ID: 1147642642

View in Genome Browser
Species Human (GRCh38)
Location 17:42013678-42013700
Sequence TTTATGTTTTTCATGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 394}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147642642_1147642648 26 Left 1147642642 17:42013678-42013700 CCAGGACACATGAAAAACATAAA 0: 1
1: 0
2: 1
3: 42
4: 394
Right 1147642648 17:42013727-42013749 CTCCATCCCATTTTCAGCACTGG 0: 1
1: 0
2: 4
3: 44
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147642642 Original CRISPR TTTATGTTTTTCATGTGTCC TGG (reversed) Intronic
900041286 1:466980-467002 TTTGTGTTTTTCATATTACCAGG - Intergenic
900062720 1:701955-701977 TTTGTGTTTTTCATATTACCAGG - Intergenic
902947640 1:19853708-19853730 TTTATGTTTTTTTTTTGACCAGG - Intergenic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
905138717 1:35823057-35823079 TTTATGTTTTTTGTGTGTGTTGG - Intronic
905602566 1:39266609-39266631 TTTTTTTTTTTCAGGTCTCCAGG + Intronic
907655966 1:56342229-56342251 TTTACTGTTTTCCTGTGTCCAGG - Intergenic
907896378 1:58696630-58696652 TTTATCTTTTACATTTATCCAGG - Intronic
908706176 1:66957597-66957619 TTTTTTTTTTTCATGTGTTCGGG + Intronic
908821868 1:68095327-68095349 TATAAGTTTTTCATGTGTTTTGG + Intergenic
908985814 1:70019600-70019622 TTTATGTATTTCTTATTTCCAGG + Intronic
911017961 1:93355164-93355186 TTTATGTATTTAAAGTATCCAGG - Intronic
911612541 1:99972204-99972226 TTTTTTTTCTTCATGTGTGCTGG + Intronic
912601487 1:110938862-110938884 TTTATGTTGTTTTTGTATCCTGG - Intergenic
915008921 1:152666453-152666475 TTTGTGTTTGGCATGTGTGCAGG + Intergenic
915171164 1:153978035-153978057 TTCATGTTCGTCATGTGTCTCGG - Intergenic
915370277 1:155343753-155343775 TTTATGTTTCTTCTGTGTTCTGG - Intronic
915783875 1:158585518-158585540 TTTATTTTTTTAATGTTTCAAGG - Intergenic
916200026 1:162262185-162262207 TTTCTGTATTTCATGTGGCTGGG + Intronic
916515722 1:165514650-165514672 TTTATGTTTATCCTATCTCCTGG + Intergenic
916528896 1:165637183-165637205 TTTTTCTTTTTAATGTGTCCAGG - Intronic
916559721 1:165924291-165924313 TTCCTGTATCTCATGTGTCCTGG + Intergenic
916704626 1:167336686-167336708 TTCAAGTTTTTCATGTCTGCTGG - Intronic
916982142 1:170149548-170149570 TTTGTGTTTTTCCTATGTGCCGG - Intronic
917132607 1:171757988-171758010 TTTATGTTTCTCTTATTTCCTGG + Intergenic
917194641 1:172452480-172452502 TTTTTGTTTTTTATGTGAACAGG + Intronic
917515798 1:175706884-175706906 TTTCTGTCCTCCATGTGTCCTGG + Intronic
918557635 1:185822400-185822422 TTTATGTTCTCCATCTTTCCAGG + Intronic
919073540 1:192786634-192786656 TTTATCTTTTTCAAGTCCCCAGG - Intergenic
921463332 1:215455164-215455186 TTTTTCTTTTTCATATGGCCAGG + Intergenic
923495290 1:234519450-234519472 TTCCAGTTTTTCTTGTGTCCAGG + Intergenic
923638345 1:235724124-235724146 TTTAATTTCTTCATATGTCCAGG + Exonic
923922824 1:238588004-238588026 TTTGTGTTTGTCAGGTATCCTGG + Intergenic
924405138 1:243736378-243736400 TTTATGTTTTTCTTGACCCCAGG - Intronic
924695204 1:246392301-246392323 TTCATGCGTTTCATGTTTCCTGG - Intronic
1063861588 10:10314429-10314451 TTTCTGATCTGCATGTGTCCAGG + Intergenic
1064284146 10:13977978-13978000 TGTATGTTTTTCTTGTCTCTTGG + Intronic
1064492296 10:15872343-15872365 TTAATATTTTTCAGCTGTCCTGG - Intergenic
1065218179 10:23470903-23470925 TTTATGTTCAGCAAGTGTCCTGG + Intergenic
1065742874 10:28813026-28813048 TTTATGGTGTACAGGTGTCCAGG + Intergenic
1065858250 10:29848204-29848226 TTTTTGTTTTTCTGCTGTCCTGG - Intergenic
1066412805 10:35190285-35190307 TTTATGTCTTTAATGTATCTGGG + Intronic
1067291282 10:44944727-44944749 TTAATGTTTTTCATCTGACTTGG + Intergenic
1067407368 10:46035142-46035164 TTCATGTTTTTCATGTTTAAAGG + Intronic
1068056891 10:52022548-52022570 TTTAAGTATTTCAAGTGTTCTGG + Intronic
1068281922 10:54883476-54883498 TTTATCTCTTTCATGTCACCTGG - Intronic
1068427749 10:56889453-56889475 GTTATGTTTTTGATGTCTCATGG - Intergenic
