ID: 1147626038

View in Genome Browser
Species Human (GRCh38)
Location 17:41900777-41900799
Sequence TGCCTGCTGTCTCACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147626037_1147626038 -2 Left 1147626037 17:41900756-41900778 CCTCTGCTTGAACACTTCTTGTG 0: 1
1: 0
2: 3
3: 29
4: 252
Right 1147626038 17:41900777-41900799 TGCCTGCTGTCTCACAGTGATGG 0: 1
1: 0
2: 3
3: 18
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147626038 Original CRISPR TGCCTGCTGTCTCACAGTGA TGG Intronic
900508996 1:3049323-3049345 TGCCTGCTTTGTCCCAGTGATGG - Intergenic
902856224 1:19207895-19207917 TGGCTGCTTTCACACAATGATGG + Intronic
903011942 1:20337599-20337621 TCCCTGCTGTCCCACTCTGATGG + Intronic
904787485 1:32993681-32993703 TGCCTCCTGTTTTACAGAGAAGG - Intergenic
904899524 1:33845883-33845905 TGCCTGCTGGCTCACCCTCAAGG - Intronic
905116419 1:35645199-35645221 TGGCTGCTTTCTCACTGTAATGG - Intergenic
905904818 1:41611037-41611059 GGCCTTCTTTCTCACAGTGTGGG - Intronic
906681725 1:47731154-47731176 TGCCAGGTGTTTCACAGTGATGG - Intergenic
908027421 1:59967671-59967693 TGCCTCCTGTGTCTCAGTTATGG + Intergenic
908892030 1:68859332-68859354 TTCCTCCTGGCTCACAGTGTAGG + Intergenic
909227432 1:73043922-73043944 TGTCACCTGTCTCACAGTGTGGG - Intergenic
910633690 1:89383725-89383747 TGCCTTCTCTCTATCAGTGAGGG - Exonic
910762205 1:90744914-90744936 TGCCTGCTGTGTGAAGGTGATGG + Intergenic
910947517 1:92610448-92610470 TGTCTGCTGTCTCTCACTCATGG - Intronic
915241380 1:154524768-154524790 TGCCAGAGGTCTCACAGTGCTGG - Intronic
916181980 1:162093147-162093169 TGCATGCTGCCTCTCAGTGCTGG + Intronic
917803045 1:178587494-178587516 TGCCTCCTGGCCCACAGTGATGG - Intergenic
918243600 1:182640781-182640803 TCCCTGCAGTCTCCCAGTGAGGG - Intergenic
919802970 1:201364608-201364630 TGCCTGATGTCTCCCAGTTGTGG - Intronic
920345791 1:205304867-205304889 TGCCTTCTGAGTCATAGTGAAGG + Intronic
1063305388 10:4894525-4894547 TGCCTGCTGTGTGGCTGTGATGG + Intergenic
1064943497 10:20761158-20761180 TGCCAGCTGTCTCTCAAGGAAGG + Intergenic
1067744200 10:48922942-48922964 TGCCTGCACCCTGACAGTGATGG + Intronic
1068517427 10:58041752-58041774 TCCTTGCTGTCTCACTGTGTTGG - Intergenic
1069274184 10:66568656-66568678 TGCCTGCTGTCACAAAGCTAGGG + Intronic
1069843116 10:71352352-71352374 TGCCTACCTTCTCACAGTCACGG - Intronic
1070784692 10:79156105-79156127 TGCCTGCTATCTGGCAGAGAAGG - Intronic
1071160876 10:82743692-82743714 TGCCATATGTGTCACAGTGAAGG + Intronic
1071517198 10:86306043-86306065 TTCCTGCTGTCTCTCAGCCATGG + Intronic
1071924135 10:90385897-90385919 TGCCTGGTGTCCCAAAGTGCTGG + Intergenic
1073761322 10:106631720-106631742 TGTCTGCTGTCTCTCAATGGAGG - Intronic
1073835010 10:107431187-107431209 TGCCTACTGTGTCAAAGCGAAGG + Intergenic
1075597263 10:123741247-123741269 TGGGTGCTGACTCACAATGACGG + Intronic
1075844989 10:125538170-125538192 TGCCTGCAGTCTGGCAGGGATGG + Intergenic
1077325731 11:1963204-1963226 TGTCTCATGTCTCTCAGTGAGGG - Intronic
