ID: 1147628073

View in Genome Browser
Species Human (GRCh38)
Location 17:41912750-41912772
Sequence ATTTGTGCCCAGATGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 165}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147628071_1147628073 -7 Left 1147628071 17:41912734-41912756 CCAGGTATCTAGAGGCATTTGTG 0: 1
1: 0
2: 1
3: 6
4: 102
Right 1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 165
1147628067_1147628073 19 Left 1147628067 17:41912708-41912730 CCTAGCCAATATCTTGCTTTTGA 0: 1
1: 1
2: 11
3: 87
4: 732
Right 1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 165
1147628064_1147628073 27 Left 1147628064 17:41912700-41912722 CCACCTACCCTAGCCAATATCTT 0: 1
1: 0
2: 0
3: 15
4: 203
Right 1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 165
1147628065_1147628073 24 Left 1147628065 17:41912703-41912725 CCTACCCTAGCCAATATCTTGCT 0: 1
1: 0
2: 2
3: 24
4: 172
Right 1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 165
1147628063_1147628073 30 Left 1147628063 17:41912697-41912719 CCTCCACCTACCCTAGCCAATAT 0: 1
1: 0
2: 0
3: 13
4: 332
Right 1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 165
1147628066_1147628073 20 Left 1147628066 17:41912707-41912729 CCCTAGCCAATATCTTGCTTTTG 0: 1
1: 0
2: 1
3: 31
4: 395
Right 1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 165
1147628068_1147628073 14 Left 1147628068 17:41912713-41912735 CCAATATCTTGCTTTTGACAACC 0: 1
1: 0
2: 0
3: 18
4: 186
Right 1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147628073 Original CRISPR ATTTGTGCCCAGATGGAGCC TGG Intronic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
902453530 1:16514700-16514722 TTCGGTGGCCAGATGGAGCCGGG + Intergenic
902473585 1:16667362-16667384 TTCGGTGGCCAGATGGAGCCGGG + Intergenic
902485218 1:16740080-16740102 TTCGGTGGCCAGATGGAGCCGGG - Intergenic
902498952 1:16895544-16895566 TTCGGTGGCCAGATGGAGCCGGG - Intronic
904208591 1:28871193-28871215 CTTGGTACCAAGATGGAGCCTGG - Intergenic
908748177 1:67395664-67395686 CTTTGTGGCCAGTTGGAGCAGGG - Exonic
911955393 1:104227735-104227757 ATTTCTGCCCATTTGAAGCCAGG + Intergenic
914517841 1:148389053-148389075 TTCGGTGGCCAGATGGAGCCTGG + Intergenic
917218123 1:172699068-172699090 ATCTGTGCCCAGATGGGGGAAGG + Intergenic
918745038 1:188187895-188187917 ATGTGTGTCCAGATGGACTCAGG + Intergenic
924147665 1:241093673-241093695 ATTAGTGCTGAGATGGAACCAGG - Intronic
1063064107 10:2591302-2591324 AGTTGTGCCCTGATGGGGGCAGG - Intergenic
1064951339 10:20854422-20854444 AATAGTCCCCAGAGGGAGCCTGG + Intronic
1069573271 10:69507196-69507218 ATCTGTGCCCACCTGGGGCCTGG + Exonic
1070699316 10:78588182-78588204 TTTGGAGCCCAGAGGGAGCCAGG + Intergenic
1070915109 10:80148495-80148517 CTTTGGGCCCAGCTGGGGCCTGG + Intergenic
1072533995 10:96345946-96345968 GCTTGTGCCCAGACTGAGCCTGG - Exonic