1068622786 10:59205537-59205559 TGTATTTATTTCATGTGCCCTGG + Intronic
1068684835 10:59859774-59859796 TTTATGTCTTTCATTAGTTCTGG - Intronic
1068914942 10:62420761-62420783 TTTCTGTTTTTCTTGTTTTCAGG + Intronic
1072328223 10:94319498-94319520 TTTATAATTTTCTTGTCTCCTGG + Intronic
1073090882 10:100938224-100938246 TTTACCTGTTTCATCTGTCCTGG + Intronic
1073312049 10:102549956-102549978 TTTATGTCTTTCAGGTTTACAGG + Exonic
1073484968 10:103811144-103811166 TTTCTTTTCTTCATGTTTCCTGG + Intronic
1074420720 10:113306588-113306610 TATATGTTTATCATCTTTCCAGG - Intergenic
1074655184 10:115578475-115578497 TTTATATGTTGCATGTTTCCAGG + Intronic
1074702834 10:116107433-116107455 TTTAAGGTCTTCATGTGTTCAGG + Intronic
1075024812 10:118976777-118976799 TTTTTGTTTTTTAGGTATCCTGG - Intergenic
1075503635 10:123002014-123002036 TTTTTGTTTTCCCTGTTTCCTGG + Intronic
1076812204 10:132893008-132893030 TTTAGGTTTTTTATGTCTCTTGG - Intronic
1076967559 11:103209-103231 TTTGTGTTTTTCATATTACCAGG - Intergenic
1079744612 11:24108661-24108683 TTAATTTTTTTCATGTGTGTTGG - Intergenic
1079778047 11:24559254-24559276 CTTTTGTTTTTAATGTTTCCAGG - Intronic
1079789087 11:24713256-24713278 TTTATGATTTTCTTGTGGGCAGG + Intronic
1079897043 11:26133246-26133268 TTTGTTTTTTTCATCTGTCTTGG + Intergenic
1082121097 11:48380398-48380420 TTTCAGCTCTTCATGTGTCCTGG + Intergenic
1083372322 11:62192250-62192272 TCTGTCTCTTTCATGTGTCCAGG + Intronic
1083694756 11:64435248-64435270 TTTATGTTTTTAATGATTCCTGG + Intergenic
1083948055 11:65936698-65936720 TTTATGTTTTTCTTGAGACAGGG + Intergenic
1084449289 11:69225043-69225065 TTTATCTTTTTGATGTCTGCAGG + Intergenic
1086967189 11:93041616-93041638 TTGCTGTTTTTCATCAGTCCTGG + Intergenic
1087587205 11:100137605-100137627 TGTATGTGTATCAAGTGTCCTGG + Intronic
1087960502 11:104342238-104342260 TTTATGATTTTCATGTGACAAGG + Intergenic
1088518756 11:110670405-110670427 ATTATGTTTTTAATGTGTGTAGG - Intronic
1089045385 11:115497782-115497804 TTTGTGCTTTTCTTGTGGCCTGG + Intronic
1089755921 11:120686844-120686866 TTTAGGGTTTTCAGTTGTCCAGG + Intronic
1090232895 11:125121730-125121752 TTTCAGTTTTTCAAGTGTCCAGG + Intergenic
1090536698 11:127649867-127649889 TTTATGTCTTTCATGTGAATGGG - Intergenic
1090700169 11:129287352-129287374 TTGATATTCTACATGTGTCCAGG + Intergenic
1091229409 11:133978007-133978029 CTGATGTTTTTCTTGGGTCCAGG + Intergenic
1092092579 12:5815106-5815128 TTTATTTTTTTCTTGTTTCTGGG - Intronic
1092514708 12:9198055-9198077 TATATGTTTTTCCTTTGGCCAGG + Intronic
1093043591 12:14414940-14414962 TTTATTTTTTTAATGAGACCTGG + Intronic
1093336783 12:17914377-17914399 CTTATGTTTTCCTGGTGTCCTGG + Intergenic
1093613520 12:21192319-21192341 TTTCTGTGTTTTATGTCTCCAGG + Intronic
1093882881 12:24425706-24425728 TTTATGTCTTTCAAGTCACCGGG + Intergenic
1095783134 12:46082874-46082896 TTTATGTTTTTCATATTTGTTGG + Intergenic
1096823060 12:54252383-54252405 TTTTTTTTTTTCATTTTTCCTGG - Intronic
1097216249 12:57415833-57415855 TTAATATTTTTGAAGTGTCCAGG - Intronic
1098320281 12:69237119-69237141 TTAATGTGTTTCATGAGTTCTGG - Intergenic
1098478185 12:70929886-70929908 TTTATCTTTTTCATGATCCCTGG + Intergenic
1098542537 12:71673285-71673307 TTAATTTTTTTGATGTTTCCAGG + Intronic
1099061555 12:77916916-77916938 ATTTTGTTTTTTATGTCTCCTGG - Intronic
1100199165 12:92279909-92279931 TTTTTGTTTTTTATGTTCCCTGG + Intergenic
1101080372 12:101175528-101175550 TTTGAGTTTTTGATGTGTCTTGG - Intronic
1101307574 12:103544538-103544560 CTGATGTTTTTCATCAGTCCTGG + Intergenic
1101550281 12:105754951-105754973 TTTAGGTTTTTTATGGGTACAGG + Intergenic
1102742421 12:115219886-115219908 TTTGTGTTTTTCTTTTGTCTGGG - Intergenic
1104357699 12:128102391-128102413 TTGATGTTCATCATGTGCCCTGG + Intergenic
1108344718 13:49534262-49534284 TTTATTTTTGTTGTGTGTCCAGG - Exonic
1108489545 13:50967458-50967480 TTTATGTGTTTAATCTTTCCAGG + Intronic
