ID: 1147637764

View in Genome Browser
Species Human (GRCh38)
Location 17:41974376-41974398
Sequence GTGGTGGCTCTGAGAAGGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 371}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147637758_1147637764 -4 Left 1147637758 17:41974357-41974379 CCATGGTCACAGAGAACTAGTGG 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1147637764 17:41974376-41974398 GTGGTGGCTCTGAGAAGGGGAGG 0: 1
1: 0
2: 1
3: 50
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147637764 Original CRISPR GTGGTGGCTCTGAGAAGGGG AGG Exonic
900385667 1:2409499-2409521 GTGGTGGTACAGAGCAGGGGCGG - Intronic
900476903 1:2880250-2880272 GTGGAGGCTCAGGGAGGGGGCGG + Intergenic
900609000 1:3536557-3536579 GTGGCGGCACTGAGTAGGGGAGG - Intronic
901017838 1:6242039-6242061 GTGGTGGCCCTGGGAACGGCGGG + Intergenic
901052526 1:6432446-6432468 GTGGAGGCTCTGGGAAAGGAAGG + Intronic
901441837 1:9282755-9282777 GAGGTGGCTCAGTGAGGGGGCGG - Intergenic
901727391 1:11252829-11252851 GTGGTGGCTTTGACTAGGAGTGG - Intronic
902254986 1:15182710-15182732 CTGGTGGCTGTGAGGAGGGAAGG + Intronic
902481717 1:16715590-16715612 GTGGAGGCTCTGGGAAAGGAAGG - Intergenic
903332501 1:22603171-22603193 GTGCTGGCTATGGGGAGGGGGGG - Exonic
903365358 1:22802472-22802494 CTGGTGGCCCTGCCAAGGGGTGG - Intronic
904211637 1:28889711-28889733 GTGGTGGGAGTGAGGAGGGGAGG + Intronic
904454737 1:30640767-30640789 TTGGTGTCTCTGAGCAGGGCAGG + Intergenic
905203030 1:36326625-36326647 GTGGTGGCTCAGTGTAGGGTGGG + Intronic
905253383 1:36664567-36664589 CTGGTGGCTTTGAGGAGGGAGGG + Intergenic
905435048 1:37950181-37950203 GTGGGGAATCTGAGAGGGGGTGG + Intergenic
905717506 1:40165210-40165232 GTGATGGGACTGACAAGGGGAGG - Intronic
905912494 1:41663661-41663683 GTAGTGCCTCTTAGAAGGTGGGG - Intronic
906560758 1:46755172-46755194 GTGGGGGCTCTCAGGAGGGAGGG + Intergenic
906582880 1:46950829-46950851 GAGGTGATTCTGAGAAAGGGAGG + Intergenic
906963280 1:50432377-50432399 GTGGAGGCCCTGAGAAGAGATGG - Intergenic
906964647 1:50444349-50444371 GAGGGGGCACTGAGAAGTGGTGG + Intronic
907457066 1:54582706-54582728 GTGAGGGCTCAGAGAAGTGGCGG + Intronic
907526458 1:55056759-55056781 GTGGTGGGTCAGAGGAGGGACGG - Intronic
908782186 1:67700721-67700743 GTGCTGGCTCTCAGAAGCAGGGG + Intergenic
909074677 1:71039136-71039158 TCGATGGCCCTGAGAAGGGGAGG - Intronic
910158214 1:84244539-84244561 GTGTTGGCTCTGAGAGGAGGAGG + Intergenic
912749005 1:112270003-112270025 GTGGTGGCTGTTAGCAGGGAGGG + Intergenic
913058964 1:115187416-115187438 GTGGTGGCCCAGAGAGGTGGTGG - Intergenic
913568824 1:120100328-120100350 TTGGTGGGTCTGGGAAGGGAAGG + Intergenic
914197994 1:145460073-145460095 AGGGTCGCTCTGAGAGGGGGTGG - Intergenic
914289642 1:146261349-146261371 TTGGTGGGTCTGGGAAGGGAAGG + Intergenic
914477096 1:148033205-148033227 AGGGTCGCTCTGAGAGGGGGTGG - Intergenic
914503083 1:148264756-148264778 CAGGTCGCCCTGAGAAGGGGTGG + Intergenic
914550678 1:148712102-148712124 TTGGTGGGTCTGGGAAGGGAAGG + Intergenic
915109595 1:153554561-153554583 GAGATGGCTGTGGGAAGGGGAGG + Intergenic
915558595 1:156673922-156673944 CTGGAGGGTCTGAGAAGGAGAGG + Intronic
915670735 1:157486652-157486674 GAGGTGTCTGTCAGAAGGGGAGG - Intergenic
916295685 1:163216782-163216804 GTGATGGCCCTGAGAAAGGGTGG + Intronic
917137960 1:171805865-171805887 GTGATGGCTCTGAGGAGTGAAGG + Intronic
917517683 1:175721815-175721837 CTGGTGGATCTGAGAATTGGGGG - Intronic
917533331 1:175856210-175856232 GTAGTGGCTCTGAGGAGGAGGGG + Intergenic
917748972 1:178037644-178037666 GTGGTGGCGGGGAGAAGGGGAGG + Intergenic
918632524 1:186735088-186735110 GTTGTGTCTCTGGGAAAGGGAGG + Intergenic
919187020 1:194164331-194164353 GGGGGGGCTTTGAGAAAGGGAGG + Intergenic
919781482 1:201224155-201224177 GTGGTGACCCTGAGCAGGGTGGG - Intronic