1072610507 10:97014449-97014471 CTTTGTGCCAAGGAGGAGCCAGG - Intronic
1073809476 10:107136907-107136929 ATTTGTTCCCAGATAGAGTTAGG - Intronic
1074289356 10:112126863-112126885 CTCTGTGCCCAGATGGACTCGGG - Intergenic
1075172392 10:120127829-120127851 ATTTTTCCCCTGCTGGAGCCAGG - Intergenic
1076508932 10:130998622-130998644 AGTGTTGCCCAGATTGAGCCGGG - Intergenic
1076697946 10:132256104-132256126 ATCGCTGCCAAGATGGAGCCTGG - Intronic
1078170680 11:8926895-8926917 ATCAGTGCCCAGAAGGAGCCAGG - Intronic
1079454734 11:20626569-20626591 AGTTGTCCCCAAATGCAGCCAGG - Intronic
1079495447 11:21038149-21038171 CTTTGTGCCCTGATGCAGCTGGG - Intronic
1079961621 11:26931319-26931341 ATTTGTGGGCAGATAGAGCTGGG + Intergenic
1082934354 11:58640862-58640884 ATGTGTGCACACATGGACCCAGG + Intronic
1085032432 11:73280925-73280947 TTCTGTGGCCAGATGGACCCTGG - Intronic
1088481165 11:110297048-110297070 AATTCTTCCCAGAGGGAGCCGGG + Intergenic
1088777667 11:113101031-113101053 CCTTGTCCCCAGAAGGAGCCTGG + Intronic
1088828214 11:113513570-113513592 ACTTGTGCCCATTTGGGGCCAGG + Intergenic
1089644259 11:119868010-119868032 GTTTCTGGCCAGATGGAGGCAGG + Intergenic
1091569319 12:1670632-1670654 ATGTGTTCCCAGATGGTGCCTGG + Intergenic
1092655576 12:10680908-10680930 ATATGTGCCAAGATGGAGTGGGG - Intergenic
1092661365 12:10741776-10741798 ATTTGTTCCCAGAGGGAGGGTGG - Intergenic
1096676576 12:53229628-53229650 AGTTAAGCCCTGATGGAGCCAGG + Intronic
1098914589 12:76244051-76244073 ACCTGTGCCCAGCTGCAGCCTGG + Intergenic
1101844059 12:108347336-108347358 AGCTGTGCTCAGATGAAGCCTGG - Intergenic
1102033811 12:109759735-109759757 GTTTGAGCCCAGATGCTGCCTGG + Intronic
1107602542 13:42028365-42028387 TTTTTAGCCCAGAAGGAGCCTGG - Intergenic
1107863308 13:44681645-44681667 GTCTGTGCCCACGTGGAGCCAGG + Intergenic
1108067445 13:46592770-46592792 AGTTTTGCCCAGAAGCAGCCAGG - Intronic
1108579676 13:51817900-51817922 ATTTGTGGCCAGTTAGAGTCGGG - Intergenic
1113919897 13:113901374-113901396 ATTTCTGCCTTGTTGGAGCCTGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1115380275 14:32729234-32729256 AATTCTGCCCAAATGGAGACTGG - Intronic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1116139229 14:40968434-40968456 CTTTGTCCCCAGATAGAGGCGGG + Intergenic
1116163729 14:41306289-41306311 ATTTGGGTCCAGCTGGAGCTGGG - Intergenic
1119788305 14:77328672-77328694 AGGGGTGCCAAGATGGAGCCAGG + Intronic
1120958764 14:90105727-90105749 ATTTGTGTCCAAAGAGAGCCAGG + Intronic
1121733845 14:96204726-96204748 ACTCCTGCCCAGCTGGAGCCAGG - Intronic
1130273479 15:82464461-82464483 GTTGGTGCCCAGGTGGAGCTCGG - Intergenic
1130465830 15:84191832-84191854 GTTGGTGCCCAGGTGGAGCTCGG - Intergenic
1130498435 15:84481704-84481726 GTTGGTGCCCAGGTGGAGCTCGG + Intergenic
1130588119 15:85196428-85196450 GTTGGTGCCCAGGTGGAGCTCGG - Intergenic
