ID: 1147642342

View in Genome Browser
Species Human (GRCh38)
Location 17:42011074-42011096
Sequence TTCTCCAGCACTGAGTGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147642342_1147642346 4 Left 1147642342 17:42011074-42011096 CCACATCACTCAGTGCTGGAGAA 0: 1
1: 1
2: 2
3: 11
4: 195
Right 1147642346 17:42011101-42011123 GACCAAAGACTAGTGCAGTAAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1147642342_1147642352 25 Left 1147642342 17:42011074-42011096 CCACATCACTCAGTGCTGGAGAA 0: 1
1: 1
2: 2
3: 11
4: 195
Right 1147642352 17:42011122-42011144 GGGAGAAATGGGCTCTCAGAGGG 0: 1
1: 0
2: 0
3: 21
4: 301
1147642342_1147642351 24 Left 1147642342 17:42011074-42011096 CCACATCACTCAGTGCTGGAGAA 0: 1
1: 1
2: 2
3: 11
4: 195
Right 1147642351 17:42011121-42011143 AGGGAGAAATGGGCTCTCAGAGG 0: 1
1: 0
2: 4
3: 37
4: 328
1147642342_1147642349 13 Left 1147642342 17:42011074-42011096 CCACATCACTCAGTGCTGGAGAA 0: 1
1: 1
2: 2
3: 11
4: 195
Right 1147642349 17:42011110-42011132 CTAGTGCAGTAAGGGAGAAATGG 0: 1
1: 0
2: 2
3: 21
4: 261
1147642342_1147642347 5 Left 1147642342 17:42011074-42011096 CCACATCACTCAGTGCTGGAGAA 0: 1
1: 1
2: 2
3: 11
4: 195
Right 1147642347 17:42011102-42011124 ACCAAAGACTAGTGCAGTAAGGG 0: 1
1: 0
2: 2
3: 8
4: 96
1147642342_1147642350 14 Left 1147642342 17:42011074-42011096 CCACATCACTCAGTGCTGGAGAA 0: 1
1: 1
2: 2
3: 11
4: 195
Right 1147642350 17:42011111-42011133 TAGTGCAGTAAGGGAGAAATGGG 0: 1
1: 0
2: 1
3: 24
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147642342 Original CRISPR TTCTCCAGCACTGAGTGATG TGG (reversed) Intronic
900885608 1:5413276-5413298 CGCTCCGGCACTGAGTAATGGGG - Intergenic
901329503 1:8394623-8394645 CTCTCCAGCACTGAGTGATGTGG - Intronic
901779908 1:11587045-11587067 TTCTCCAGCACTGATAGACCTGG - Intergenic
903704007 1:25271717-25271739 CTGTCCAGTACTGAGGGATGGGG + Intronic
903723229 1:25421595-25421617 CTGTCCAGTACTGAGGGATGGGG - Intronic
904922405 1:34019299-34019321 GTCTCCAGTTGTGAGTGATGTGG - Intronic
907870926 1:58442009-58442031 TTCTCCTTCACTGAGAAATGGGG - Intronic
908063420 1:60375715-60375737 TTCTCCAACAGTGAGTTATCTGG - Intergenic
909056477 1:70826687-70826709 TTCTCCAGCCCTGACTACTGTGG + Intergenic
909872401 1:80759350-80759372 TTCTCCAGCACTATGGGATGGGG - Intergenic
910379366 1:86609391-86609413 TACTCCAGCCCTCAGTGGTGAGG + Intergenic
912487156 1:110038258-110038280 TCCTCCAGCAATGGGTCATGAGG + Intronic
916186635 1:162139447-162139469 TCCTCCAGCACTGAGATCTGTGG - Intronic
917078269 1:171228745-171228767 TTCTCCAGGAATGAATGATAAGG + Intergenic
918355647 1:183704978-183705000 TTCTACACCAATGAATGATGTGG - Intronic
920760163 1:208775970-208775992 ATCTCAAGCACTGACTGAGGTGG + Intergenic