919914975 1:202133663-202133685 GTGGGGGCCCTGGGGAGGGGCGG + Exonic
920347122 1:205313644-205313666 CCCGAGGCTCTGAGAAGGGGTGG - Intronic
920698061 1:208196790-208196812 GTGTTGTCCCTGAGAATGGGTGG + Intronic
920832448 1:209477914-209477936 ATGCTGGCTCAGAGAAGGGCTGG + Intergenic
921010091 1:211133295-211133317 GTGGTGGGTGGGTGAAGGGGTGG + Intronic
921404548 1:214764833-214764855 GTGGTTGCTCTGGGCAGGGAAGG + Intergenic
923340143 1:233000074-233000096 GTGCTGGCTCTGTGAGGTGGAGG + Intronic
1062825768 10:567474-567496 GTTGTGGCTGGGAGCAGGGGTGG - Intronic
1063478514 10:6349820-6349842 GGTGTGGCTCTGGGAAGTGGAGG + Intergenic
1064123306 10:12638067-12638089 GAGGGGCCTCAGAGAAGGGGAGG + Intronic
1064581398 10:16796527-16796549 GTGGGAGCTCTGATAAGAGGGGG - Intronic
1064761232 10:18623477-18623499 GTGGAGTCTCTGAAAAGGAGAGG + Intronic
1064851527 10:19714237-19714259 GTGGTAGCTCTCAGAAGACGGGG + Intronic
1065045104 10:21740165-21740187 GTGGTAGCTGTGTGAAGTGGGGG - Exonic
1065141908 10:22726148-22726170 GTGGTGCCTTTTAGAAGGGGAGG - Intergenic
1065216753 10:23456501-23456523 TTGGGGCCTCTGAGCAGGGGAGG + Intergenic
1065637334 10:27745118-27745140 GGGGTGGCTCGGAGAAGGCCGGG - Intronic
1065646924 10:27844813-27844835 CTTGTAGCTCTAAGAAGGGGAGG + Intronic
1066411292 10:35171983-35172005 GTGGTGGGTGGGAGAAGTGGTGG + Intronic
1069984435 10:72273854-72273876 GTCGTGGCGCAGAGAAGGCGTGG + Intergenic
1069997035 10:72348710-72348732 GGGGTTGCTCTGAGTAAGGGAGG + Intronic
1070737297 10:78871996-78872018 GTAGTGGCCCTGGGAAGGGGTGG - Intergenic
1071505706 10:86230210-86230232 GTGGTGGTTCTGGGATGGGGCGG - Intronic
1073805076 10:107088589-107088611 GAGCTGGCTCTGAGAAAAGGTGG - Intronic
1074168992 10:110914325-110914347 GTGGGGGTTCTGAGAGGGGGTGG + Intronic
1074377043 10:112949754-112949776 GTGGTGGCTGGGGGAGGGGGTGG - Intergenic
1076733945 10:132450555-132450577 GGGGTGCCTCTGAGCACGGGAGG - Intergenic
1076842063 10:133050557-133050579 GCGGTGGCTCTGGGTGGGGGAGG + Intergenic
1077142070 11:1029142-1029164 CTGGGGGCTCTGCGAGGGGGCGG + Exonic
1077156138 11:1092557-1092579 GAGGTGGGTCTGAGCTGGGGGGG - Intergenic
1077353984 11:2106291-2106313 GTGGCGTCTCTGAGGAGTGGTGG - Intergenic
1077406634 11:2385348-2385370 GTGGTTGCCCTGGGACGGGGAGG - Intronic
1078011082 11:7573706-7573728 GTGGGCCCGCTGAGAAGGGGAGG - Intronic
1078101324 11:8332004-8332026 GTGGTGCCTCTGACAGGGAGAGG + Intergenic
1080035969 11:27711559-27711581 GTGGTAGCTATAAGATGGGGAGG + Intronic
1080460327 11:32449291-32449313 ATGGTTGCTGTGAGAAGTGGAGG - Intergenic
1080685736 11:34513445-34513467 GTGGTGGCTGTGAGGAGGGCTGG + Intronic
1081486187 11:43531290-43531312 GTGGTGGCACAAAGAAAGGGTGG - Intergenic
1082219039 11:49610345-49610367 GTGGGGGCACTGGGAAGGGGAGG - Intergenic
1083184151 11:61007840-61007862 GTGGCGGCTCTGCGAGGTGGTGG + Exonic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084069829 11:66727336-66727358 GTGGCTGCTCCGAGAGGGGGAGG + Intronic
1084288487 11:68146866-68146888 GTGGTGGCTTGAAGAAGTGGGGG - Intergenic
1084559110 11:69892813-69892835 GTCGTGGCTGTGCGTAGGGGAGG + Intergenic
1084768117 11:71325507-71325529 GAGGAGGCCCTGTGAAGGGGAGG + Intergenic
1085034462 11:73291815-73291837 GAGGAGGCTCAGAGAAGGGAAGG + Intronic
1085125410 11:73998746-73998768 GTGATGATTCTGAGAAAGGGAGG - Intergenic
1085169375 11:74435492-74435514 ATGCTGTCTCTGATAAGGGGAGG + Intergenic
1085216254 11:74835449-74835471 GTGGAGGCACAGGGAAGGGGAGG - Intronic
1085257611 11:75184850-75184872 GTGGTGGGTGTGAGTAGAGGGGG - Intronic
1086630610 11:89014529-89014551 GTGGGGGCTCTGGGAAGTGGAGG + Intronic
1086848298 11:91778931-91778953 GTTGTGGTTCAGAGCAGGGGAGG - Intergenic
1087097192 11:94330663-94330685 GTGGTGGGACTGGGGAGGGGTGG - Intergenic
1087705587 11:101487520-101487542 GTGGGGGCTCAGAAGAGGGGAGG - Intronic