1078645821 11:13140781-13140803 AGCCTGCCGACTCACAGAGAGGG - Intergenic
1079017457 11:16881381-16881403 TGCCTGCTGTCTCTCAATTTCGG + Intronic
1080605717 11:33863381-33863403 TGCAGGCAGTTTCACAGTGAAGG - Intronic
1081257834 11:40919232-40919254 TTCCAGCTGTATCACAGTGTAGG + Intronic
1083308080 11:61771157-61771179 TGCCTGCAGTGTCACACTCAAGG - Intronic
1084966562 11:72747617-72747639 TGCCTGCAGTCTCTCAGCCAAGG - Intronic
1085012508 11:73151053-73151075 TGGCTGGAGTCACACAGTGAAGG - Intergenic
1085298344 11:75443475-75443497 TGCCTTCTGGCTCTCTGTGAGGG + Intronic
1086960829 11:92978868-92978890 TGCCAGCTGTTTCCCTGTGAAGG - Intronic
1087904760 11:103682766-103682788 TGCCTGTTGCCCCACAGTGCTGG + Intergenic
1088289328 11:108219492-108219514 TGCATGCTGTCTCATACAGAAGG + Intronic
1089617970 11:119705877-119705899 TGCCAGCTGTCTCACCTGGAGGG - Intronic
1089863803 11:121614484-121614506 TTCCTGCTGTAACACTGTGATGG + Intronic
1090596803 11:128329223-128329245 TGGCTGCTGGCTCACTCTGAGGG - Intergenic
1090714519 11:129418469-129418491 TGCCTTCTTTCTCCCAGTCAGGG + Intronic
1090725395 11:129521190-129521212 TGCCTGATGTATCCCAGAGATGG - Intergenic
1090829835 11:130413510-130413532 TGGATGCTGTTTCATAGTGATGG + Intronic
1091235172 11:134017128-134017150 TGCCTGCTCCCTCACAGTGATGG + Intergenic
1202808711 11_KI270721v1_random:18383-18405 TGTCTCATGTCTCTCAGTGAGGG - Intergenic
1097604040 12:61730838-61730860 TGCCTGCTTTCTCAGAGGGAAGG - Intronic
1099545997 12:83980369-83980391 TGCATGCTGGCTCAGACTGAGGG + Intergenic
1100033692 12:90224672-90224694 AGACTGCTGTCCCACAGTGCAGG + Intergenic
1103010507 12:117454981-117455003 TGCCTGCCTCCACACAGTGAAGG - Exonic
1103326030 12:120121354-120121376 TGCCTGGTGTCTCCCTCTGATGG + Intergenic
1103943939 12:124516105-124516127 TGCCCGCTGTCTCATTGTCATGG - Intronic
1104393554 12:128411904-128411926 AGCCTGGTGTCTCACCGTAAGGG - Intronic
1105603438 13:21907878-21907900 GGCCTGGGGTCTCACAGTGGTGG - Intergenic
1106813141 13:33379551-33379573 TGCCTGTTCTCTCACTGGGAAGG + Intergenic
1106954522 13:34921339-34921361 TGACTGCTGTGTGTCAGTGAAGG - Intergenic
1107355288 13:39559738-39559760 TGCATGCTGTAGCACAGAGAAGG + Intronic
1107813587 13:44223672-44223694 TGCCTACTATCACACAATGATGG - Intergenic
1108364625 13:49697450-49697472 TGTCCGTTGTCTTACAGTGATGG - Intergenic
1108747695 13:53411612-53411634 GGCCTGCTGTGCCACAGTCAGGG + Intergenic
1109883053 13:68507139-68507161 TGACTGCTCTCTGCCAGTGAGGG - Intergenic
1111868055 13:93794599-93794621 TCCCTCCTCTCTCAAAGTGATGG - Intronic
1114063555 14:19040231-19040253 GCCCTGCAGTCTCACAGTGGAGG - Intergenic
1114098701 14:19359765-19359787 GCCCTGCAGTCTCACAGTGGAGG + Intergenic
1115484800 14:33900444-33900466 TGCCTGCTTTCTGACTTTGAAGG - Intergenic
1117836468 14:59811987-59812009 TGAATGCTATTTCACAGTGAGGG - Intronic
1118076251 14:62302359-62302381 TGCCTCCTGTCTCCCTGTGGAGG - Intergenic
1118230970 14:63949581-63949603 GGCATGCTGTCCCACATTGAGGG - Intronic
1121282115 14:92706468-92706490 AGCCTGCTGGCTCACCGTGGGGG + Exonic