1108686161 13:52820674-52820696 TTTATGTGGTTTATGTGTCAGGG + Intergenic
1108836118 13:54551428-54551450 TTATTTTTTTTCATGTGTCTTGG - Intergenic
1109455158 13:62577285-62577307 TTTATGTTTTGAAAGTGTCACGG + Intergenic
1110288589 13:73778352-73778374 TTTTTGTTTTTCTTGAGTCAGGG + Intronic
1110898047 13:80781948-80781970 TTCATGTTTTCCATGTGTCCTGG + Intergenic
1110918928 13:81059825-81059847 TTTATTTTATTCATGAGTCATGG + Intergenic
1111507810 13:89217090-89217112 TCTGTGTTTTTCATGTTCCCTGG + Intergenic
1111596516 13:90419120-90419142 TTTATCTTTTTCTTGTTTCTAGG - Intergenic
1112928385 13:104705378-104705400 TTCATCTTCTTCCTGTGTCCAGG + Intergenic
1114708518 14:24752699-24752721 TTTATGTTTTTCTTATGTTCTGG + Intergenic
1115628758 14:35222144-35222166 TCTCTGTTGTTCATGTGTTCAGG - Intronic
1115833245 14:37365665-37365687 TTTCTTTTTTTGATGTGTCTTGG + Intronic
1116588320 14:46738391-46738413 TTTATTTGTTTCCTGTGTCCAGG + Intergenic
1116645614 14:47525265-47525287 TTTATGGTTTTCTGGTTTCCAGG + Intronic
1116661500 14:47716613-47716635 TTTTTTTTTTTCATGTTTCTTGG + Intergenic
1117246527 14:53891998-53892020 TTTACCTTTTTCAGGTCTCCTGG - Intergenic
1117592739 14:57290868-57290890 TTAATGTTTTCCCTGTGTCTGGG + Exonic
1119798682 14:77423132-77423154 TACAGGTTTTTCATGAGTCCAGG - Intronic
1120951641 14:90047129-90047151 TTTATGGTATTCTTTTGTCCTGG - Intergenic
1121871576 14:97412983-97413005 TTTACTTCTTTCAAGTGTCCAGG + Intergenic
1122052380 14:99068671-99068693 TGAATGTTTGTCATGTGTCAGGG - Intergenic
1123005804 14:105323178-105323200 TCGATGATTTTCATGAGTCCCGG + Intronic
1123884550 15:24712197-24712219 TTACTATTTTTCATGTATCCAGG + Intergenic
1124406057 15:29392696-29392718 TTTATATTTTTCATTCGTTCTGG + Intronic
1124658709 15:31528099-31528121 TTTAGGAACTTCATGTGTCCCGG - Intronic
1125205766 15:37152114-37152136 TTTATTTTTGTCATTTGCCCTGG - Intergenic
1125285321 15:38086602-38086624 TTTATTTTATACATGTTTCCAGG - Intergenic
1125745488 15:41994657-41994679 TTAATATTTTTTATGTGGCCAGG - Intronic
1126114035 15:45192785-45192807 TTTATCTTTTTGAAATGTCCAGG + Intronic
1127400351 15:58579270-58579292 TGTATGTTTTTCATTTGTTTGGG + Intergenic
1127436008 15:58958932-58958954 TTTTTTTTTTTTATTTGTCCAGG + Intronic
1127693801 15:61424080-61424102 TTTATGTTTTTCACATTTCTTGG + Intergenic
1129981506 15:79875831-79875853 TCTAAGTTTTTTATGTGTTCTGG - Intronic
1130121519 15:81052752-81052774 TTTCTTTTTTTGTTGTGTCCTGG + Intronic
1131673140 15:94642713-94642735 TTTAAGTTTTTAATGTGTTGAGG - Intergenic
1131761878 15:95632501-95632523 TTGATGTTTTAGATGTGGCCAGG - Intergenic
1132926986 16:2435785-2435807 TTTATGTTCTTAATGTTTCAGGG + Exonic
1133677047 16:8083292-8083314 TTTATTTTTTTCAAGTGGGCTGG + Intergenic
1134000849 16:10781616-10781638 TTTGTGAAATTCATGTGTCCAGG - Intronic
1135622273 16:23966301-23966323 TGTTTCTTTTTCATGTGTTCTGG + Intronic
1137065655 16:35840187-35840209 TGTATGTTTTTCATTTGTATTGG - Intergenic
1137535810 16:49324240-49324262 TTTATGGTATTAAAGTGTCCCGG - Intergenic
1137915286 16:52423498-52423520 GTTATGTTTTTCTTCTTTCCAGG + Intergenic
1138141115 16:54569306-54569328 TTGTTGTTTTTCATTTGTCATGG - Intergenic
1139274304 16:65713332-65713354 TTTATTTTTTCCATGTGACAGGG - Intergenic
1141799871 16:86299696-86299718 TTTATTGTTTTCATGTCTGCTGG - Intergenic
1142531874 17:584819-584841 TATATGCTTTTCACGTGGCCAGG - Intronic
1143039828 17:4025774-4025796 TTCATGTTTTTTCAGTGTCCTGG - Intronic
1143236519 17:5406297-5406319 TCTTTGTCTTTCATGTTTCCAGG - Intronic
1143434261 17:6911098-6911120 TTTATCTCTTTCATGTTTCATGG - Intronic
1143806820 17:9435532-9435554 CTTATGTTTTTAATTTGTCTGGG - Intronic
1143943630 17:10569681-10569703 TTTTTTTTTTTCTTATGTCCAGG + Intergenic
1146385587 17:32369466-32369488 TTTATGTTTTTCATATTTAGTGG + Intronic
1147483641 17:40791067-40791089 TTTATGTTTTCAATTTGTCCTGG - Intergenic
1147642642 17:42013678-42013700 TTTATGTTTTTCATGTGTCCTGG - Intronic