1088805903 11:113351800-113351822 ATGGAGCCTCTGAGAAGGGAAGG + Intronic
1089215514 11:116832391-116832413 CTGGTGGCTCTGAGCAGGGTAGG - Intronic
1089309263 11:117547200-117547222 GTGGGGGCTCTGGGGAGGGTTGG - Intronic
1089701256 11:120245464-120245486 GTGCTGCCCCAGAGAAGGGGGGG + Intronic
1090387925 11:126367248-126367270 GTGGTGGCATGCAGAAGGGGAGG - Intronic
1090390564 11:126384694-126384716 GTGGTGGCATGCAGAAGGGGAGG - Intronic
1091303586 11:134523401-134523423 GTTCTGGCTCTGACACGGGGAGG + Intergenic
1091303898 11:134524398-134524420 AAGGTGGCTCTGAGAAGATGGGG - Intergenic
1096661664 12:53129064-53129086 AAGGTGGCTCTCAGCAGGGGAGG - Intergenic
1096799817 12:54102789-54102811 GTGGTGCCTCTGAAAGGGAGGGG + Intergenic
1097171551 12:57117112-57117134 GTGGTGGCTATGAGAGTGAGTGG + Intronic
1097264758 12:57738535-57738557 GTGGGGGCGCTGAGATGGGTGGG + Intronic
1098872793 12:75835547-75835569 ATGGTGGTTCTTAGATGGGGAGG + Intergenic
1103425991 12:120834386-120834408 GAGTGGGCTCTGAGTAGGGGTGG + Intronic
1104555782 12:129798739-129798761 GTTCTGGCTTAGAGAAGGGGTGG + Intronic
1104914330 12:132257022-132257044 GTGGTGGCTATGAGGAGCAGGGG + Intronic
1104993361 12:132639423-132639445 GTGGGGACAGTGAGAAGGGGAGG - Intronic
1106297490 13:28429881-28429903 GTGGTGGAGGTGAGAAGGGCTGG - Intronic
1109326095 13:60869742-60869764 GTGATTGCTCAGAGTAGGGGAGG + Intergenic
1110130431 13:72002109-72002131 GTGGTGACTCTGATAAAGGAGGG + Intergenic
1111030570 13:82592295-82592317 GTGCTGGCTGTGAGAGGTGGAGG - Intergenic
1111926167 13:94465042-94465064 ATGATGGCTCTGAGAAGGGGAGG - Intronic
1113966227 13:114155336-114155358 GTGGGGGCTATGAGGAGGGGTGG + Intergenic
1114618259 14:24079917-24079939 GTGGTGGTGGTGAGAGGGGGAGG + Intergenic
1114640596 14:24217143-24217165 GTGTTGGCTCTGAGAGGAGGAGG - Exonic
1114968816 14:28000820-28000842 GTTGTGGCTTGGAGGAGGGGTGG - Intergenic
1115298834 14:31860961-31860983 GTGGTGGCTGTGTTAAGGAGGGG + Exonic
1117647110 14:57865044-57865066 GGGGGGGGTCTGAGAAGGGGAGG - Intronic
1118375914 14:65176845-65176867 GTGGTGGCTGTGAGTTGGGATGG + Intergenic
1118609325 14:67527901-67527923 GTAGTGGCTTTGAGGAGGGGAGG + Intronic
1119485524 14:74984469-74984491 GGGGTGGCTCAGAGAGGGCGTGG + Intergenic
1119861460 14:77939130-77939152 GTGGTTGCTCTGGGCAGGGAGGG - Intergenic
1122446861 14:101775925-101775947 GGAGAGGCTCTGGGAAGGGGAGG + Intronic
1122552303 14:102556572-102556594 GTGGTGGTTCTGACCAGTGGAGG - Intergenic
1122724395 14:103740744-103740766 GTGGAGGCTCTAAGAGGGGGAGG - Intronic
1123627805 15:22239493-22239515 GTGGGTGCTGTGAGCAGGGGTGG - Intergenic
1124077800 15:26462252-26462274 GTGGTCACTCAGGGAAGGGGAGG - Intergenic
1124371813 15:29108398-29108420 GTGGTGGCCCAGAGCAGGAGGGG - Intronic
1125595067 15:40879740-40879762 GGGGTGTGTCTGAGAAGGTGTGG + Intergenic
1127981371 15:64037731-64037753 ATGGAGGCTCAGAGAAGGGAAGG - Intronic
1128092024 15:64925787-64925809 GTGGAGGCTCAGAGAGGTGGAGG + Intronic
1128576650 15:68780566-68780588 GTGGGGGCTCTGAGAGGCTGGGG - Intronic
1130416000 15:83695266-83695288 GTGGGGTCTTTGAGAAGGGGAGG + Intronic
1130650620 15:85760251-85760273 GGGTGGGCTCTGAGGAGGGGAGG + Exonic
1132404322 15:101533249-101533271 TAGGTGGCCCTGAGAAGAGGTGG + Intergenic
1132544055 16:524940-524962 GTGGTGGCCCAGAGAAAGGCGGG + Intergenic
1132646962 16:1003583-1003605 GTGGTGGTCCCGGGAAGGGGTGG + Intergenic
1133272429 16:4616726-4616748 GTGGGGGCTGTGAGAACGGCTGG + Intronic
1133819494 16:9223934-9223956 GTGTTGGCCCTGAGATGGAGAGG + Intergenic
1135398395 16:22148373-22148395 CTGTTGGCACTGAGAAGAGGGGG - Intronic
1135570767 16:23547763-23547785 GTGGTGGCTCTCACATGGGGTGG - Intronic
1137781030 16:51098036-51098058 GTGTTGGCAGTGAGCAGGGGAGG + Intergenic
1137971085 16:52985640-52985662 TAGGTGGCTCTGAGAAAGAGGGG - Intergenic