1124082708 15:26516540-26516562 TGCCTGCTGTTTTAGAATGATGG + Intergenic
1125267003 15:37893484-37893506 TGGCAGCTGTCTCACTGTAAAGG + Intergenic
1126713611 15:51489008-51489030 TGCCTACAGTCACACAGTAAGGG + Intronic
1127854193 15:62941372-62941394 TGCCTGCAGAGCCACAGTGAAGG - Intergenic
1131376085 15:91924729-91924751 TGCTTACTGCCTCACAATGATGG + Intronic
1131550952 15:93356553-93356575 TCCCTGCTCTCACACAGTGTAGG + Intergenic
1132041523 15:98528555-98528577 TGCCTTCTGTCTGACAGTGATGG - Intergenic
1132552054 16:557572-557594 TGCCTGCACCCACACAGTGAGGG - Intergenic
1133101787 16:3484456-3484478 TGCCTGCTGCCTCACTCAGAAGG + Intronic
1133258848 16:4535679-4535701 TGCCTGATGACTCACAGAGTAGG + Intronic
1138311667 16:56029054-56029076 TACCTGGTGTCTCTCATTGAGGG - Intergenic
1139486348 16:67258736-67258758 TGCCTGCTTTCTTACAGCTAAGG - Intronic
1141754645 16:85983179-85983201 TGCCTGAGGCCACACAGTGATGG + Intergenic
1142120647 16:88384964-88384986 TGCCTGCTGCCTCAGGATGATGG - Intergenic
1143094764 17:4472632-4472654 TCCCTGCTGGCTCTCAGTTAGGG + Intronic
1144722353 17:17480151-17480173 TGCCTGGTGTCCCACAGTCAAGG - Intronic
1144827975 17:18117127-18117149 TGCAGGCAGTCTCACAGGGATGG - Intronic
1146582115 17:34047774-34047796 GGGCTGCAGTCTCACAGTGGAGG - Intronic
1147626038 17:41900777-41900799 TGCCTGCTGTCTCACAGTGATGG + Intronic
1152908887 17:82985825-82985847 TGCCAGCTGTCTCACGGGGCAGG - Intronic
1153129703 18:1840944-1840966 TGCCTCCTACCTCAAAGTGAAGG - Intergenic
1153146725 18:2041524-2041546 TGCATTCTCCCTCACAGTGAAGG + Intergenic
1155923641 18:31630509-31630531 TGCCTGCTCTCCCCCAGTGATGG - Intronic
1156583473 18:38406476-38406498 TCCATGCTTTCTCACAGTGCAGG + Intergenic
1158872691 18:61703540-61703562 ACCCTGCTGTCTCACTGTAATGG + Intergenic
1161226313 19:3148029-3148051 TGCCTGCTGCATCAAACTGAGGG - Intronic
1161326242 19:3665602-3665624 TCCCAGCGGTCTCACAGTTAGGG - Intronic
1164778089 19:30869990-30870012 TTCATGCTATCTCACAGTCAAGG - Intergenic
1165337618 19:35182773-35182795 TGCCTGGTGCCCAACAGTGATGG + Intergenic
1165614094 19:37183399-37183421 TGCCTGCTGTATGGCAGTCATGG + Exonic
1166962836 19:46509528-46509550 TGCCTGCTGTATCACAGGTGTGG - Intronic
1167037476 19:47002735-47002757 TGCCTGCGTTCACACAGGGACGG - Exonic
925329243 2:3045337-3045359 AGCCTGCTGTCTCACTGTGGCGG - Intergenic
925333287 2:3075148-3075170 TCCCTTCCGTATCACAGTGAGGG + Intergenic
926411404 2:12606538-12606560 CCCCTGCTGACTCACAGTGTGGG + Intergenic
927048262 2:19301954-19301976 TGGCTGCTGGCTCACAGAGAAGG + Intergenic
927187977 2:20496275-20496297 TGCCTGGTGACTCACTGTGCTGG + Intergenic
928637329 2:33261221-33261243 AGTCTGCTGCCTCACGGTGATGG + Intronic
930278202 2:49338554-49338576 TGCCTGAGGTCTCAGAGTTAGGG + Intergenic
931435693 2:62244071-62244093 TGACTGGTGTCTCAGAGTGTGGG + Intergenic
932502739 2:72198296-72198318 GGCCTGCTCTCTCACAGAGCAGG + Intronic
932919675 2:75896874-75896896 TGCCTCCAGTCTCAAAGAGAAGG - Intergenic
933835283 2:86240885-86240907 TGCCTGCTGTCTCTCCTTAAGGG - Intronic
