ID: 1147627442

View in Genome Browser
Species Human (GRCh38)
Location 17:41909227-41909249
Sequence ACATAGCTCTTCAGCCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147627438_1147627442 -10 Left 1147627438 17:41909214-41909236 CCCTGCTCCCTGGACATAGCTCT 0: 1
1: 0
2: 0
3: 22
4: 414
Right 1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 144
1147627432_1147627442 11 Left 1147627432 17:41909193-41909215 CCCTTCCATCTCCTCTGCAACCC 0: 1
1: 0
2: 4
3: 74
4: 575
Right 1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 144
1147627428_1147627442 30 Left 1147627428 17:41909174-41909196 CCTAAACGCACCCCACTGGCCCT 0: 1
1: 0
2: 2
3: 8
4: 148
Right 1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 144
1147627429_1147627442 20 Left 1147627429 17:41909184-41909206 CCCCACTGGCCCTTCCATCTCCT 0: 1
1: 0
2: 2
3: 68
4: 696
Right 1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 144
1147627430_1147627442 19 Left 1147627430 17:41909185-41909207 CCCACTGGCCCTTCCATCTCCTC 0: 1
1: 0
2: 4
3: 47
4: 510
Right 1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 144
1147627435_1147627442 0 Left 1147627435 17:41909204-41909226 CCTCTGCAACCCCTGCTCCCTGG 0: 1
1: 1
2: 47
3: 625
4: 1965
Right 1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 144
1147627431_1147627442 18 Left 1147627431 17:41909186-41909208 CCACTGGCCCTTCCATCTCCTCT 0: 1
1: 0
2: 9
3: 96
4: 793
Right 1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 144
1147627434_1147627442 6 Left 1147627434 17:41909198-41909220 CCATCTCCTCTGCAACCCCTGCT 0: 1
1: 1
2: 2
3: 70
4: 723
Right 1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 144
1147627433_1147627442 10 Left 1147627433 17:41909194-41909216 CCTTCCATCTCCTCTGCAACCCC 0: 1
1: 0
2: 5
3: 57
4: 619
Right 1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 144
1147627437_1147627442 -9 Left 1147627437 17:41909213-41909235 CCCCTGCTCCCTGGACATAGCTC 0: 1
1: 0
2: 0
3: 29
4: 245
Right 1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147627442 Original CRISPR ACATAGCTCTTCAGCCACTG AGG Intronic
900865525 1:5266194-5266216 CCACAGCTCTTCCGCCACTCTGG - Intergenic
901281295 1:8037271-8037293 TCTTTGGTCTTCAGCCACTGAGG + Intergenic
902752479 1:18526779-18526801 ACATCTCACTTCAGCCACAGAGG + Intergenic
902895463 1:19476811-19476833 CCAGACCTCTTCAGCCACTGTGG + Intronic
903374738 1:22858776-22858798 ACATAGCTCTTCAGTAGCAGAGG - Intronic
907962807 1:59298450-59298472 ACATGGCTCTCCACCCTCTGGGG - Intronic
912544540 1:110441333-110441355 ACATTGCTCTTCAGCCCCATTGG - Intergenic
914830993 1:151170762-151170784 GCATCTCTCTTCACCCACTGTGG - Intronic
916682239 1:167115218-167115240 CTATAGCCCTTCAGCCACTAAGG - Intronic
920347143 1:205313765-205313787 ACCTAGCCCTGCAGCCTCTGAGG - Intronic
923558856 1:235023213-235023235 ACGTAGCTCTTAAACAACTGAGG + Intergenic
924080888 1:240397041-240397063 GCAAAGTTGTTCAGCCACTGTGG - Intronic
1063534013 10:6864761-6864783 AAATACCTCTCCAGCCACCGAGG - Intergenic
1066977776 10:42385359-42385381 ACTTTGCTTTTCAGCCTCTGAGG - Intergenic
1068997297 10:63222116-63222138 ACATAGCACTTCCGCCAGGGAGG + Intronic
1072133832 10:92523881-92523903 ACATAACTCTACCGACACTGTGG - Intronic
1073142996 10:101261299-101261321 ATACAGCCCTTCAGCCAATGGGG - Intergenic