1148374054 17:47126207-47126229 TTTCTTTTTTTCAAGTGACCAGG + Intronic
1148966289 17:51438692-51438714 TTTCTGTTCTTCCTGTCTCCAGG + Intergenic
1151087446 17:71397149-71397171 TTTTTTTTTTTCATGTGTTAGGG - Intergenic
1152369355 17:79876753-79876775 TTTTTTTTTTTATTGTGTCCTGG + Intergenic
1156172292 18:34500375-34500397 TTTATGTTTATCTAGTATCCTGG + Intronic
1156885121 18:42126408-42126430 ATACTGTTTTTCATGTGTCGTGG + Intergenic
1157693124 18:49699990-49700012 TTGTTGTTTTTCAGGTGTCTTGG + Intergenic
1158218453 18:55125389-55125411 TTTATGTTTTAAATGTCTCAGGG - Intergenic
1158438795 18:57455123-57455145 TTTCTGTTTTTGATATGTCTGGG + Intronic
1158688291 18:59634998-59635020 TTTATGTTTTTCATCAATTCTGG - Intronic
1158768450 18:60484921-60484943 TTTTTGTTTTTCATCTGTGTGGG - Intergenic
1159048817 18:63397387-63397409 TGTTTGTTTTTAATGTGTTCTGG - Intronic
1159255879 18:65944892-65944914 TTTATGTTCTTCATATCTCATGG - Intergenic
1160644364 19:172832-172854 TTTGTGTTTTTCATATTACCAGG - Intergenic
1161996292 19:7714025-7714047 TTTGTGTTTTTCATGTTTGTGGG - Intergenic
1162120786 19:8466483-8466505 TTCATGTTTTTTATGTGACTAGG + Intronic
1162275016 19:9646663-9646685 TTTATATTTTTCATTTTTGCTGG - Intronic
1163012094 19:14433023-14433045 TTTGTTTTTTTCAGGGGTCCCGG + Intergenic
1164067664 19:21734305-21734327 GTAATGTTTTTCATGGTTCCTGG - Intronic
1165645938 19:37437004-37437026 TTTTTTTTTTTGATGTGTCTTGG - Intronic
1167536667 19:50057770-50057792 TTTCTGTTTATTATGTTTCCAGG - Intergenic
1168569776 19:57456846-57456868 TTTTTGCTTTTCATATCTCCAGG - Exonic
925933801 2:8733680-8733702 TTTATGTTTTTCTTCTGTTAAGG - Exonic
926777720 2:16438862-16438884 ATTATGTTTTTGGTGTGTCAAGG - Intergenic
927300974 2:21514173-21514195 TTTTATTTTTTCTTGTGTCCAGG + Intergenic
929773426 2:44912478-44912500 CTTATATTCTTCCTGTGTCCTGG + Intergenic
930367218 2:50455257-50455279 TTTATGGTTTTGAGGTCTCCAGG - Intronic
930569866 2:53072189-53072211 TTTATGTCTTTTATTTGTTCTGG - Intergenic
931002361 2:57801399-57801421 TTTATGTTGTCCATGGTTCCTGG - Intergenic
932312054 2:70750840-70750862 TATAATTTTTTCCTGTGTCCAGG + Intronic
932655807 2:73610406-73610428 TTTTTTTTTTTCATGTGGCCTGG + Intronic
932828709 2:74967106-74967128 TTAATGTCTTTCATCTGTCCTGG + Intronic
933176974 2:79185478-79185500 ATTATGTTTTTCATGTATCTTGG + Intronic
934918752 2:98323594-98323616 TTTATGTTTATCATGTTTTGAGG - Intergenic
935303993 2:101719181-101719203 TTTATGCTCTTCATCTGTCTGGG + Intronic
935314592 2:101819043-101819065 TTTATATATTCCATGTGTCCAGG - Intronic
935318023 2:101856916-101856938 TTTATGCTTATCATGTGTCTTGG + Intronic
935558453 2:104536586-104536608 TTTATCTTTTTGATGAGCCCTGG + Intergenic
935804424 2:106731871-106731893 ATTATGATTTTCATGGGTCTAGG - Intergenic
935884136 2:107597324-107597346 TCTATGTTTTTCATGTTTTGTGG + Intergenic
936522240 2:113218609-113218631 TATTTTTTTTTAATGTGTCCAGG - Exonic
937029567 2:118727020-118727042 TTTATAGTTTCCATGTGTCAGGG - Intergenic
937794044 2:125996118-125996140 ATTATGTTTTTCTTTTGTCAAGG + Intergenic
938694853 2:133826049-133826071 TTTCTGTTTTTTAAGTCTCCCGG + Intergenic
940282567 2:152003050-152003072 TTTATATTTTCCATGGGCCCTGG - Intronic
940539886 2:154999643-154999665 TTTATATTTTTCATTTGATCAGG - Intergenic
940715371 2:157217418-157217440 TTTATATTTTTCATTTGTACAGG - Intergenic
942299240 2:174546601-174546623 TTTATGTTTTCAATTTGTGCAGG - Intergenic
942884166 2:180902269-180902291 TTTATTTTTTTCCTTTGTCCAGG - Intergenic
943170611 2:184393308-184393330 TTTTTGTGTTTCATGACTCCAGG - Intergenic
943468848 2:188266606-188266628 TTTATGCTTGTCATTTGTACAGG - Intergenic
945740117 2:213649489-213649511 TTGCTGTTTTTCATCTTTCCTGG - Intronic
946923763 2:224605381-224605403 TTTATGTTTGACATTTGTCAAGG + Intergenic
946969011 2:225070925-225070947 TTTGTGTTTCTCACATGTCCGGG - Intergenic
948136625 2:235641356-235641378 TTTTTTTTTTTTAAGTGTCCTGG + Intronic