1130651325 15:85763706-85763728 AGTTGGGCCCAGCTGGAGGCAGG + Intronic
1131060213 15:89399904-89399926 TTCTGCGCCCAGAGGGAGCCAGG - Intergenic
1132295935 15:100734503-100734525 ATCTGTGCCCATGTGGAGCTAGG - Intergenic
1133483725 16:6197475-6197497 AATTGTGCTCAGGTGGAGCAGGG - Intronic
1133921133 16:10154192-10154214 TTGTGGGCCCAGATGGAGCATGG - Intronic
1134827548 16:17296640-17296662 ATTTGTCCCCAGTTGGCCCCGGG - Intronic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1138203257 16:55105657-55105679 ACATGTGCCCAGAGGGAGCCAGG + Intergenic
1138234869 16:55373781-55373803 AGTTGATCCCAGAAGGAGCCAGG + Intergenic
1138648012 16:58439195-58439217 TTTTGTGGCCAGATGGAGACAGG - Intergenic
1139939753 16:70596650-70596672 ATTTGTGCCCAGTTGCAGTGGGG + Intronic
1140416666 16:74778577-74778599 ATTTGTGCCCTTCTGGGGCCAGG + Intergenic
1140474860 16:75234801-75234823 ATTTGTTCTCAGCTGGGGCCTGG - Intronic
1140538456 16:75733007-75733029 AGTTCTGGCCAGATGGTGCCAGG + Intronic
1140910143 16:79443594-79443616 ATTTGTTCCTAGATGGAGAATGG - Intergenic
1142979439 17:3663237-3663259 AGCTTTGCCCAGATGAAGCCAGG - Exonic
1144389211 17:14778109-14778131 TTTTATGCCCAGATGGAAACAGG + Intergenic
1146896323 17:36544780-36544802 ATTTGCGCCCAGAGGGTGCGGGG - Intergenic
1147628073 17:41912750-41912772 ATTTGTGCCCAGATGGAGCCTGG + Intronic
1149463561 17:56854990-56855012 TTTTGTGCCCATCTGGTGCCAGG + Intronic
1149535606 17:57431256-57431278 TTTTGTGCTCAGGAGGAGCCTGG - Intronic
1150340411 17:64362185-64362207 TTTTAGGCCCAGATGGGGCCAGG - Intronic
1150812020 17:68364035-68364057 AAGTGTCCCCAGATGGTGCCTGG - Intronic
1151430872 17:74061857-74061879 CTCTGTGCCCAGGTGGAGGCTGG + Intergenic
1152086799 17:78224873-78224895 GTTTCTGCCCGGAAGGAGCCCGG - Exonic
1155944240 18:31829651-31829673 ATTAGTGCCGAGATTGAGACTGG + Exonic
1158052170 18:53235280-53235302 ATTTGTGCCCACATCCAGCAGGG - Intronic
1161424298 19:4194172-4194194 TTTTGTTCCGAGATGGAGTCTGG + Intronic
1161569116 19:5020584-5020606 CTTGGTGCCCAGAGGAAGCCAGG + Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1163716962 19:18878478-18878500 GTCTCGGCCCAGATGGAGCCTGG + Exonic
1163987827 19:20969760-20969782 ATTTGTGCTGGTATGGAGCCAGG - Intergenic
1164939505 19:32241646-32241668 AATTGTGCCGAGAGGGAGCTTGG - Intergenic
1165433659 19:35785513-35785535 ACCTGTGCCCATGTGGAGCCGGG + Intronic
1168358149 19:55715129-55715151 ATTTGAGCCCAGATCGAGGAGGG + Exonic
1202705776 1_KI270713v1_random:22438-22460 TTCGGTGGCCAGATGGAGCCGGG + Intergenic
926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG + Intronic
932392679 2:71411007-71411029 TTTTTTGTCGAGATGGAGCCTGG + Intronic
933887254 2:86730078-86730100 GTTGGTGCACAGATGGAGTCTGG + Intronic
933922921 2:87066635-87066657 GTTGGTGCACAGATGGAGTCTGG - Intergenic
935570346 2:104653745-104653767 ATATGTGGCCAGAAGGAGCAGGG - Intergenic