921334861 1:214075942-214075964 TTGTCTAGCGCTGAGGGATGAGG + Intergenic
921924248 1:220698512-220698534 TTCTCCAACACCCAGTGTTGTGG - Exonic
922564063 1:226589783-226589805 CGCTCCAGCCCTGAGTCATGTGG + Intronic
1063629599 10:7721562-7721584 TTCTCCAGCACACAGGGAAGAGG - Intronic
1063643425 10:7854850-7854872 TTCTGAACCACTGAGTGTTGTGG + Intronic
1065804149 10:29379428-29379450 TTCTCGAGCACTGGGTAATGTGG + Intergenic
1068671956 10:59732615-59732637 TTCTCAACCACTGTGTGTTGGGG + Intronic
1069180308 10:65350898-65350920 TTTTACAGCACTGAGTTCTGGGG - Intergenic
1069665240 10:70150848-70150870 TTCTCCAGTACTGACTTGTGGGG - Exonic
1069895272 10:71676668-71676690 TTCTCTGTCACTCAGTGATGGGG + Intronic
1070269983 10:74944223-74944245 TTCTGCATCACTCAGTAATGTGG + Intronic
1071483579 10:86082748-86082770 TTGGGCAGCACTGAGTGGTGGGG - Intronic
1075459149 10:122604540-122604562 TTTTCCAGCAGTGATGGATGGGG - Intronic
1075459781 10:122608599-122608621 TTTTCCAGCAGTGATGGATGGGG - Intronic
1075460413 10:122612658-122612680 TTTTCCAGCAGTGATGGATGGGG - Intronic
1075461045 10:122616717-122616739 TTTTCCAGCAGTGATGGATGGGG - Intronic
1080240830 11:30125460-30125482 TTCTACAGCACTCTGTGATATGG - Intergenic
1081419452 11:42856338-42856360 TTCTCCAGCAATGTATGAGGTGG - Intergenic
1082109872 11:48262716-48262738 CTCTGCAGAAGTGAGTGATGTGG - Intergenic
1083082348 11:60107477-60107499 TTCTCAACCACTGTGTGTTGAGG + Intergenic
1084085896 11:66855132-66855154 TTCTGCATCACCGAGTCATGTGG + Intronic
1086905653 11:92415282-92415304 TTATTCAGCAGTGAGTGCTGAGG + Intronic
1088207430 11:107409698-107409720 TGCTTGAACACTGAGTGATGAGG - Intronic
1088647467 11:111928209-111928231 TTCTCCACCAATTAGTGGTGGGG - Intronic
1095758578 12:45800401-45800423 TTCTCCAGTACTGAGAAATCTGG - Intronic
1100175882 12:92030374-92030396 TTCTCCAGCTCTTACTGAAGGGG + Intronic
1101490527 12:105205590-105205612 TTCTACAGCACTGACCGATCAGG + Intronic
1101680287 12:106956873-106956895 TTCTTTAGCAGTGAGTGACGTGG - Intronic
1101966570 12:109286291-109286313 TTCTCCACCCCTGACAGATGAGG + Intronic
1102256376 12:111417995-111418017 TTCACCAGCACTGGGTGTTATGG + Intronic
1103492278 12:121331341-121331363 GTCTCCAGCACTGTTTGGTGAGG - Exonic
1105829482 13:24151125-24151147 GTCTCCAGAACTGTGTGATTTGG - Intronic
1110328869 13:74248718-74248740 CTCTCCAGCTCTGAGCCATGGGG + Intergenic
1115052661 14:29083261-29083283 TTCTAAACCACTGAGTGATTTGG - Intergenic
1117160340 14:52983581-52983603 ATCTCCAACACTTAGTGATATGG + Intergenic
1118226686 14:63907108-63907130 ATCTCCAGCTTTAAGTGATGGGG + Intronic
1121118654 14:91361579-91361601 ATTTCCAGCACTGAGTGGAGGGG - Intronic
1122078821 14:99253156-99253178 GTGGCCAGCAGTGAGTGATGGGG + Intronic
1122886621 14:104713189-104713211 TTCTCCTGCACTGGCAGATGTGG - Exonic