949084560 2:242140597-242140619 TTTGTGTTTTTCATATTACCAGG + Intergenic
1171158712 20:22901300-22901322 TTTAGCTTTTTGATGTGTGCTGG - Intergenic
1172828749 20:37813564-37813586 TTTGTGTTTTTCATTTTGCCAGG + Intronic
1173960872 20:47071687-47071709 TTTATTTTCTTCATCTATCCAGG + Intronic
1175607425 20:60322496-60322518 TTTATGTTTTTCAGGAGCTCAGG + Intergenic
1176870719 21:14081476-14081498 TTTATTTTTTTCTTTTTTCCTGG + Intergenic
1177484432 21:21738664-21738686 TTTATGTTTTTGACTTTTCCAGG - Intergenic
1177542178 21:22508555-22508577 TTTATGTTCTTCATGGATTCTGG + Intergenic
1177703455 21:24669255-24669277 TCTATACTTTTCATCTGTCCTGG + Intergenic
1181141086 22:20805441-20805463 TTTATATGTTTCATGTATTCAGG - Intronic
1181256260 22:21564799-21564821 GCTATGTTTTTTATTTGTCCTGG + Intronic
1181992261 22:26846461-26846483 TTTATTTTGTTCTTGTCTCCTGG + Intergenic
1182079848 22:27521244-27521266 TTTTGGTTTTGCATGTGGCCTGG - Intergenic
1182252699 22:29014075-29014097 TGGATTTTTTTCATCTGTCCTGG + Intronic
1182268553 22:29138149-29138171 CTTCTGTGTTTCTTGTGTCCTGG - Intronic
1184618779 22:45657477-45657499 TTTATCTTTTTCCTGTGAACAGG + Intergenic
949504811 3:4717416-4717438 TTTTTGTTTTTCATGTCTCATGG + Intronic
952876181 3:37946421-37946443 TTTATGTTTTTTAAGTGTAAAGG + Intronic
953365608 3:42341834-42341856 TCTCTCTTCTTCATGTGTCCTGG - Intergenic
953651489 3:44809415-44809437 TTTATATTTTTGATGTAGCCAGG + Intronic
954841015 3:53511572-53511594 TTCATGTTTTTCAGGGGTCAGGG + Intronic
955385380 3:58475078-58475100 CTCTTGTTTTTCATGAGTCCTGG + Intergenic
955469034 3:59266964-59266986 TTTAGGTTGTTTATGTGTCTTGG + Intergenic
957024465 3:75165830-75165852 TGTATATTTTTCATCTCTCCAGG + Intergenic
957744349 3:84319122-84319144 TTTATTTTTTTAATGTTACCAGG - Intergenic
957895536 3:86417014-86417036 TTTGTGCTTTTCATGATTCCTGG + Intergenic
958096487 3:88952214-88952236 TTTATGTTTTTGAGGTGATCTGG + Intergenic
959306059 3:104667299-104667321 TTTATTTTCTTCATCTGTCTGGG - Intergenic
959458836 3:106598640-106598662 TTTTTGTTTTTCCAGTTTCCTGG + Intergenic
962614050 3:137106465-137106487 TTTGAGTTTTTTAAGTGTCCAGG - Intergenic
962813971 3:138982158-138982180 ATTATGTATTTCCTGTTTCCAGG - Intergenic
963008069 3:140744711-140744733 TCTGTATTTTACATGTGTCCTGG + Intergenic
963364088 3:144312194-144312216 TATATATTTTTCAAGTGTCCTGG - Intergenic
964191805 3:154011713-154011735 TTTATTTTTCTCCTGTGTTCCGG - Intergenic
965116142 3:164491542-164491564 TTTATTTTTTTAATGCTTCCCGG - Intergenic
965126871 3:164641830-164641852 TTTATGGTTTTCAACAGTCCGGG - Intergenic
965292715 3:166904505-166904527 TTTTTTTTTTTCATGTTTCTTGG + Intergenic
965347469 3:167569669-167569691 TTTTTTTTTTTGCTGTGTCCAGG - Intronic
965902920 3:173665967-173665989 TTTCTGTCCTTCATGTGTTCAGG - Intronic
965949564 3:174290427-174290449 TTTATATTTTTAATTTGTCTGGG - Intergenic
966450965 3:180061167-180061189 GATATATTTTTCATGTTTCCTGG - Intergenic
966707257 3:182930121-182930143 TTTCTGTTTTTCATTTGTTAAGG - Intergenic
967045151 3:185729981-185730003 GTTTTGGTTTTCATGTCTCCAGG + Intronic
967209925 3:187159331-187159353 ATGCTGTTTGTCATGTGTCCTGG - Intronic
967731468 3:192910959-192910981 TATATGTACTTCATGTGTTCAGG - Intronic
968586427 4:1418835-1418857 TTAATTTTTTTGATGTGCCCTGG + Intergenic
970416882 4:15866820-15866842 TATATGTCTTTCATGAGCCCAGG - Intergenic
971562330 4:28095890-28095912 TTTATGTTTCTATTGTCTCCTGG + Intergenic
971650702 4:29269519-29269541 TTTATATTTTTCATGTGTTATGG - Intergenic
972608212 4:40633061-40633083 TTTATTTTTGTCATGTTCCCGGG - Intergenic
973188893 4:47364669-47364691 TTTATGTTTTTTATTTATGCTGG - Intronic
973791609 4:54383373-54383395 TTTATATTTTTCAAGTTTTCTGG + Intergenic
974317445 4:60300236-60300258 TATATGTTTATCTTGTGTCAGGG - Intergenic
974396226 4:61338330-61338352 TTTCTGTTATTCATGTTTTCAGG + Intronic