937435937 2:121881338-121881360 ATGTGTGCCCAGAGGGTGCCAGG + Intergenic
940865877 2:158817477-158817499 ATTTGGGGCTAGATGGAGGCAGG + Intronic
941352794 2:164456798-164456820 CATTGTGCCCAGATGCAGCCTGG + Intergenic
942119479 2:172762586-172762608 ATTTGTCCCCAGTTAGAGGCAGG + Intronic
942376110 2:175339647-175339669 ATTTTTCCCCTGCTGGAGCCAGG - Intergenic
943916611 2:193643575-193643597 AGCTGTGCTCAGATGGAGCCAGG + Intergenic
944313557 2:198261852-198261874 GTTTGTACCCAGATGGAGAGAGG + Intronic
946403139 2:219479291-219479313 ATCTGTGCCCACAGGAAGCCAGG + Intronic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947497982 2:230652588-230652610 CTATGTGCTCAGATGGGGCCTGG - Intergenic
1171528357 20:25834019-25834041 AGTTTTGCAAAGATGGAGCCTGG + Intronic
1171548469 20:26021859-26021881 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1174671356 20:52310796-52310818 ACTTGTGCTCAGAAGGACCCCGG - Intergenic
1174684306 20:52438779-52438801 ATTTGTGCCCAGAAACAGCAAGG + Intergenic
1175725970 20:61318608-61318630 GTTCGTGCCCAGGAGGAGCCTGG + Intronic
1178908304 21:36654081-36654103 CTGTGTGCCCACATGGACCCAGG - Intergenic
1184050096 22:41997955-41997977 AGTTGTGTCCAGGTGGAGACAGG - Exonic
1184159137 22:42687691-42687713 ATTTCTGGCCAGCTGGATCCTGG - Intergenic
950138784 3:10601224-10601246 ATTGGTGCCCAGCGTGAGCCAGG + Intronic
950660809 3:14465905-14465927 TTTTGTGCTTAGATGGTGCCTGG + Intronic
954458931 3:50615288-50615310 ATTTATGCCCAGCTGGACCCAGG - Intronic
961155576 3:124676734-124676756 AGTTGTTCTCAGAAGGAGCCAGG + Intronic
961778453 3:129306940-129306962 AGGTGTGGCCAGGTGGAGCCAGG + Intergenic
964145261 3:153453188-153453210 ATTTGTGTCCAGATAGAGATAGG - Intergenic
966549291 3:181186124-181186146 ATTTGTTCCCAAATGGGGACAGG + Intergenic
974102680 4:57435326-57435348 AATTGAGCTCAGATGAAGCCAGG + Intergenic
974144810 4:57934076-57934098 ATTTGTCCCCAGGTGGAGCAAGG - Intergenic
976910788 4:90303196-90303218 ATTTGTGCCCAGTGGAAGTCTGG + Intronic
979514787 4:121595255-121595277 ATTTCTGTCCAGTTGGAACCTGG + Intergenic
980004168 4:127522261-127522283 ATATTTGCCTAGAAGGAGCCAGG - Intergenic
982132256 4:152240239-152240261 ATTTGTTCCCAGAATGAGTCGGG - Intergenic
987070920 5:14336220-14336242 ATTTTTGCCAAGGTGGAGTCAGG - Intronic
987155128 5:15081552-15081574 ATTTGCACCCAGAAGGAGCCTGG - Intergenic
987394876 5:17413516-17413538 CTATGTTCCAAGATGGAGCCAGG - Intergenic
989092030 5:37743569-37743591 ATTTTTCCCCTGCTGGAGCCAGG + Intronic
990550907 5:56877404-56877426 ATTTCTGCCTCCATGGAGCCTGG - Intronic
993253414 5:85556682-85556704 ATTTTTCCCCTGTTGGAGCCAGG + Intergenic
995875475 5:116784723-116784745 ATTTGTGCAAAGTTGGGGCCAGG + Intergenic
996395220 5:123006723-123006745 GTCTGTGGCCAGAGGGAGCCTGG - Intronic
997208730 5:132065531-132065553 CTGTGTGTCCAGATGGCGCCAGG + Intergenic