934720168 2:96568628-96568650 TGCCTGCTGGCTCAGGTTGAGGG + Intergenic
936764017 2:115823106-115823128 TTTCTGCTGTCTCTCAGTCATGG + Intronic
937813123 2:126220908-126220930 TGCCTGAGGTCTCACAGGGGAGG - Intergenic
938079806 2:128363872-128363894 TGCCTGCCTTCTCACTGTGAGGG + Intergenic
938485787 2:131706407-131706429 TGACTGCTGTGTGTCAGTGAAGG - Intergenic
938846023 2:135210140-135210162 TTACTGCTGTCTCAGTGTGATGG - Intronic
940131552 2:150388183-150388205 TGGTTTCTGTCTCACAGGGAAGG - Intergenic
941846836 2:170142081-170142103 TGCCTGCTGTGCCCCTGTGATGG + Intergenic
943634931 2:190296098-190296120 TGCCTGCTTTTTCTCAGAGAAGG - Intronic
944280379 2:197889227-197889249 TGTCTCCTGTCTCCCAGTGTAGG + Intronic
945916974 2:215714501-215714523 TGCCTGGTGGTTCACAATGATGG + Intergenic
946870199 2:224078009-224078031 GGCCTGCTCTCTTACAGTCATGG + Intergenic
948764818 2:240213979-240214001 TGCCTGCTCTCTCACAGCACTGG - Intergenic
948887762 2:240892588-240892610 GGCCAGCAGGCTCACAGTGACGG + Intronic
948887775 2:240892642-240892664 GGCCAGCAGGCTCACAGTGACGG + Intronic
948908151 2:240989609-240989631 TCACTGCTGTCTCTCACTGAGGG - Intronic
948938220 2:241182238-241182260 TGTCTGCTGTGTCACAGTGATGG + Intronic
1168855630 20:1005692-1005714 TTCCTGCTATCCCACAGAGAAGG - Intergenic
1172024289 20:31937421-31937443 TGGCTGCTGGCTGTCAGTGATGG - Exonic
1174391158 20:50219177-50219199 TTCCTGCTGCCACACAGTGTTGG + Intergenic
1176219698 20:63964099-63964121 TGCCTCCTTGCTGACAGTGATGG + Exonic
1179001143 21:37459514-37459536 TACTTTCTGTCTCACAGTGGTGG + Intronic
1179082152 21:38181224-38181246 TCCCTCCCGTTTCACAGTGAAGG + Intronic
1179321948 21:40300627-40300649 TGACTCCTGTCCCTCAGTGATGG - Intronic
1179396562 21:41045613-41045635 TGCCTGCTGGCCCACAGCCAAGG - Intergenic
1179896351 21:44365738-44365760 TGCCTGTGGCCTGACAGTGAGGG + Intronic
1180482049 22:15762865-15762887 GCCCTGCAGTCTCACAGTGGAGG - Intergenic
1180840442 22:18956622-18956644 GGGCTGATGTCTCACAGTGAGGG + Intergenic
1181061048 22:20282154-20282176 GGGCTGAAGTCTCACAGTGAGGG - Intronic
1182158444 22:28098130-28098152 TGCATGCTGCCCCACTGTGATGG + Intronic
1184444045 22:44536752-44536774 TGCCTACTGTTGCACAGTGCAGG - Intergenic
952042111 3:29273513-29273535 AGCCTGCTGGCTCACCCTGAAGG - Intergenic
954240269 3:49288210-49288232 TGCCTGCTGCCTCTCGGAGAAGG + Intronic
954751711 3:52817740-52817762 TGCCTGGGGTCACACAGGGATGG - Intronic
955047264 3:55372129-55372151 CACCTGCTATCTCCCAGTGAAGG + Intergenic
956142369 3:66158943-66158965 TGCATGCTGTCCCACAGTATGGG - Intronic
959009783 3:101061527-101061549 TGCTTGCTTTCTCAGTGTGAAGG - Intergenic
959930152 3:111971742-111971764 TCCCTTCTGTCTGTCAGTGAGGG + Intronic
960052447 3:113251321-113251343 GGCCTCCTGTCTCTCTGTGAGGG + Intronic
963754953 3:149225250-149225272 CTCCTGCTGTCACAAAGTGAAGG - Intergenic
967130375 3:186465034-186465056 GGGCTGCTGTTCCACAGTGAAGG + Intergenic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