974477404 4:62401173-62401195 TTTATATTTTGCATGTGCCTGGG - Intergenic
975151178 4:71022620-71022642 TTTTTTTTTTTAATGTTTCCTGG + Intronic
975164273 4:71160297-71160319 TTTATCTTATTCATGTGTCTGGG + Intergenic
976177367 4:82368351-82368373 TGTATGTTTTTAATATTTCCTGG - Intronic
976504173 4:85827379-85827401 TTTATTTTTTTCAGGTTTCCAGG - Intronic
977627799 4:99206890-99206912 TTTCTGTTTTTTACCTGTCCTGG - Intronic
977709085 4:100104123-100104145 TTTATTTTTTTCATATTTCTGGG - Intergenic
977859444 4:101938616-101938638 GTTATGTTTTTTATTTCTCCTGG - Intronic
977922745 4:102663418-102663440 ATTATGTTTTTCATGTTTGATGG - Intronic
978543124 4:109840227-109840249 TTTTTTTTTTTCATGTTTCTTGG + Intronic
979578382 4:122323482-122323504 AATATGTTTTTCATGTGTTGGGG - Intronic
980062901 4:128151521-128151543 TTGATGTTTTTCAAGAGTTCAGG + Intronic
981017967 4:139994014-139994036 TTTTTGTGTTTCATGTGACATGG + Intronic
981327560 4:143468168-143468190 TTTATGAATTTCATCTGTCATGG + Intronic
981856341 4:149297337-149297359 TTTTTTTTTTTCATTTATCCTGG - Intergenic
983098921 4:163600386-163600408 TTTATGTTTTTAATGCTGCCAGG - Intronic
983202067 4:164872115-164872137 TTTATCTTTTTCACTTTTCCAGG + Intergenic
983901291 4:173137573-173137595 ATTATGTTCTTCATTTATCCTGG + Intergenic
984135004 4:175925102-175925124 TTTCTGATTTTCATGTGATCAGG - Intronic
984149728 4:176111777-176111799 ATTATGTTTTTCATGTAACAAGG - Intronic
984340547 4:178451149-178451171 TTTATCTGTATCATGTGTCTGGG - Intergenic
984480463 4:180294613-180294635 TTTATTTTATTCATATGTTCAGG + Intergenic
985928449 5:3035867-3035889 ATTTTCTTTTTCCTGTGTCCTGG + Intergenic
986263839 5:6175379-6175401 TTTTTCTTTTTCATGGGTCATGG + Intergenic
986276888 5:6283358-6283380 TTTAATTTTTTCATGTGTAAAGG + Intergenic
986700117 5:10398674-10398696 TTCATGTTTTAAATGTGACCTGG - Intronic
987575961 5:19728852-19728874 TATTTCTTTTTCATGTTTCCTGG - Intronic
987637413 5:20563040-20563062 GTTAAGTTTTTCATGTGTTATGG - Intronic
988639299 5:33023634-33023656 TTTATGTTTTTCATCCATCAAGG + Intergenic
988682787 5:33500494-33500516 TTTTTGTCTTTCAACTGTCCTGG - Intergenic
990001266 5:50896059-50896081 TTTATGTCATTCATGTGTTATGG + Intergenic
990074754 5:51830529-51830551 TTACTGGTTTTCATGAGTCCTGG + Intergenic
990092307 5:52067716-52067738 TTTATCTTTTTCATGTCTGATGG - Intronic
990632117 5:57681706-57681728 TTTTAGCTTATCATGTGTCCAGG + Intergenic
990985137 5:61634466-61634488 GTTATGGTTTTCATGTGGTCAGG + Intergenic
991205656 5:64047251-64047273 TTTATGTTGATTTTGTGTCCTGG - Intergenic
991496720 5:67234073-67234095 TTTCTGTTTTTCCTCTTTCCAGG + Intergenic
992087955 5:73294891-73294913 TTTATTTATTTCATGCATCCTGG - Intergenic
992916280 5:81456355-81456377 TTTTTTTTTTTCATGTGGCTTGG + Intronic
993191800 5:84692610-84692632 TTTCTGTATTTCTTGTTTCCTGG + Intergenic
995367497 5:111379959-111379981 TTTATGTTTTAGATTTTTCCTGG - Intronic
995426577 5:112030239-112030261 TTTTTTTTTTTCATGTGTTCTGG - Intergenic
995650980 5:114367913-114367935 TTTCTGGTTCTCATGGGTCCTGG + Intronic
995744387 5:115388666-115388688 ATTCTGTTTTTAATGTCTCCTGG + Intergenic
996079512 5:119241010-119241032 ATTATGATTTTCATCTGTGCAGG - Intronic
996121307 5:119675496-119675518 TTGATGTATTGCGTGTGTCCAGG + Intergenic
996370167 5:122744920-122744942 TTAATTTTTATCATGTTTCCAGG - Intergenic
996712483 5:126557017-126557039 TTTATTTTTTTCATGTGTTTTGG - Intronic
996749886 5:126877830-126877852 TTTATGTTTCTCATTTTTGCCGG - Intronic
996815942 5:127572608-127572630 TGTATTTTTCTCTTGTGTCCAGG + Intergenic
998414338 5:141935065-141935087 GATGTGTTTTTCATGTGTACAGG - Intronic
998574624 5:143300466-143300488 TTTATGTTTTGCATCTTACCTGG + Exonic
998769308 5:145524029-145524051 TTTTTGTTTTTCAGGGGTCAAGG + Intronic
1000665511 5:163990969-163990991 TTTATTTTTTTCATGTTTATAGG + Intergenic
1001032878 5:168275619-168275641 ATTATGTTTTTCATGATACCAGG - Intergenic
1001622592 5:173101000-173101022 TTTATTTTTTTCATTTGTGAAGG + Intronic