998407828 5:141883778-141883800 AATTGTGCCCAGATAGGGCAGGG - Intergenic
998499372 5:142618826-142618848 ATTTGTGCCCAGCTTGGCCCTGG + Intronic
1001689962 5:173625626-173625648 ATTTATTTCCAGAGGGAGCCTGG + Intergenic
1003042426 6:2700469-2700491 ATCTGTGACCAGAGGGAGCCTGG - Intronic
1007670314 6:43547188-43547210 ACTTGTGCCATAATGGAGCCAGG + Intronic
1012004305 6:93693435-93693457 ATTTGTTCCCTGATGAAACCAGG - Intergenic
1013810700 6:114041450-114041472 AATTTTGCCCATATTGAGCCTGG + Intergenic
1015135767 6:129868222-129868244 ATTTTTCCCCAGTTGGAGCCTGG - Intergenic
1017184534 6:151587786-151587808 ATTAGTGCCATGATGGAGACAGG + Intronic
1018222073 6:161591155-161591177 ATATGTACACAGATGGAGACAGG + Intronic
1018647499 6:165961850-165961872 GGTTGTGCCCAGATGGAGGGTGG - Intronic
1019732601 7:2636174-2636196 CCTTGTGCCCAGTTGCAGCCTGG + Intronic
1028230405 7:88300815-88300837 ATTTATGCTCAGATTCAGCCAGG - Intronic
1032107559 7:129046918-129046940 ATTTGTGGCAAGGTGGGGCCAGG - Intronic
1036561079 8:9901000-9901022 ATTTGAGCACAGAAGGGGCCTGG + Intergenic
1036802402 8:11802477-11802499 ATTGGTGCCCTGATGGAGCCGGG - Exonic
1037613095 8:20492993-20493015 ATTGGTGTTCAGATGGAGCATGG - Intergenic
1040835059 8:51722752-51722774 GTTTGTCCCCTCATGGAGCCTGG + Intronic
1040991675 8:53358150-53358172 ATTTTTGTACAGGTGGAGCCTGG + Intergenic
1041195977 8:55401668-55401690 CTTTGGCCCCAGATGGACCCAGG - Intronic
1041836214 8:62219037-62219059 AATTGTGCCCATATGGAACTTGG + Intergenic
1047287277 8:123498387-123498409 ATTTTTGGCCAAATGGAGCAGGG + Exonic
1048005728 8:130417985-130418007 TTATGTGCCCAGATGGACACGGG + Intronic
1048911472 8:139139460-139139482 ATGTGTCCCCAGAGGGACCCTGG - Intergenic
1049061391 8:140278753-140278775 GCGGGTGCCCAGATGGAGCCTGG - Intronic
1050797543 9:9562896-9562918 ATGTCTGCCCACATGGAGCTTGG - Intronic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1052990299 9:34515043-34515065 ATTTTTCCTTAGATGGAGCCGGG - Intronic
1054148858 9:61584710-61584732 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054184729 9:61942222-61942244 AGTTTTGCAAAGATGGAGCCTGG + Intergenic
1054468621 9:65515819-65515841 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1054653778 9:67646275-67646297 AGTTTTGCAAAGATGGAGCCTGG - Intergenic
1057572928 9:96218073-96218095 TTTTTTGCCCAGATGCAACCAGG - Intergenic
1057718777 9:97516274-97516296 CTGTGTTCCCAGATTGAGCCGGG - Intronic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1060845347 9:126832498-126832520 ATTTGTGATGAAATGGAGCCTGG + Exonic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1188043799 X:25402347-25402369 TGTTGGGCCAAGATGGAGCCTGG + Intergenic
1199942210 X:152637885-152637907 ATCTGTGCCCAGTCGCAGCCAGG + Intergenic
1202369408 Y:24186883-24186905 GTTGGTGCCCAGGTGGAGCTCGG + Intergenic
1202501377 Y:25483234-25483256 GTTGGTGCCCAGGTGGAGCTCGG - Intergenic