1124552724 15:30696451-30696473 TTTTCCAGCCCTGAGTCTTGGGG + Intronic
1124678518 15:31709219-31709241 TTTTCCAGCCCTGAGTCTTGGGG - Intronic
1130836142 15:87651884-87651906 TTCTCCAGTCAAGAGTGATGTGG + Intergenic
1132016191 15:98319567-98319589 TTCTCCAGGCCTGATTTATGAGG + Intergenic
1132415073 15:101613765-101613787 TCCTGCAGCACTGCGTGTTGGGG + Intergenic
1133127250 16:3655114-3655136 TCCTCCAGCAGCGAGTGAGGCGG + Intronic
1133252896 16:4495893-4495915 TTTTCAGGCACTGAGTGGTGGGG + Intronic
1134282675 16:12831670-12831692 GTCTCGAGCACTGTGCGATGTGG - Intergenic
1136349773 16:29699221-29699243 TCCTCCAGCTCTGAGAGCTGGGG + Intergenic
1139332389 16:66203588-66203610 TTCTCCAGCCCTGTGTGAGCTGG + Intergenic
1139970939 16:70774594-70774616 AGCTCCAGCCCTGAGTGCTGCGG - Intronic
1140745912 16:77980124-77980146 TTATCCAGCAATGAATTATGTGG - Intergenic
1146095973 17:29930392-29930414 TTTGCCAGCACTGGGTGCTGTGG + Intronic
1147642342 17:42011074-42011096 TTCTCCAGCACTGAGTGATGTGG - Intronic
1147988512 17:44319903-44319925 TTCCTCAGCACTGAGGGAGGGGG - Exonic
1151547347 17:74801209-74801231 GTCTCCAGAACTGAATGAGGAGG - Intronic
1151564918 17:74892720-74892742 TTCTCTAGCTCTGGGTGATCTGG + Intronic
1152206304 17:78976432-78976454 TTCTCCAGCACTGGGAGTGGAGG + Intronic
1152498824 17:80694731-80694753 ATCAGCAGCACTGAGTGATCAGG + Intronic
1153689334 18:7575781-7575803 TTCTACAGCACTGAGGGTTTAGG + Intronic
1154358581 18:13641551-13641573 TTCTGCAGCACTGAGTGTCTGGG - Intronic
1154370295 18:13754982-13755004 TTCTTCAGCAGTGGGTGTTGAGG + Intronic
1164113927 19:22198011-22198033 TTCTTCAGCACTGAGAGAGCAGG + Intergenic
1165331822 19:35144488-35144510 GTCTCCAGCACTGAGGGCAGGGG + Intronic
1166569006 19:43781736-43781758 TTCTCTAGCTCTGGGTGATTGGG - Intergenic
1166946869 19:46402777-46402799 TGCACCAGCACTGCGTGATGTGG - Intergenic
1167390381 19:49190783-49190805 GCCTCCAGCACTGTGTGAGGTGG + Intronic
927214791 2:20662171-20662193 TTCTCCAGCTCTGAGTCAAAAGG + Intergenic
927708997 2:25313795-25313817 GTCGTGAGCACTGAGTGATGCGG + Intronic
929546715 2:42860577-42860599 TTATCCAGAACTGAATTATGTGG - Intergenic
929920055 2:46165439-46165461 TACTCCAGCACTGAGGGGTTGGG + Intronic
935098615 2:99970860-99970882 ATCTCAAGCAGTGAGTGCTGAGG - Intronic
938395727 2:130946496-130946518 TTCTCCAGCACTGGAAGAGGAGG - Exonic
938652472 2:133397986-133398008 TTCTCCAACACTGAGAGGGGAGG - Intronic
938963272 2:136362018-136362040 TTCTCAAGCACTGCTTGTTGAGG + Intergenic
941453988 2:165694032-165694054 TCCTCCAGCAGTGAGCCATGTGG + Intergenic
941967047 2:171310939-171310961 TTCTCCTTCACTGAGGAATGAGG + Intergenic
947157264 2:227175085-227175107 TTGTGAAGCACTGAGGGATGTGG + Intronic