1073179498 10:101575177-101575199 CCAGAACTCTTGAGCCACTGGGG - Intronic
1074072991 10:110092126-110092148 ACACTGCTGTCCAGCCACTGTGG + Intronic
1075786995 10:125056856-125056878 ACACAGCTCATCAAGCACTGGGG - Intronic
1077519090 11:3020690-3020712 ACATAGTGGTGCAGCCACTGGGG + Intronic
1079856759 11:25614083-25614105 TCATTGCCCTTCAGCCACAGTGG + Intergenic
1081053369 11:38374839-38374861 ACAAAACTTTTTAGCCACTGTGG - Intergenic
1082195343 11:49298170-49298192 ACATACCAATTCAGCCACAGTGG - Intergenic
1082903702 11:58283836-58283858 AGATAGCTCTTCAGCAAATTAGG - Intergenic
1086660589 11:89411382-89411404 ACATACCAATTCAGCCACAGTGG + Intronic
1086964146 11:93010225-93010247 ACCTGGCACTTCAGTCACTGTGG + Intergenic
1087260102 11:96001736-96001758 ACATAGCTCTTCACTAACTTTGG + Intronic
1087953823 11:104258651-104258673 TCATCGCTCTGCATCCACTGAGG - Intergenic
1089756983 11:120694546-120694568 ACATTTCACTGCAGCCACTGAGG + Intronic
1091408463 12:223740-223762 ACATACCTCTTCACTTACTGTGG + Intronic
1092384037 12:8021805-8021827 ACAGGGCTCTGAAGCCACTGAGG - Intergenic
1093682105 12:22014486-22014508 AAATAGCTCCTCTCCCACTGAGG + Intergenic
1094352761 12:29544938-29544960 ACATTTCTCTTTGGCCACTGGGG - Intronic
1094391914 12:29960896-29960918 ACATTTCACTTCAGCCACTGAGG + Intergenic
1097711834 12:62925644-62925666 ATGTAGCTCTTCAGCCACAGGGG - Intronic
1102007575 12:109598258-109598280 ACACAGCTCATCAGCATCTGAGG + Intergenic
1106074078 13:26442222-26442244 ACATTGCTCTTCAGCCTCCCAGG - Intergenic
1111052751 13:82906693-82906715 AGGCAGGTCTTCAGCCACTGAGG + Intergenic
1111825668 13:93264058-93264080 TCATTGCTCTTCTGCTACTGGGG + Intronic
1113620484 13:111759106-111759128 AAAAAGCGCTGCAGCCACTGAGG + Intergenic
1117189849 14:53278831-53278853 GAGTAGGTCTTCAGCCACTGAGG - Intergenic
1117563180 14:56966302-56966324 ACCAAGCACATCAGCCACTGAGG - Intergenic
1117737774 14:58784982-58785004 AGACATCCCTTCAGCCACTGGGG - Intergenic
1117976422 14:61301552-61301574 ACACATCTGTTCAGGCACTGAGG + Intronic
1118000140 14:61515301-61515323 ATAAAGTTCTCCAGCCACTGTGG + Intronic
1118454197 14:65930031-65930053 ACATAACTCTATAGCCACAGGGG + Intergenic
1122119270 14:99543220-99543242 AGTTAGCTCTTCTGGCACTGGGG - Intronic
1122202503 14:100131058-100131080 ACCTAGCTCTCCAGGCACAGGGG - Intronic
1122762325 14:104038420-104038442 ACATAGTTCCTCACCCACAGAGG - Intronic
1123141013 14:106078729-106078751 ACACTGCTCTTCAGCCACATTGG + Intergenic
1125106142 15:35973699-35973721 ACATAGGTCTTCGGCCTTTGTGG + Intergenic
1126133538 15:45368076-45368098 ATAAAGCTCATCAGCCATTGTGG + Exonic
1126314491 15:47355666-47355688 AAATAGCTTTTAAGCCACTTTGG + Intronic
1128239521 15:66092403-66092425 TCATGGCTCTTCAACCAATGAGG + Intronic
1128694322 15:69748886-69748908 ACCTAGCTTTTCAGCCAGAGAGG - Intergenic
1128995225 15:72290052-72290074 ACATAACTCTTTGGCCCCTGTGG - Intronic
1130358474 15:83157540-83157562 ACAGAGCTCTTCAGAAACTGAGG - Exonic
1130575470 15:85089053-85089075 TCACAGCTCTTCAGCAGCTGTGG - Intronic
1133416760 16:5612964-5612986 ACCTTGCTGGTCAGCCACTGTGG - Intergenic
1133728116 16:8555959-8555981 AGACAGCGCTTCAGACACTGTGG - Intergenic
1136274661 16:29171864-29171886 ACATAGCTGTGCACACACTGTGG - Intergenic
1138191139 16:55015403-55015425 ACATACCTCTTTAGACACGGTGG + Intergenic
1139767507 16:69243329-69243351 CCACAGCTCTTCAGCCATTCTGG + Intronic
