ID: 1147629150

View in Genome Browser
Species Human (GRCh38)
Location 17:41918879-41918901
Sequence CCGCGCACGGACTTCGGCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 29}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147629150_1147629158 16 Left 1147629150 17:41918879-41918901 CCTCTGCCGAAGTCCGTGCGCGG 0: 1
1: 0
2: 1
3: 3
4: 29
Right 1147629158 17:41918918-41918940 CCGACGAACCCCGCAAAATCCGG 0: 1
1: 0
2: 0
3: 0
4: 10
1147629150_1147629154 -8 Left 1147629150 17:41918879-41918901 CCTCTGCCGAAGTCCGTGCGCGG 0: 1
1: 0
2: 1
3: 3
4: 29
Right 1147629154 17:41918894-41918916 GTGCGCGGCGCTTCTTCCACAGG 0: 1
1: 0
2: 1
3: 5
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147629150 Original CRISPR CCGCGCACGGACTTCGGCAG AGG (reversed) Exonic
901018982 1:6246388-6246410 CTGCGCACGGACTTCGGTGGTGG + Intergenic
905275974 1:36818558-36818580 CAGGGCAGGGACTTGGGCAGAGG - Intronic
905804538 1:40866197-40866219 CCTTGCAAGGACTTTGGCAGAGG + Intergenic
922811119 1:228416289-228416311 CCGGGCAGGGACAGCGGCAGCGG + Intronic
1065533653 10:26697818-26697840 CTGCGCGCGGACTTCGGCAGCGG - Exonic
1076864666 10:133160786-133160808 CCGCGCACCAACTTCTGCAGGGG - Intronic
1078091678 11:8268204-8268226 CAGCGCCCGGGCTTCGGCGGCGG - Intronic
1084787050 11:71448517-71448539 CCGCGCCCGCCATTCGGCAGCGG + Intronic
1090985208 11:131760606-131760628 CCACGCACTGACGTTGGCAGCGG + Intronic
1113656918 13:112073114-112073136 CCGCGCGCGGGCCTCGGCGGGGG - Intergenic
1125134705 15:36328381-36328403 CCGAGCAAGGCCTTAGGCAGAGG - Intergenic
1132325257 15:100963613-100963635 CCGAGCCAGGACTTCTGCAGAGG - Intronic
1133113456 16:3563248-3563270 CCGTGCACAGACTGCGGCATCGG + Exonic
1141839804 16:86567284-86567306 TCGCGCACGGACTGCGGCCGGGG - Exonic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1147629150 17:41918879-41918901 CCGCGCACGGACTTCGGCAGAGG - Exonic
1153963224 18:10157843-10157865 CCGCCCTCTGACTTCTGCAGAGG - Intergenic
1158507218 18:58057459-58057481 CCCTGGACGGACTTCAGCAGAGG - Intronic
1161333817 19:3700393-3700415 CCGCGCGCGGACGGCGGCGGGGG + Exonic
1162706765 19:12560893-12560915 CCGCGCCCGGCCTTCTGTAGGGG + Intronic
930021547 2:47004794-47004816 CAGGGCAGGGACTTAGGCAGAGG - Intronic
934636292 2:95992379-95992401 CCGGGCATGGGCTTCGGCCGGGG - Intergenic
934836054 2:97590392-97590414 CCGGGCATGGGCTTCGGCCGGGG - Intergenic
1172143935 20:32743342-32743364 CCGCCCACGGCCTCCGGCACCGG + Exonic
966378689 3:179322875-179322897 CGGCGCAAGGCCTCCGGCAGGGG + Intergenic
985894853 5:2742953-2742975 ACGCGCACGGGCTTCGGAGGTGG + Intergenic
1013366339 6:109440872-109440894 GGGCGCCCGGATTTCGGCAGCGG + Exonic
1019588529 7:1817349-1817371 CCACGCACAGACCTCGGCACGGG + Intronic
1022238023 7:28481074-28481096 CCTCTCACGTACTTCTGCAGAGG - Intronic
1056406814 9:86282690-86282712 TTGCGCACGGTCTCCGGCAGTGG + Intergenic
1062294745 9:135818452-135818474 CGGTGCACCGACTTCGGCCGCGG + Exonic
1186946409 X:14573247-14573269 CCCCACACGGACTTCTGAAGAGG + Intronic
1196717240 X:118823699-118823721 CCCCGCACAGCCTTGGGCAGAGG - Intergenic
1197759131 X:130015411-130015433 CCGTGCACGGACTTCCTGAGGGG + Exonic