947274719 2:228377477-228377499 TTCTCCAGCACTGAGAAATGGGG - Intergenic
947586739 2:231361164-231361186 TTGTCCAGGGCTGGGTGATGGGG + Intronic
948079117 2:235191195-235191217 TTCTCCACCCTTGATTGATGTGG + Intergenic
948932025 2:241137918-241137940 ACCTCCCGCACTGTGTGATGGGG - Intronic
1170851098 20:20005222-20005244 TTCCCCAGCAGTGAGAAATGAGG - Intergenic
1173445383 20:43112797-43112819 TTCTCCAGCCCTGGATGTTGGGG + Intronic
1174137846 20:48392961-48392983 TTCCCCAGCTCTGAGGCATGAGG - Intergenic
1175308435 20:57994151-57994173 ATCTCCAGCACGGAGACATGTGG - Intergenic
1177043407 21:16140925-16140947 GACACCACCACTGAGTGATGGGG + Intergenic
1177496106 21:21894522-21894544 TGGCCTAGCACTGAGTGATGTGG + Intergenic
1177898489 21:26883954-26883976 TGCTCCAGCACTGTGTCATCAGG - Intergenic
1178523207 21:33303311-33303333 TGCCCCTGCAGTGAGTGATGAGG + Intergenic
1179032021 21:37729273-37729295 TTATCCAGCCCAGAGTGACGTGG - Intronic
1181880988 22:25979844-25979866 TTCTCCATCCCTGTGTGATAAGG + Intronic
1183267442 22:36837767-36837789 CTCTGCAGAAATGAGTGATGGGG + Intergenic
1184038203 22:41928494-41928516 TTCCCCAGCCCTGAGTGCTTAGG - Intergenic
1184241792 22:43214861-43214883 TTCTCCAGCACTGAGAAACTCGG - Intronic
949809052 3:7986181-7986203 TTCTCCAGCAGAGGCTGATGGGG + Intergenic
950336003 3:12193741-12193763 CTCTCCAGCCCTTAGTAATGGGG + Intergenic
952846676 3:37693784-37693806 TGTCCCAGCACTGAGGGATGAGG - Intronic
953071240 3:39522061-39522083 TTCTCCATCACTGGGAGAGGTGG + Intronic
954858120 3:53664200-53664222 TTCTCCAGGAATGAGGGAGGTGG - Intronic
956260370 3:67333104-67333126 TTCTCAAGCACTGTTTGTTGAGG + Intergenic
958032615 3:88130989-88131011 TTATGCAGCACTTAATGATGGGG + Intronic
959234717 3:103705327-103705349 TACTCCAGGACTCAGTGTTGTGG - Intergenic
961048346 3:123725170-123725192 TTCTCCACCACTGAGTGGTCGGG - Intronic
961155669 3:124677545-124677567 TTCACAAACACTGAGTGATATGG + Intronic
964146032 3:153464597-153464619 TAGCCTAGCACTGAGTGATGAGG + Intergenic
966654679 3:182342392-182342414 TGCTCCAGGGCTGATTGATGCGG - Intergenic
967415349 3:189211486-189211508 TGATCCAGTATTGAGTGATGTGG - Intronic
968955041 4:3714075-3714097 TGCTCCAGCAGTGAGAGCTGAGG + Intergenic
969153038 4:5186639-5186661 TTCTCCATCTCTGTGTGTTGGGG - Intronic
969693703 4:8723322-8723344 TTCTCCAACCCTAAATGATGGGG + Intergenic
970373020 4:15427793-15427815 TTCTCCATCTCTGTGTGTTGTGG - Intronic
971370301 4:26013748-26013770 TTCTCCTGCACTTGGTGACGGGG + Intergenic
971573113 4:28238923-28238945 TTCCCCAGCACTGAGTTTTGAGG - Intergenic
975666664 4:76740502-76740524 TTCTCCAGCACCGAGCAGTGGGG - Exonic
977344999 4:95806654-95806676 TTCTCTAGCACTGAGTCCTGTGG - Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
981134208 4:141191421-141191443 TTCTCCAGAATTGAGGGATGTGG - Intronic