1140126087 16:72120083-72120105 GAGGTGGCTGTGGGAAGGAGAGG + Exonic
1140494892 16:75376829-75376851 GTCATTGCTCTGGGAAGGGGCGG - Intronic
1141995532 16:87634562-87634584 GTGGTGGCTCTGCGGCTGGGAGG - Intronic
1142010216 16:87710032-87710054 GTGCTGGCTCCCAGAAGGGCTGG + Intronic
1142587280 17:981160-981182 GTGGAAGCTCTGAGAGGGGCGGG - Intergenic
1142716044 17:1747520-1747542 GTGGGGGATCTGAGAGGAGGAGG - Intronic
1143325415 17:6095268-6095290 GTGGTGGTCCTGAGAGAGGGGGG + Intronic
1143327102 17:6106586-6106608 GTGGTTGCTCTGGGGAGGGAAGG + Intronic
1143374032 17:6457013-6457035 GTGGGGACTCTGAGAGGGTGTGG - Intronic
1143433962 17:6908947-6908969 GTGGCTGCTCAGGGAAGGGGTGG + Intronic
1143627529 17:8118971-8118993 GCGGGGGCTCTAAGAACGGGAGG + Exonic
1144316109 17:14063023-14063045 CTGGTGGGTCTGACAAGGAGGGG + Intergenic
1144773324 17:17771442-17771464 GCAGTGGCTCTGAGGATGGGAGG + Intronic
1147187855 17:38722268-38722290 GGGCTGGCTCTGGGAAGGGAGGG + Intronic
1147637764 17:41974376-41974398 GTGGTGGCTCTGAGAAGGGGAGG + Exonic
1147925518 17:43943138-43943160 ATGGGGGCTCTGAGATGGGGAGG - Intergenic
1148462186 17:47845216-47845238 TTGGTGGCACAGGGAAGGGGTGG + Exonic
1148554452 17:48570017-48570039 CTGGTGGGTTTGGGAAGGGGGGG - Intronic
1148677885 17:49455596-49455618 CTGGTAGCTCTGGGAAGGGCTGG + Intronic
1148681755 17:49478112-49478134 GTCGTGGGTGGGAGAAGGGGAGG - Intergenic
1151195258 17:72426541-72426563 GGGGTGACTCGGAGAAGGGAGGG + Intergenic
1151304414 17:73253862-73253884 GTGGGAGCTCTCAGCAGGGGAGG - Intronic
1151324111 17:73368378-73368400 GAGGGGGCCCTGAGGAGGGGAGG - Intronic
1151892165 17:76957217-76957239 GTGCTGCCTCTGAGATGAGGTGG + Intergenic
1151973031 17:77468814-77468836 GTGGTGGCTGTGAGATGTGTTGG + Intronic
1152092101 17:78252741-78252763 CAGGAGGCTCTGAGGAGGGGGGG - Intergenic
1153980276 18:10302873-10302895 GAGGGGGCTGGGAGAAGGGGAGG - Intergenic
1155774091 18:29737365-29737387 GTGGTGGCACTGGGCAGGGTTGG + Intergenic
1157244243 18:46039495-46039517 GTGGTGGCCCTCAGAGGGTGAGG - Intronic
1158254490 18:55530546-55530568 GAGGTGGCCCTGAAAAGGGGGGG + Intronic
1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG + Intergenic
1160083961 18:75756965-75756987 GGAGTAGCTCTGAGTAGGGGTGG - Intergenic
1160145586 18:76361484-76361506 GGGGTGGCTCAGGGAAGGGGCGG + Exonic
1160245360 18:77154788-77154810 GTGGGTGCTGTGAGATGGGGTGG + Intergenic
1160770663 19:829285-829307 GAGGAGGCTCAGAGAAGGGAAGG + Intronic
1160982473 19:1822704-1822726 GAGGGGGCTCTGGGGAGGGGAGG + Intronic
1161096816 19:2396779-2396801 GTGGAGGCTGTGAGACCGGGAGG + Intronic
1161478708 19:4500016-4500038 GGGGTGGCTCTGTGCAGCGGGGG + Intronic
1161824293 19:6551925-6551947 GTGGTCGCTCTGATGCGGGGTGG + Intergenic
1161847227 19:6718843-6718865 GTGGAGTCTCAGAGAAGGGGAGG + Intronic
1161847287 19:6719037-6719059 GTGGAGTCTCAGAGAAGGGAGGG + Intronic
1162802104 19:13116914-13116936 GTTGTGGCTCAGAAAAGGGGCGG + Exonic
1163104786 19:15116960-15116982 ATGGAGGCTCTGAGAAGGTGAGG + Intronic
1163548151 19:17951254-17951276 GTGGGGGTTCAGAGACGGGGCGG + Intergenic
1163672222 19:18636236-18636258 GCGGCGGATCTGAGGAGGGGCGG - Intergenic
1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG + Intronic
1165382233 19:35489616-35489638 GTGGTGTCACTGAGCTGGGGGGG - Intronic
1166070622 19:40385255-40385277 GATGTGGCTATGAGCAGGGGAGG - Intronic
1166251242 19:41572499-41572521 TTGGTGCCTCTGGGAAGAGGAGG - Intronic
1166338123 19:42121497-42121519 GTGGTGGCTGAGGGATGGGGTGG - Intronic
1166396031 19:42441780-42441802 GTGGTTGCTCTGTGCAGGGCTGG + Intronic
1166675426 19:44737958-44737980 GTTGTGGCCTTGAGTAGGGGAGG + Intergenic
1168344339 19:55643051-55643073 TTGGTGGCCCTGAGACGGGCAGG - Exonic
1168691447 19:58380050-58380072 TTGGTGGCTCTGAGGTGTGGAGG + Intronic