1139916280 16:70430384-70430406 AAATTGCTTTTCAGGCACTGAGG + Intronic
1141908718 16:87044179-87044201 ACTCAGCTCTTCAGCCAGAGGGG - Intergenic
1142428112 16:90011435-90011457 GCCCAGCTCTTAAGCCACTGGGG - Intronic
1143914395 17:10278242-10278264 AAAGAGCTCTTCAGCCATTGTGG + Intergenic
1147030008 17:37625977-37625999 ACATAGCTCTTCGGACCTTGTGG + Exonic
1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG + Intronic
1152495563 17:80669001-80669023 ACCTGGCTCTCCAGCCTCTGTGG - Intronic
1155938026 18:31774594-31774616 ACGAAGACCTTCAGCCACTGTGG - Intergenic
1156833105 18:41519618-41519640 ACATGGCTCTTGTGCCACTGTGG - Intergenic
1157291606 18:46413457-46413479 ACAGAGCTCTGCAGGCTCTGTGG + Intronic
1157823413 18:50790414-50790436 ACATCTCTCTTCAGCTGCTGTGG - Intergenic
1160578220 18:79869091-79869113 ACACAGCCCTGCAGACACTGGGG + Intronic
1161951074 19:7468469-7468491 TCATAGCTCTTGAGCCTCTTGGG - Intronic
1162064903 19:8119389-8119411 TCATCACTCTTCAGCCACAGAGG + Intronic
1162679674 19:12331525-12331547 ACATGGCTGGTCAGCCACTCAGG - Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
927766458 2:25813536-25813558 ACTTAGTTTTTCAACCACTGCGG + Intronic
928252921 2:29697507-29697529 GCAAAGTTCTTCAGCCACTTTGG - Intronic
928980904 2:37134323-37134345 ACTTTGCTTTTCAGCCTCTGAGG + Intronic
929555655 2:42924158-42924180 ACATAGCTGTTCAGACTCAGAGG + Intergenic
929832259 2:45356572-45356594 GCATTGCTGTTCAGCCACTCTGG + Intergenic
930585415 2:53262152-53262174 ACATAGTTCTTTAGTGACTGAGG + Intergenic
937087639 2:119181819-119181841 ACAGAACTCTTCAGCCGCTCAGG - Intergenic
940856046 2:158729494-158729516 TCATTGCTCCTCAGCCACAGGGG + Intergenic
947643510 2:231721153-231721175 TCATAGCTCTTCCACCACTAGGG + Intergenic
1170115003 20:12848074-12848096 CCATAGCTCTCCAGCAACTTTGG - Intergenic
1174956001 20:55099485-55099507 ACTTACCCATTCAGCCACTGAGG + Intergenic
1179337357 21:40470209-40470231 ACAAAGCTTTTCAGCCAATGAGG + Intronic
1180020567 21:45122888-45122910 TCATAGCTCTTCTGCACCTGTGG + Intronic
1181303003 22:21895126-21895148 ACAAAATTATTCAGCCACTGTGG + Intergenic
949212300 3:1518023-1518045 ACATAGCTGTTCCTCCAATGTGG + Intergenic
950519868 3:13491716-13491738 CCATACCTCGTCAGCCTCTGTGG - Intronic
950679706 3:14576380-14576402 ACACAGCTCATCAGCAGCTGAGG + Intergenic
950746742 3:15096583-15096605 ATATGCCACTTCAGCCACTGGGG + Exonic
951317325 3:21203570-21203592 AAATAGATCTTCAGAGACTGAGG + Intergenic
951472687 3:23072767-23072789 ACATAGCTCTGCCCTCACTGAGG + Intergenic
951829616 3:26911393-26911415 ACATTGGCCCTCAGCCACTGGGG - Intergenic
956921846 3:73938103-73938125 ACAAAAGTCTTAAGCCACTGAGG - Intergenic
962114557 3:132489401-132489423 ACCTAGCACTTCTGCCACTTTGG - Intronic
963638825 3:147833998-147834020 ACAAATCAGTTCAGCCACTGTGG - Intergenic
963771459 3:149390642-149390664 AAATAGCTCTTTTGCCTCTGTGG + Intergenic
964416970 3:156457942-156457964 TCATAGTTTTTCAGCCCCTGAGG + Intronic
965074542 3:163959730-163959752 ACATTGTTGTTCTGCCACTGAGG - Intergenic
968243211 3:197112336-197112358 ACAAACCTCTTCATTCACTGCGG + Intronic
970780160 4:19728025-19728047 ACATAGCTTGTAAGCCAATGAGG + Intergenic
970926404 4:21457534-21457556 ACATAGCTCTTCTGGTATTGGGG + Intronic
973305212 4:48640164-48640186 ACATACGTCTTCAGCTCCTGTGG - Intronic