982670855 4:158318797-158318819 TTCTCCAGTGCTGAGAGCTGTGG + Intronic
983653947 4:170061891-170061913 TTCTCCAGAACAGATGGATGTGG - Exonic
983808888 4:172031949-172031971 TTCTCCAGCACTGAAAGATGGGG - Intronic
983885241 4:172974340-172974362 TGCTCCAACACTGAGAAATGGGG - Intronic
986545139 5:8888979-8889001 AACTCCAGGACTGGGTGATGGGG - Intergenic
987470325 5:18320072-18320094 TTTTCCAGAATTTAGTGATGTGG - Intergenic
988995594 5:36711996-36712018 TTCTCCTCCTCTGCGTGATGAGG - Intergenic
993011701 5:82490373-82490395 ATCTACAGCCCTGAGTGATCTGG - Intergenic
993950443 5:94168686-94168708 TTGTCCAGCATTTAGTGGTGAGG + Intronic
995584285 5:113631032-113631054 TTCTTCAGTAGTCAGTGATGTGG - Intergenic
995891891 5:116963220-116963242 TTCTCCAGCTGTGACTGCTGGGG + Intergenic
998467771 5:142359173-142359195 TTCCCCAGAACTGAGTGGCGGGG - Intergenic
999959391 5:156737687-156737709 ATCTCCTGCACTGAGTCAAGTGG - Intronic
1000827428 5:166062785-166062807 TTCTAAAGCACTGGGTGATGTGG + Intergenic
1002770060 6:282789-282811 CTCCCGAGCACTGAGTGTTGTGG + Intergenic
1003893888 6:10588675-10588697 ATCTCCAGCTCTAAGTGATCAGG - Intronic
1004366070 6:15013786-15013808 TAACTCAGCACTGAGTGATGTGG - Intergenic
1005987884 6:30885357-30885379 GTGTCCAGGACTGAGTGGTGTGG + Intronic
1010155237 6:72784779-72784801 TTGGCCAGAACTGAGTCATGTGG + Intronic
1010379261 6:75206962-75206984 TTCTCCAGTACTGTGTGTGGAGG - Intergenic
1011593626 6:88995314-88995336 TTCTCCTTCAGTGTGTGATGGGG - Intergenic
1013284438 6:108668742-108668764 TTCTACAAGATTGAGTGATGTGG - Intronic
1013406562 6:109849055-109849077 TTCACCAGGACTGAGGGAAGTGG + Intergenic
1015932954 6:138380940-138380962 TTGTCCAGGACGGAGTGAAGTGG + Intronic
1018646968 6:165957931-165957953 CTCTCCAGCCCTGAGAGGTGTGG - Intronic
1018768050 6:166949622-166949644 TTCTCCAGCACTGAGCAGTAAGG - Intronic
1018768498 6:166952635-166952657 TCATTCAGCACTGAGTGCTGTGG + Intronic
1019564555 7:1672984-1673006 ATCTCCAGGGCTGGGTGATGAGG + Intergenic
1019825872 7:3283808-3283830 TTTTCCAGGACTCTGTGATGTGG - Intergenic
1020634679 7:10682395-10682417 TTCTTCAACACTGAGAGCTGAGG - Intergenic
1021832176 7:24625571-24625593 TACTCCAACACCGGGTGATGGGG + Intronic
1022533685 7:31082778-31082800 TTCTCCAGCTCTGAGTTCTACGG - Intronic
1023316899 7:38947462-38947484 TACTACAGGACTGAGTGAAGGGG + Intergenic
1023470067 7:40508042-40508064 TTCTCCAGCTCTGCCTGAGGAGG - Intronic
1023655155 7:42412415-42412437 TTGTCCACCAATGGGTGATGTGG - Intergenic
1025231207 7:57204327-57204349 TTATGCAGCACTGTGAGATGCGG + Intergenic
1026766674 7:73164486-73164508 TCCTCCAGCCCAGAGGGATGGGG - Intergenic
1027043152 7:74974185-74974207 TCCTCCAGCCCAGAGGGATGGGG - Intronic
1027080495 7:75228174-75228196 TCCTCCAGCCCAGAGGGATGGGG + Intergenic