1202715756 1_KI270714v1_random:41502-41524 GTGGAGGCTCTGGGAAAGGAAGG - Intergenic
925130041 2:1488339-1488361 GTGGTGGGGAGGAGAAGGGGAGG - Intronic
925551341 2:5078838-5078860 ATGGTGGCTCTGACAAGAGGAGG - Intergenic
925611229 2:5705323-5705345 GAGGAGGAGCTGAGAAGGGGTGG + Intergenic
925611342 2:5705682-5705704 GTGGAGGAGCCGAGAAGGGGTGG + Intergenic
925611372 2:5705767-5705789 GTGGAGGACCTGAGAAGGGGTGG + Intergenic
925656571 2:6156205-6156227 GAGGTGGCTCTAAGAAGGAAGGG - Intergenic
925970759 2:9105117-9105139 GGGGTGGCTGTGAGAAGCGAAGG + Intergenic
926181357 2:10646713-10646735 GTGGTGGCCCTGAGCAAGGGAGG - Intronic
927875191 2:26650511-26650533 GTTGTGGCTTCAAGAAGGGGAGG + Intergenic
928112604 2:28522719-28522741 GTCGTGTTCCTGAGAAGGGGGGG - Intronic
928234229 2:29526036-29526058 GTGGTTACTCTGAGAAGGAGGGG + Intronic
928344291 2:30476435-30476457 GTGGCGGATCTGAGCAGAGGTGG - Intronic
928615600 2:33036222-33036244 TTGGTGGGTCTGGGGAGGGGTGG + Intronic
929077443 2:38090088-38090110 ATGGTTACTCTGGGAAGGGGTGG - Intronic
929382055 2:41365111-41365133 GTGGTTGCTCAGAGGAGGGGAGG - Intergenic
932447140 2:71787897-71787919 GTGGGGCCTCTGTGGAGGGGAGG - Intergenic
932772071 2:74506049-74506071 GTGCTGGCTCTGAGAAAGATAGG + Exonic
932823745 2:74922309-74922331 CTGGAAGCTCTGAGAAGGTGGGG - Intergenic
933728484 2:85439442-85439464 ATGGAGGCTCTGAGCAGGGGTGG + Intergenic
936034449 2:109099651-109099673 GCTGTGGCTCTTATAAGGGGTGG + Intergenic
938108526 2:128549378-128549400 GGGGTTGCTCTCAGGAGGGGAGG + Intergenic
938246491 2:129781268-129781290 GTCCTGGCTCTGAGGAGGAGGGG + Intergenic
938383114 2:130847762-130847784 GTGCTGGCTTAGAGAAGGTGAGG + Intronic
939041105 2:137190434-137190456 GAGGTGTCTCTGAGGAGGGTTGG + Intronic
939826976 2:147026680-147026702 GTGAAGGCTTTGAGTAGGGGAGG + Intergenic
940431759 2:153599870-153599892 GTGTCAGCTCTGAGAAGAGGGGG - Intergenic
943722725 2:191221774-191221796 GATGTGGCTCTAAGAATGGGTGG + Intergenic
945437013 2:209830814-209830836 GAGGTGGCTCTGAGGAAGAGGGG + Intronic
946095607 2:217271773-217271795 GTGAGGGCTCTGTGAGGGGGAGG + Intergenic
947821649 2:233075681-233075703 GTGGAGGCTCTGCCAAGCGGTGG - Intronic
948655433 2:239473915-239473937 GTGGTGGCAGTGAGAAGGAGAGG + Intergenic
948717094 2:239872003-239872025 GTGCAGGCTCTGAGTAGGGCTGG - Intergenic
1168875000 20:1165221-1165243 GTCTTGGCTCTGATAAGGGGTGG - Exonic
1169084327 20:2817208-2817230 CTGGGGGCTTTGAGAAGAGGGGG + Intronic
1169280945 20:4266490-4266512 ATGGTGGCTCTAAGAGGGAGAGG + Intergenic
1170211451 20:13849646-13849668 ATGGTGGCTCTGAGTGGAGGTGG - Intronic
1170328547 20:15183030-15183052 GTGGTGGAAATGAGAATGGGAGG - Intronic
1170389387 20:15855173-15855195 CTGGTGGCTCTGAAAAATGGAGG + Intronic
1170555713 20:17513235-17513257 TGGAGGGCTCTGAGAAGGGGAGG - Intronic
1170735016 20:19006916-19006938 GTGGTGGCTCTGAGTTGAGTGGG + Intergenic
1171053398 20:21882964-21882986 GTGGTAGCTCAGAGCAAGGGAGG + Intergenic
1171364744 20:24616272-24616294 GCTGTGGCTCTAAGAAGGTGAGG + Intronic
1171796622 20:29571558-29571580 GTGGTGCCTCTGAAAGGGAGGGG - Intergenic
1171851619 20:30312608-30312630 GTGGTGCCTCTGAAAGGGAGGGG + Intergenic
1172744936 20:37199606-37199628 GTGGAGGCTCTGCAAAGTGGGGG + Intronic
1172827736 20:37804755-37804777 GTCATGGCACTGAGAAGAGGAGG + Intronic
1172995769 20:39069450-39069472 GTGGTGGGACTGAGGTGGGGGGG + Intergenic
1173886664 20:46465181-46465203 GTGGTGACTGTGGGATGGGGTGG + Intergenic
1174254337 20:49243137-49243159 CAGGTGGCTCTGAGAGGGGTGGG - Intronic
1174295121 20:49540237-49540259 ATGGGGGCACAGAGAAGGGGAGG + Intronic
1174397841 20:50258978-50259000 GGGAGGGCTCTGAGCAGGGGTGG - Intergenic
1175940676 20:62536229-62536251 GGGCTGGCTCCGAGGAGGGGTGG + Intergenic
1175948863 20:62571834-62571856 GTGGGGCCTGTGAGAAGGCGGGG + Intergenic
