGCTGG - Intronic
1202418072 Y:24643459-24643481 GTCCTTTGTGGGCAGGGCACTGG - Intergenic
1202452714 Y:25026627-25026649 GTCCTTTGTGGGCAGGGCACTGG + Intergenic
1202455937 Y:25057700-25057722 GCCCTTTTTGGGCATGGCGCTGG + Intronic