1001989301 5:176103056-176103078 TTTATGTTTATGAGGTGGCCTGG + Intronic
1002593248 5:180305422-180305444 TTAATTTTTTTCCTGTGTTCAGG + Intronic
1002732560 5:181351948-181351970 TTTGTGTTTTTCATATTACCAGG + Intergenic
1002751979 6:122160-122182 TTTGTGTTTTTCATATTACCAGG - Intergenic
1002952849 6:1832475-1832497 TTTATTTTTTTTATGTGTGTTGG + Intronic
1005384991 6:25277610-25277632 TTTTTTTTTTTCCTGTGGCCTGG - Intergenic
1008385917 6:50889700-50889722 TTTATGTTTTTGAACTCTCCTGG - Intergenic
1008503824 6:52209566-52209588 TTTATTTTTTTCATGAGACAGGG - Intergenic
1008823888 6:55667930-55667952 TTTATGTTTTTTATGTTTCTTGG + Intergenic
1009384311 6:63070213-63070235 TTTTTATTTTCCATGTTTCCTGG - Intergenic
1009644735 6:66383507-66383529 TTTTTGTTTTTCTTCTTTCCAGG - Intergenic
1009737656 6:67698488-67698510 TTTATGTTTTACAATTGTGCAGG + Intergenic
1010100473 6:72100116-72100138 TTTATTTTTTTCATGAGAGCTGG - Intronic
1012377491 6:98580168-98580190 TTTTTGTTTTTCTTCTTTCCTGG + Intergenic
1012836293 6:104273307-104273329 TTTCTGTCTTTCATGTATCTTGG + Intergenic
1013452431 6:110297700-110297722 TTAATGTTTTTCATATGTGTGGG - Intronic
1014954974 6:127603572-127603594 TTTATCTTTTTGTTGTGTCCTGG + Intergenic
1015215484 6:130745177-130745199 TTCATATTTTTCCTGTGTGCTGG + Intergenic
1016370964 6:143373511-143373533 TTTATTATTCTTATGTGTCCAGG + Intergenic
1017027385 6:150193237-150193259 TTTTTCTTCTTCCTGTGTCCTGG - Intronic
1017226268 6:152025267-152025289 TTTTTTTTTTTCCTATGTCCTGG + Intronic
1018355149 6:163006969-163006991 TTTATTTGTCCCATGTGTCCTGG + Intronic
1019076533 6:169392964-169392986 TTTCTGTCTCTCATGTGCCCTGG - Intergenic
1019236812 6:170624267-170624289 TTTGTGTTTTTCATATTACCAGG + Intergenic
1021540841 7:21756083-21756105 TTTATGGCTTTCATGTGTTAAGG + Intronic
1022160157 7:27702186-27702208 TTTCTGTTTTTAATGTGATCAGG + Intergenic
1022850184 7:34253401-34253423 TGTATGGTTTTCATTTCTCCAGG + Intergenic
1023880444 7:44317237-44317259 TTTTTTTTTTTCATTTTTCCTGG - Intronic
1024185391 7:46943535-46943557 TTTATATTACTCATGTGTTCAGG - Intergenic
1025914903 7:65857979-65858001 GGTAGGTTTTTCATGTTTCCTGG + Intergenic
1026219857 7:68385466-68385488 TTTATTTAATTCATGTGTGCTGG - Intergenic
1027332545 7:77114600-77114622 TTTATTTCTTACTTGTGTCCAGG - Intergenic
1027537187 7:79417993-79418015 CATATTTTTTTCATGTGTACAGG + Intronic
1027545918 7:79527498-79527520 TTTTTTTTTTTAATGTGTACTGG + Intergenic
1027553988 7:79639747-79639769 TTTCTGTTTTGCATGTGAACTGG - Intergenic
1027583803 7:80031966-80031988 TCTATGACTTACATGTGTCCAGG + Intergenic
1028148669 7:87346625-87346647 TTTATATTTTTAATGTGTACCGG + Intronic
1028560657 7:92171699-92171721 TTTCTTTTTTTGCTGTGTCCTGG - Intronic
1028803817 7:95000541-95000563 TTTATTTTTTTCCTTTTTCCAGG + Intronic
1028822333 7:95226880-95226902 TTTCTGTTTTACATGTGTCATGG - Intronic
1029325689 7:99806934-99806956 TTTAAGTATTTCATGGGTCGGGG + Intergenic
1029783235 7:102756713-102756735 TTTATTTCTTACTTGTGTCCAGG + Intronic
1030164666 7:106541816-106541838 TTTTTGTTTTTCTTTTGTACTGG - Intergenic
1031627378 7:124006005-124006027 TTAATTTTTCTCATGTGTCCAGG + Intergenic
1031637843 7:124122825-124122847 TCTATATATTTGATGTGTCCTGG - Intergenic
1033819933 7:145123126-145123148 TTTATGGTGTTCATGTGACTAGG + Intergenic
1034577842 7:152016608-152016630 GTTTTCTTGTTCATGTGTCCTGG - Intronic
1035510960 8:182343-182365 TTTGTGTTTTTCATATTACCAGG - Intergenic
1036289136 8:7471889-7471911 TTTATGTCTTTCATTTGTTCTGG + Intronic
1036332339 8:7839638-7839660 TTTATGTCTTTCATTTGTTCTGG - Intronic
1036424650 8:8632865-8632887 ATTACGTTTTTTATGTGTCAGGG - Intergenic
1036712572 8:11090846-11090868 TTTTTGGTGTTCATGTGTCCTGG + Intronic
1036947152 8:13105272-13105294 TCTGTGGTTTTCATTTGTCCTGG + Intronic
1039252065 8:35677174-35677196 CTTTTGCTTTTCATGTGTCATGG - Intronic