1176035952 20:63036500-63036522 GGAGTGGCTCTGAGCCGGGGAGG + Intergenic
1176271686 20:64238710-64238732 CTGGGGACTCTGAGAAGGGGAGG - Intronic
1178291292 21:31370905-31370927 GTGCTGGGTCTGAGAGAGGGCGG - Intronic
1178579011 21:33821335-33821357 TTGCTGGCTTTGTGAAGGGGTGG + Intronic
1179171568 21:38976935-38976957 GTGGTGGGTCTGAGTTAGGGTGG + Intergenic
1179554891 21:42166187-42166209 GTGTTGGTTCTGAGAAGTGGAGG + Intergenic
1179612543 21:42561830-42561852 GCGGGGCCTCTGAGAAGGGTGGG - Intronic
1179709478 21:43204845-43204867 GGGGAGACACTGAGAAGGGGTGG - Intergenic
1180876249 22:19176555-19176577 GTGGTGGGGCCGGGAAGGGGAGG - Intronic
1181843714 22:25688336-25688358 GTCGTGGCTCTGTAAAGGGCTGG + Intronic
1181932075 22:26409854-26409876 GAGATGGCTCTGGCAAGGGGAGG - Intergenic
1182302162 22:29342987-29343009 CTGGTGGCGCTGTGACGGGGTGG - Intronic
1184009998 22:41740365-41740387 GTGGTCCCTCTGAGGTGGGGTGG + Intronic
1184375000 22:44106195-44106217 GAGGAGGCTCTGGGAAGAGGGGG + Intronic
1184549667 22:45197740-45197762 GAGCTGGCTGTGAGAAGGTGCGG + Intronic
950466880 3:13161036-13161058 ATGGGGGCTCTGAGAAAGGAAGG + Intergenic
950715195 3:14842841-14842863 GTGTTGGGTGTGAGAATGGGTGG + Intronic
952316762 3:32238665-32238687 GTGGAGGCCCGGAGGAGGGGAGG - Exonic
952853963 3:37752389-37752411 GTGGTGGCTGAGAGTGGGGGTGG - Intronic
953585832 3:44200201-44200223 GTGGTGGGTGTGGGATGGGGGGG - Intergenic
953604058 3:44397308-44397330 GTGGTTGCTTGGAGAGGGGGTGG - Intronic
954106819 3:48414013-48414035 GTGGTGGCTATGATAGGGGATGG - Exonic
954707782 3:52490206-52490228 GCAGTGGCTCTGAGAAGTAGCGG - Exonic
956219379 3:66885442-66885464 GTGGTGACTCTGAGCAGGATAGG - Intergenic
959669877 3:108964466-108964488 GTGGAGGGTCTGAAAAGGGAAGG - Intronic
962396406 3:135018502-135018524 GTGGGTGCTTTAAGAAGGGGTGG - Intronic
962741534 3:138365831-138365853 GCCGTGGCTCTGGGAATGGGGGG + Intronic
962853303 3:139323861-139323883 GTGATGACCCTGAGGAGGGGTGG - Intronic
964389557 3:156183272-156183294 GTGAGGGCTTTGAGAAGGGGTGG + Intronic
964874138 3:161347004-161347026 GTGGTGGGTTTGAGAGGAGGAGG + Intronic
965860764 3:173146938-173146960 GTTGTGGCTATGGGAAGGGTAGG - Intergenic
966781046 3:183584399-183584421 GCTGTGGCTCTGAGAAGAGGCGG + Intergenic
967352718 3:188531908-188531930 GTGGTGGGGCAGAGTAGGGGTGG - Intronic
967857703 3:194130866-194130888 GTGGGGGTGCTGGGAAGGGGGGG - Intergenic
968186125 3:196634559-196634581 GTGGGGGCTAGGAGAAGTGGAGG + Intergenic
968284838 3:197502417-197502439 CTGATGTCTCTGAGAAGGGGAGG + Intergenic
968628195 4:1637476-1637498 GTGGATGCTCTGGGAAGGGTGGG + Intronic
968926404 4:3550867-3550889 GGGGTGGGTCTGGGCAGGGGTGG + Intergenic
969274600 4:6127071-6127093 TTGGTGGCTCCGAGCAGGGCAGG + Intronic
969280894 4:6170249-6170271 GTGGTGGTGGTGAGAAGGGTGGG - Intronic
969280914 4:6170336-6170358 GTGGTGGTGGTGAGAAGGGTGGG - Intronic
969359812 4:6656338-6656360 GTGCTGACTCTGAGATGTGGGGG - Intergenic
969448353 4:7258050-7258072 GTGGTGGCTTCCAGCAGGGGCGG + Intronic
970509925 4:16771752-16771774 CTGGAGGCACAGAGAAGGGGTGG - Intronic
971674197 4:29604047-29604069 GTGGTGACTCAGAGAAGGATTGG + Intergenic
974428550 4:61768784-61768806 GTAGAGGCACGGAGAAGGGGTGG + Intronic
975486438 4:74938504-74938526 GTGGTAATTCTGAGAAGAGGTGG + Intronic
977878675 4:102178987-102179009 GTGATGGCTCTGAGCAGGGTGGG - Intergenic
977895850 4:102364034-102364056 GTGGTGGGGAGGAGAAGGGGAGG + Intronic
978458744 4:108926389-108926411 GTGGTCCATCTGTGAAGGGGAGG + Intronic
978885555 4:113762314-113762336 CTGGTGGCTGTGGGAAGGGTTGG - Intergenic
979727599 4:123982824-123982846 GAGGTGGCTCTCAGCAGGGTGGG + Intergenic
983414866 4:167440315-167440337 GTAGAGACACTGAGAAGGGGTGG + Intergenic
984507475 4:180637956-180637978 GTGGTGGTTGTGGGGAGGGGAGG - Intergenic
985579550 5:689647-689669 GGGGTGGCTCTGGGAGGGGGTGG + Intronic