969690027 4:8699132-8699154 TTCCTGCTGACCCCCAGTGAGGG + Intergenic
970810797 4:20091806-20091828 TGCCTGGTGTCTTACATAGAAGG + Intergenic
971057117 4:22926113-22926135 TGCCTGCTTTTTAACAATGAAGG - Intergenic
972052608 4:34758021-34758043 TCCCTGCTGTCTTCCAGTGCTGG + Intergenic
972791872 4:42380318-42380340 TGTCTGCTGTCTCTCATTTATGG + Intergenic
975184098 4:71380927-71380949 TGCCTGGTGTTTCTCAATGAAGG + Intronic
978160822 4:105545859-105545881 TGCATTCTGACTCACTGTGATGG - Intergenic
978943982 4:114472408-114472430 CGCCTGCTCTCTGACAGTGCCGG + Intergenic
979628975 4:122879378-122879400 TGGCTACTGTCAGACAGTGAGGG + Intronic
980441606 4:132854478-132854500 TCCCTGCTATCTCACAAGGAAGG + Intergenic
981538598 4:145825253-145825275 TGCAGGCTTTCTCACAGTGCTGG - Intronic
982743425 4:159081439-159081461 TGCCTGCAGTCCCAAAGTGCTGG - Intergenic
984065038 4:175037137-175037159 TGCTTGCTGTGTCAAAGAGAAGG - Intergenic
985964823 5:3331959-3331981 TGCCTGCAGGCTCACACTCATGG - Intergenic
986464957 5:8011856-8011878 CACCTGCTGTCCCACAGTGAGGG - Intergenic
986896537 5:12377457-12377479 TGTGTGCAGACTCACAGTGAGGG - Intergenic
989000693 5:36757247-36757269 TTCCTGCTGTCTCATAGTTTCGG + Intergenic
989245243 5:39246918-39246940 TGCTTGAGGTCTCACAGTAAGGG - Intronic
989973363 5:50551940-50551962 AGCCTTCTGTCTTACAATGAAGG + Intergenic
991124393 5:63053100-63053122 TGGCAGCTGCCTCCCAGTGAGGG + Intergenic
992579937 5:78162818-78162840 TGTCTGCTGTCCAACAGGGATGG - Exonic
993129841 5:83881812-83881834 TGTCTGCTCTCTCACATTGCTGG - Intergenic
994051896 5:95371298-95371320 GGCCTTCTGTCTCAGACTGAAGG + Intergenic
995016410 5:107314453-107314475 AGTCTGTTCTCTCACAGTGAGGG - Intergenic
997157280 5:131574029-131574051 TGTGGGTTGTCTCACAGTGAAGG - Intronic
997465157 5:134083117-134083139 TGCCTTGGGTCACACAGTGATGG + Intergenic
998107353 5:139476991-139477013 TGCCCGAGGTCACACAGTGAGGG + Intronic
998628096 5:143868415-143868437 TGGCTGCTGTATCTCAGGGAAGG - Intergenic
999145651 5:149391554-149391576 AGCCTGCTGTTTCACAGTGCTGG + Intronic
999482506 5:151961707-151961729 TGCCTGTTATTCCACAGTGAGGG + Intergenic
999637862 5:153641320-153641342 TGACAGCTGTCTCCCAGGGAGGG - Intronic
999953429 5:156674538-156674560 TGCCTTGAGTCTCTCAGTGATGG - Intronic
1001145810 5:169183450-169183472 TGCCTCCTTTCTTGCAGTGAGGG + Intronic
1003811610 6:9789033-9789055 TACCTGTTGTCTCTCAGTGGGGG - Intronic
1003964063 6:11236485-11236507 TGACTGCTCTCTAAGAGTGAAGG + Intronic
1005728190 6:28670271-28670293 TGCCTTATGTCTCACAGTAGCGG + Intergenic
1005850636 6:29818111-29818133 TGGCTGCTTTCACACAATGAGGG + Intergenic
1005983825 6:30857772-30857794 TGCCTGCTGGGGCCCAGTGAGGG + Intergenic
1006066151 6:31463879-31463901 TGGCTGCTGTCACACAATGAGGG - Intergenic
1007710982 6:43824156-43824178 TGCCTGCTGTTTTCCAGTTATGG + Intergenic
1008138517 6:47805128-47805150 TGCCTCAAGGCTCACAGTGAGGG - Intronic
1008813720 6:55537662-55537684 TGCCTGCAGTATCAGAGTGTTGG - Intronic
1010048758 6:71478785-71478807 TGTCTGTTGTCTCAAAGTGGTGG + Intergenic