1027905767 7:84179610-84179632 TTCTCCAGCACTATGTTGTGAGG + Intronic
1030075881 7:105736144-105736166 CTTCCCAGGACTGAGTGATGAGG + Intronic
1034088572 7:148343048-148343070 TTCTCAAGCAGGGAGTGCTGTGG - Intronic
1034736859 7:153437351-153437373 TCCTCCAACAATGAGAGATGTGG + Intergenic
1035373753 7:158394788-158394810 GTCTCCAACACTGAGTCAGGTGG - Intronic
1036610366 8:10344755-10344777 TTCTCCATTACTGTGTGAGGTGG + Intronic
1038122429 8:24632439-24632461 TTCTCAAGCAGGGAGTGAGGAGG - Intergenic
1038230587 8:25695597-25695619 TTCTCTACCACTGAGATATGTGG + Intergenic
1038345188 8:26725930-26725952 TTCATCAGTACTGAGAGATGAGG + Intergenic
1039296976 8:36167648-36167670 TTCTCAAGCAACGAGGGATGTGG + Intergenic
1039308116 8:36286390-36286412 TTCTCAAGCAACGAGGGATGTGG - Intergenic
1041183229 8:55270702-55270724 CTCTTCAGCACTGAATGATTTGG - Intronic
1042877489 8:73452373-73452395 TTCTCCAGCACTGGGTGGGCTGG - Intronic
1043653638 8:82632939-82632961 TTCTCCAGCATTGCATGATTTGG - Intergenic
1044021610 8:87112059-87112081 TTCTGCAGAACTGAGTCAGGTGG + Intronic
1048278381 8:133084941-133084963 TTCCCCAGCAGTGGGTGATTTGG + Intronic
1050708888 9:8437048-8437070 TTCTCCTGCACTGTGTGAAATGG + Intronic
1053609095 9:39692845-39692867 TTCTCCTGAACTGTGTGGTGTGG + Intergenic
1053866939 9:42449115-42449137 TTCTCCTGAACTGTGTGGTGTGG + Intergenic
1054089221 9:60778644-60778666 TTCTCCTGAACTGTGTGGTGTGG - Intergenic
1054244430 9:62649553-62649575 TTCTCCTGAACTGTGTGGTGTGG - Intergenic
1054558557 9:66684096-66684118 TTCTCCTGAACTGTGTGGTGTGG - Intergenic
1058593412 9:106589040-106589062 CTCTCCAGCCCTGAGTGAGGTGG + Intergenic
1059511993 9:114857090-114857112 TTCTCCAGTGATTAGTGATGTGG - Intergenic
1060173387 9:121479599-121479621 TTATCCAGTAGTGTGTGATGTGG - Intergenic
1060695770 9:125707503-125707525 TCGTCCAGAAATGAGTGATGAGG + Intergenic
1061992569 9:134167556-134167578 ATGTCCAGCACTGAGAGCTGGGG - Intergenic
1062145203 9:134985233-134985255 TTCTCGTGCACTCAGTGATGGGG - Intergenic
1185786182 X:2892883-2892905 TTCTGCAGCCCTGAGAGTTGGGG - Intergenic
1185914485 X:4021074-4021096 TTCTCCAGGACTCCGTCATGAGG - Intergenic
1185932555 X:4219219-4219241 TTCTCTACCACTGAGTACTGGGG + Intergenic
1188525965 X:31088166-31088188 TTCTCTAGCACAGAGTTCTGTGG + Intergenic
1195018586 X:100802515-100802537 ATCTCCAGAAGTCAGTGATGAGG + Intergenic
1195773600 X:108378591-108378613 TTGTCCAGAACTGAGTCATGTGG - Intronic
1196282116 X:113833902-113833924 TCCTCCAGCAATGAGTGAGTTGG - Intergenic
1199990043 X:152982475-152982497 TTCTGGAACACTGAGGGATGGGG + Intergenic
1201534270 Y:15028534-15028556 CTCTCCAGCAATGAATCATGAGG - Intergenic
1202094661 Y:21236306-21236328 TTCTCCAATAATCAGTGATGTGG + Intergenic