985594396 5:781706-781728 GGGGTGGCTCTGGGAGGGGGTGG + Intergenic
985731759 5:1553465-1553487 GTGGGGGCTCTAAGTAGTGGGGG - Intergenic
986905626 5:12491052-12491074 GTAGTGACACAGAGAAGGGGTGG - Intergenic
987303315 5:16616612-16616634 GTGGGGGCGCTGAGGAGGGCAGG - Intronic
989099110 5:37808313-37808335 GCGGTGGGTCTGAAAGGGGGGGG + Intergenic
989216348 5:38908151-38908173 GTGGTGGCACTGGGAAGGCAGGG - Intronic
990312053 5:54549480-54549502 CTGGTGGGTCTGAGAAGCAGTGG - Intergenic
991581889 5:68164244-68164266 GTGGTGGCTTTGGGAAGCTGAGG - Intergenic
991932382 5:71766431-71766453 GTGGTGGCTAGGAGAAGGCTGGG + Intergenic
991960455 5:72039108-72039130 GAGGTGACTCTGGGAGGGGGAGG - Intergenic
1000188050 5:158880165-158880187 CTGGGTGCTCTGAGAAAGGGAGG + Intronic
1000852876 5:166362107-166362129 GAGGTGGCTCTCAGCAGGGTGGG + Intergenic
1000998828 5:167985922-167985944 GTGGTAGCTTTGAGAAGCGGAGG - Intronic
1001073621 5:168607475-168607497 TTGGTGGCTAGGAGAAGAGGTGG + Intergenic
1001576176 5:172765407-172765429 GGGGTGCCTCTGAGAAGTGCTGG - Intergenic
1001764695 5:174236268-174236290 CTTGTGGGTCTGGGAAGGGGAGG + Intronic
1006129785 6:31862350-31862372 CTGGAGGCTCGGAGCAGGGGAGG + Intronic
1006409413 6:33863627-33863649 GTGGGTGCTCCGAGGAGGGGAGG - Intergenic
1006500667 6:34457005-34457027 CTCCTGGCTCTGAGAAGAGGGGG + Intergenic
1006638420 6:35476032-35476054 GGGGTGGGTCTGAGAAGGCGGGG + Exonic
1006671281 6:35731412-35731434 CTGGTGGCTCTGGGACGGGGTGG - Intergenic
1009894913 6:69736192-69736214 GTGGTGGGTCGGCGGAGGGGGGG - Intronic
1011354307 6:86458298-86458320 TTGGGGTCTCTGAGGAGGGGTGG - Intergenic
1011511973 6:88111512-88111534 AGGGTGGGTCTGAGAAGTGGTGG + Intergenic
1011585812 6:88924021-88924043 CTGGAGGCCCTGAGGAGGGGTGG + Intronic
1012699473 6:102435716-102435738 GTGCTGGCACAGACAAGGGGAGG + Intergenic
1015004543 6:128263149-128263171 GGGGTGCCTATGAGAAGAGGTGG + Intronic
1015332454 6:131996799-131996821 GTGAGGGCTCTGATAAGAGGAGG - Intergenic
1016995371 6:149958848-149958870 TTGCTGGCTCTGAGATGTGGGGG - Intergenic
1017003240 6:150010656-150010678 TTGCTGGCTCTGAGATGTGGGGG + Intergenic
1017012851 6:150074694-150074716 TTGCTGGCTCTGAGATGTGGGGG + Intergenic
1017442291 6:154475343-154475365 GTGCTGGATTGGAGAAGGGGAGG - Intronic
1018068724 6:160142333-160142355 CTGGTGGCTTTGAGCAGGGGTGG + Intronic
1018854737 6:167667368-167667390 GTGGAGAGTGTGAGAAGGGGAGG + Intergenic
1019056464 6:169227158-169227180 GGGGTGGCTCAGAAAGGGGGTGG + Intronic
1019665967 7:2252535-2252557 GGGTTGGCTCTGTGGAGGGGTGG - Exonic
1020029242 7:4921163-4921185 GTGGTGGCCCAGAGAGGGGCTGG - Intronic
1021850221 7:24800803-24800825 GTGGTGCTTCTGAGAGGAGGAGG + Intronic
1021974892 7:26002192-26002214 ATGATGGTTCTGAGAAGAGGAGG - Intergenic
1022969917 7:35507522-35507544 CTGCTGGCTCTGAGATGGAGGGG - Intergenic
1023929381 7:44695933-44695955 GTGGTGGCTGTCAGAAAGTGTGG + Intronic
1024666044 7:51548243-51548265 GGGGTGTCTCTCAGAAGGGCTGG - Intergenic
1027830859 7:83175759-83175781 GATATGGCTCTGAGAAGGGTGGG - Intergenic
1027844239 7:83351499-83351521 ATGGTGGAGCTGAGAAGAGGGGG - Intergenic
1028260619 7:88659636-88659658 GTGGTCTTTCTGAGAAGGTGTGG - Intergenic
1028848576 7:95511246-95511268 TTGGTGGCTCTCGGTAGGGGCGG - Intronic
1029383277 7:100227046-100227068 GTGGAGGCTGTGAGCAGGGCGGG - Intronic
1029402024 7:100352659-100352681 CTGGTGACTGTGAGCAGGGGGGG + Exonic
1030046897 7:105505423-105505445 GTTGGGACTCTGGGAAGGGGAGG - Intronic
1031515611 7:122694566-122694588 GGTGTGGCTATGAAAAGGGGAGG + Intronic
1031997694 7:128243419-128243441 CAGGGGTCTCTGAGAAGGGGAGG + Intronic
1032077445 7:128842715-128842737 GGGGTGGGTCTGGGAGGGGGCGG + Intronic
1032791777 7:135247692-135247714 GGGATCGCTCTGTGAAGGGGAGG + Intronic
1034875129 7:154718971-154718993 GTGGTGCTTCTGAGCAGTGGGGG - Intronic