976050427 4:81005698-81005720 TCACAGCTCTCCAGGCACTGGGG + Intergenic
980329274 4:131389577-131389599 ATATATCTCTTGAGCCAGTGAGG - Intergenic
980863012 4:138521825-138521847 AAATAGGTCTTCAGACAGTGTGG + Intergenic
980998722 4:139807623-139807645 ACAAGGCTCTTCTGCCACTGAGG - Intronic
985991645 5:3566708-3566730 ACTTGGCTCTTCGGCCACCGCGG + Intergenic
990951634 5:61304412-61304434 AAATAGCTCTTTAGCCAGTGTGG - Intergenic
994816969 5:104597012-104597034 ACTTTGCTTTTCAGCCTCTGAGG + Intergenic
995528844 5:113073144-113073166 ACATTGCTCTTCTTCCAGTGTGG + Intronic
995556980 5:113339873-113339895 AGATTGCTATGCAGCCACTGTGG - Intronic
995676170 5:114664527-114664549 ACATAGCTCCTCTAACACTGGGG - Intergenic
997184232 5:131865910-131865932 ACATACCACTGCTGCCACTGAGG - Intronic
999148046 5:149408651-149408673 CCAGAGCTCTTCAGCAACTCTGG - Intergenic
1001270494 5:170307755-170307777 ACACGGCTCTCCAGCCATTGAGG + Intergenic
1001416153 5:171545890-171545912 TCATTGCTCTTCTACCACTGAGG + Intergenic
1002916900 6:1536743-1536765 ACATTCCTCTGCAGCCGCTGTGG + Intergenic
1004644357 6:17545007-17545029 AAATAGCTCTTCAGAAAGTGTGG - Intronic
1009974202 6:70655567-70655589 ACTCAGCTCTTCTGCCACAGGGG - Intergenic
1012063769 6:94520273-94520295 AACTAAATCTTCAGCCACTGAGG + Intergenic
1013427345 6:110025367-110025389 ACAAAACTCCTCAGACACTGAGG + Intergenic
1013723187 6:113056728-113056750 ACATAGCTGGTAAGCCACAGAGG - Intergenic
1026255574 7:68708303-68708325 ACATAGCTCTTCAGGCACATAGG + Intergenic
1028515598 7:91674703-91674725 ACCTAGCTTTTCTGCGACTGAGG - Intergenic
1029956543 7:104646008-104646030 CCATAGCTCTCCAGACAATGAGG + Intronic
1030206685 7:106958320-106958342 ACCTTGCTCTCCAGCCACTCTGG - Intergenic
1030440557 7:109583805-109583827 AGATAGGGCTTCAGCCAGTGTGG + Intergenic
1031396467 7:121280248-121280270 ACATAGATATTCAGCCACTTGGG + Intronic
1036774717 8:11602782-11602804 ACAAAGCAGTTCAGCCACTGTGG - Intergenic
1037587593 8:20288676-20288698 ACATGGCTCTCCCACCACTGGGG + Intronic
1038701795 8:29855792-29855814 CCATGCCTCTTCAGCCACTTAGG + Intergenic
1042066640 8:64884190-64884212 ACAAAATTCTTAAGCCACTGAGG - Intergenic
1045139024 8:99258461-99258483 ACATAGCTCTGGAGCCTATGGGG + Intronic
1047624630 8:126643897-126643919 ACACAGCAATTTAGCCACTGGGG - Intergenic
1049178574 8:141208672-141208694 AGCTAGCTCTTCAGCCACCAGGG + Intronic
1053421671 9:37983741-37983763 ACATGGCTTTGCAGCCACCGGGG + Intronic
1055909103 9:81327007-81327029 ACACAGCACCTCACCCACTGGGG - Intergenic
1056297165 9:85204808-85204830 CCATAGCTCTGGAGACACTGAGG + Intergenic
1059501068 9:114754746-114754768 CCATAGCTCCTCAGCTGCTGTGG - Intergenic
1060639674 9:125227990-125228012 ACAAAGCTCTTCATCCACGGAGG + Exonic
1061741322 9:132708479-132708501 ACATGGCCCTTCAGCACCTGGGG - Intergenic
1062384716 9:136304619-136304641 ACATGGCTCTGCAGTCCCTGAGG + Intronic
1062627414 9:137449557-137449579 CCGAAGCTCTGCAGCCACTGCGG - Intronic
1186456985 X:9717459-9717481 AGATTGCTCTGCAGCCAGTGAGG + Exonic
1189614474 X:42769309-42769331 ACTTTGCTTTTCAGCCTCTGAGG + Intergenic
1194748932 X:97662475-97662497 ACATTGCTCTTCAACCCCTTGGG + Intergenic
1196803323 X:119563008-119563030 TCATCGCACTTCAGCCACAGTGG - Intronic
1197685738 X:129437712-129437734 AAATAGCTCCTCAGGCACTCTGG - Intergenic
1199918349 X:152369459-152369481 ACACTCCACTTCAGCCACTGTGG + Intronic