1011084028 6:83519280-83519302 TGTATGCTGACTCACAGTGGTGG + Intronic
1013838331 6:114359465-114359487 TGCCTGCTGGGTCACAGTAAAGG - Intergenic
1013880303 6:114891188-114891210 TGACTACTGTGTCACAGTGGAGG - Intergenic
1016342517 6:143079059-143079081 CTCCTGCTGCCTCACTGTGAAGG - Intronic
1022527795 7:31049656-31049678 TGCCTTCTGTCTCCTAGGGAAGG - Intergenic
1022575362 7:31492243-31492265 TGCCTGCTAGGTCACAGTGTCGG + Intergenic
1023242970 7:38168576-38168598 TGCCCACTCTCTGACAGTGATGG - Intergenic
1023872954 7:44272567-44272589 TGCCTGCTGCCTCAAGGTCAGGG + Intronic
1031393444 7:121244423-121244445 TTCCTGCTGTCTCACAGCAGAGG + Intronic
1034673080 7:152872166-152872188 TACCTGCTGTCTCTCAGCGGTGG + Intergenic
1035294931 7:157861635-157861657 TGCCTGCAGTCTCACAGGCTGGG + Intronic
1035484603 7:159212905-159212927 TGCCAACTGTCCCACACTGAGGG - Intergenic
1039461813 8:37751432-37751454 TGGTTACTGTCTCACACTGATGG + Intronic
1039977350 8:42378646-42378668 TTCCTGCTGCCTCACTGTAAGGG + Intergenic
1041936589 8:63338712-63338734 GGCCTGCTGGCTACCAGTGACGG - Intergenic
1041990179 8:63978765-63978787 GGGCTGCAGTTTCACAGTGAAGG + Intergenic
1045105712 8:98890465-98890487 TGCTTGCTGTCGCACAGACAAGG - Intronic
1048058319 8:130890908-130890930 TGACTGAGGTCTCACAGTGTGGG + Intronic
1049420534 8:142514453-142514475 TGCCACCTGTCTCAGAGTGGTGG + Intronic
1049630545 8:143652995-143653017 TGCCTGCTGTGGCACAGAGCTGG + Exonic
1050259204 9:3823518-3823540 TGCCTGCTCTCTGACCTTGAGGG + Intergenic
1053532123 9:38892948-38892970 TGCTTGCTGGCTAACAGGGAGGG + Intergenic
1054204346 9:62117357-62117379 TGCTTGCTGGCTAACAGGGAGGG + Intergenic
1054634015 9:67471007-67471029 TGCTTGCTGGCTAACAGGGAGGG - Intergenic
1056795419 9:89655592-89655614 TGCCTGGTGCCTCACAGTGGTGG + Intergenic
1057266692 9:93622118-93622140 TCCCTGCTATATCACAGGGAGGG + Intronic
1057696434 9:97326159-97326181 TGCCTGCTCTCACACAGTCCAGG + Intronic
1061182403 9:129032540-129032562 TGGCTGCTCTCTGCCAGTGAGGG - Intergenic
1061290516 9:129648371-129648393 TGCCTGCTGTCTCCCCAGGAGGG + Intergenic
1062685602 9:137811405-137811427 TTCCTGCTGGCTCACAGTGCTGG - Intronic
1185452809 X:291786-291808 TGCCTGCTCTCCCGCAGTGTGGG + Intronic
1187200217 X:17127522-17127544 TGCCTGCTGTGGCATAGAGAAGG + Intronic
1187383681 X:18828364-18828386 TCCCTGCTGTCTTACAAGGAAGG + Intergenic
1187469360 X:19554884-19554906 TTTCTGCTTTCTGACAGTGAAGG + Intronic
1192051650 X:67729802-67729824 TGGCTGCTGCCTCACAGTATGGG + Exonic
1193629111 X:83859377-83859399 GGCCTCCTGTCTCACAATGCCGG + Intergenic
1195053217 X:101117442-101117464 TGCCTGCTCTCCCAAAGTGTTGG + Intronic
1195247293 X:103005924-103005946 TGCCTGCTCTCTCTCAGGTAAGG - Intergenic
1195788962 X:108560352-108560374 TGCCTGCTGGCCAACTGTGAGGG - Intronic
1198643009 X:138777271-138777293 TGCCTGGTGTTTCACAGTAAGGG - Intronic
1200343009 X:155419158-155419180 TACCTGATATCTCACAGTTATGG + Intergenic
1200979900 Y:9253848-9253870 TGCCTTCTGGTTTACAGTGATGG + Intergenic