1035050398 7:155995501-155995523 GTGGGGGCTCTGACACAGGGCGG + Intergenic
1035219710 7:157399024-157399046 GTGTTGGCTCTCAGAGGGTGAGG + Intronic
1035389916 7:158497149-158497171 GAGGGGGCTCAGGGAAGGGGAGG - Intronic
1036743360 8:11387237-11387259 CTGGGGCCTCTGAGCAGGGGTGG - Intergenic
1036933536 8:12979049-12979071 TTGGGGACACTGAGAAGGGGAGG + Intronic
1037767267 8:21779944-21779966 ATGGTGCCTTTGGGAAGGGGAGG - Intronic
1037906874 8:22720680-22720702 CTGGTGCCTCTGACAAGGGCTGG - Intronic
1037928508 8:22863994-22864016 CTGGTGGCTGTGAGGAGGGTAGG - Intronic
1038747622 8:30268301-30268323 TTGGAGGCTCTGAGATGGGAAGG - Intergenic
1039638616 8:39194229-39194251 GTGGCTGCTCAGTGAAGGGGTGG + Intronic
1040798893 8:51319394-51319416 GTTGTAGATCTGAGAAAGGGGGG + Intergenic
1041762714 8:61384343-61384365 TTGGTGGCTATGAGCAGGGAGGG + Intronic
1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG + Intergenic
1043404578 8:79917304-79917326 GGTGTGGCCCTGGGAAGGGGTGG + Intergenic
1043876431 8:85491676-85491698 GTGGTGGCTATGGGAAATGGGGG + Intergenic
1045365459 8:101471603-101471625 GTGGTGGCAGTGAGGTGGGGGGG + Intergenic
1048029897 8:130621342-130621364 GTGGTGGCTCTGGGGTTGGGTGG - Intergenic
1048752634 8:137697399-137697421 GGGGTGACTCAGAGAAGGGGAGG + Intergenic
1049249545 8:141580842-141580864 GTGATGGGACTGAGATGGGGCGG + Intergenic
1049693089 8:143971321-143971343 TTGGTGGTTCTGAGGAGGGCAGG - Intronic
1053431005 9:38041689-38041711 CTGGTGGTTCTGAGAAGTCGAGG + Intronic
1053750032 9:41243901-41243923 GGGGTGGGTCAGACAAGGGGAGG - Intergenic
1053801331 9:41766248-41766270 GGGGTGGGTCTGGGCAGGGGTGG + Intergenic
1054143869 9:61548575-61548597 GGGGTGGGTCTGGGCAGGGGTGG - Intergenic
1054189761 9:61978402-61978424 GGGGTGGGTCTGGGCAGGGGTGG + Intergenic
1054463647 9:65479914-65479936 GGGGTGGGTCTGGGCAGGGGTGG - Intergenic
1054648754 9:67610190-67610212 GGGGTGGGTCTGGGCAGGGGTGG - Intergenic
1056607511 9:88098696-88098718 CAGGTGGCTTTGAGAATGGGAGG + Intergenic
1056815723 9:89799449-89799471 AGGGTGGCTCTGAGAATCGGTGG + Intergenic
1057139563 9:92718367-92718389 CTGGGGGCCCTGAGCAGGGGAGG + Intronic
1057487257 9:95495249-95495271 TTGGTGGCTATAAGAAGTGGTGG - Intronic
1057734359 9:97640604-97640626 ATAGTGGCTCTGGGAATGGGAGG + Intronic
1058787963 9:108409318-108409340 ATGGTTGCTCTGAAATGGGGTGG + Intergenic
1060722677 9:125989250-125989272 CTGGTGACTCTGAGCAGGTGAGG - Intergenic
1060815297 9:126632086-126632108 GTGGAGGCTCTGAGAAGCTAAGG - Intronic
1061134389 9:128724852-128724874 GTGGTGGCTCACAGCAGGAGAGG - Intergenic
1061400522 9:130365825-130365847 GGGGTGGGGCTGAGATGGGGAGG - Intronic
1061416367 9:130449228-130449250 GTGGTGGCACTGAGCTGGGATGG + Intronic
1188236790 X:27741340-27741362 CTGGTGGCTCTGGGGAGGGGAGG - Intronic
1189180937 X:39004004-39004026 GAGGTGGGACTGAGGAGGGGTGG + Intergenic
1190301978 X:49062355-49062377 GTGGTGATTCAGAGCAGGGGAGG - Intronic
1190402668 X:50054426-50054448 CTCCTGGCTCTGACAAGGGGAGG - Intronic
1191137682 X:57083190-57083212 GTGGTTGCTCAGGGCAGGGGAGG - Intergenic
1191617210 X:63182145-63182167 GTGGTGGCTCAGAGAAAGGAAGG - Intergenic
1191619088 X:63196778-63196800 GTGGTGGCTCAGAGAAAGGAAGG + Intergenic
1192133472 X:68574748-68574770 CTTGTGGCCCTGAGAAGGGAAGG - Intergenic
1192153439 X:68726058-68726080 GGGGTGGGGCAGAGAAGGGGTGG + Intergenic
1192180852 X:68914674-68914696 GTGGTGGGTCTGGGGAGGGCTGG + Intergenic
1193180760 X:78453701-78453723 GGGGTGGATCTGGGAAGGTGAGG - Intergenic
1195577116 X:106463697-106463719 GTAGAGGATCAGAGAAGGGGAGG - Intergenic
1195960672 X:110383094-110383116 GGGGTGGTTCTGAGATGAGGAGG - Intronic
1200077178 X:153556952-153556974 GTGGTGGCTGTGACAGGGGATGG + Exonic
1202042586 Y:20700632-20700654 GTGGAGGCTCAGAGGAGGTGGGG + Intergenic