1039331142 8:36538318-36538340 TTGATGTTTTTCTTATGTCCTGG - Intergenic
1039935364 8:42039325-42039347 TTTATTTTTTTCTGGTGACCTGG - Intronic
1040652943 8:49469897-49469919 TTTTTGTTTTTAATGTGTTCAGG - Intergenic
1041432794 8:57803130-57803152 TTCATATTTTTAATGTGTCCTGG + Intergenic
1042347666 8:67744609-67744631 TCTATGTTTATCATCTGACCCGG + Intronic
1042525025 8:69755540-69755562 TTTTTCTTTTTCTTGTGTCGAGG + Exonic
1044810820 8:96059498-96059520 TTTAAGGGTTTCATGTGTCCGGG - Intergenic
1044981730 8:97723070-97723092 TTTACATTTTTCATGTGTTAAGG + Intronic
1046509215 8:115178468-115178490 TGTCAGTTTTTTATGTGTCCTGG - Intergenic
1046832137 8:118758110-118758132 TTTATCTTTCTCCTGTCTCCTGG - Intergenic
1048080738 8:131123514-131123536 TTTATGTTATTTATGTCTCATGG + Intergenic
1048789875 8:138091514-138091536 TTTATGTTTATCTTGTTTCCAGG - Intergenic
1048879781 8:138862766-138862788 TTTTTTTTTTTCATGTTTTCAGG + Intronic
1049206960 8:141368040-141368062 TCTCTGTTTTGCATGTGTCCTGG + Intergenic
1051262110 9:15274735-15274757 TTTATCTTCTTAATTTGTCCAGG + Intronic
1051327203 9:15985445-15985467 TTTGAGTTTCTCATTTGTCCTGG + Intronic
1051373871 9:16384133-16384155 TTTATGTTTTTCATGTTTATTGG + Intergenic
1051491020 9:17665413-17665435 TTGATGTTTTTGATGAGTACAGG + Intronic
1052054336 9:23886638-23886660 TTGATGTTCTTTATGTTTCCTGG + Intergenic
1052344173 9:27391401-27391423 TTTAAGTTATTTTTGTGTCCTGG + Intronic
1052360244 9:27547893-27547915 TTCATGGTTTACATGTGTCAAGG - Exonic
1052430284 9:28357637-28357659 TTTCTGCTTTTCATTTGTTCAGG - Intronic
1052514388 9:29461440-29461462 TTTAAGTCTTTCATTTGTCTTGG + Intergenic
1054705906 9:68461889-68461911 TTTATGCTATTCATTTTTCCTGG - Intronic
1056493178 9:87128250-87128272 ATTATGTTTTTCCTGTGTAGAGG - Intergenic
1058333716 9:103798952-103798974 TTTATTTTTTAAATGTCTCCTGG - Intergenic
1058553686 9:106142953-106142975 TTTATGTTCTACATGTTTACTGG + Intergenic
1059091338 9:111361836-111361858 TTTATGTTTTTAAAGTATCTGGG - Exonic
1059371358 9:113841496-113841518 TTTATGTCTTTCATGTTACTGGG - Intergenic
1061608116 9:131726995-131727017 TTTTTGTTTTTCATTTGTGATGG - Intronic
1061987693 9:134139475-134139497 GTTCTTTTTTTAATGTGTCCAGG + Intronic
1062756962 9:138304273-138304295 TTTGTGTTTTTCATATTACCAGG + Intergenic
1185998649 X:4983375-4983397 TATTTGTTTTTCATGTGTTCTGG - Intergenic
1186128366 X:6440451-6440473 TTTATGTAGTTCAGGAGTCCAGG - Intergenic
1187291461 X:17958163-17958185 ATTATGTTTTTCATCAGTCTTGG + Intergenic
1187825070 X:23326918-23326940 TTTATGCATTTCATGTGCCAAGG - Intergenic
1187988162 X:24837664-24837686 TTTATCTTTTGCATGAGTCCAGG - Intronic
1188146193 X:26616737-26616759 TTTATATCTTTCTTGTGTACAGG + Intergenic
1188428617 X:30078684-30078706 TTTTTCTTTTTCTTGTCTCCAGG - Intergenic
1189949880 X:46217951-46217973 TATATGTTTTTCATTTTTCTGGG - Intergenic
1189984459 X:46541895-46541917 TTTTTGTTTTTCCTCTCTCCTGG + Intronic
1190523295 X:51301868-51301890 TTTTTGCTTTTCATGTTTTCTGG - Intergenic
1190885249 X:54525969-54525991 TTTATGTTTTTGAAGAGTCCAGG - Intergenic
1190953020 X:55164323-55164345 TTTATGTGGTTCATGTTTGCAGG + Intronic
1191804015 X:65114549-65114571 ATTATTCTTTTCATGTGTGCAGG + Intergenic
1191931483 X:66377964-66377986 TTTTTTTTTTTCATGTTTGCTGG + Intergenic
1192276506 X:69636784-69636806 ATTATGTTTTTCTTGGGACCTGG + Intronic
1192622883 X:72697137-72697159 TTTTTGTTTTTCCTGTTTCTAGG + Intronic
1194210841 X:91066725-91066747 ATTTTCTTTTTCATGTGTTCTGG - Intergenic
1194903606 X:99545081-99545103 TTTATGCTTTTTATGTGTTCTGG + Intergenic
1195229127 X:102828650-102828672 TTTATGTCTTAAATATGTCCTGG - Intergenic
1195471931 X:105240126-105240148 TTTATCTTTTTCATGAGTCATGG + Intronic
1195572616 X:106413506-106413528 TTAATGCTTTTCATCTGTTCTGG - Intergenic
1195647202 X:107245802-107245824 TGTATCTTTTTCCTATGTCCTGG + Intergenic
1196363017 X:114888706-114888728 TTCATATTTTGCATGTCTCCAGG + Intronic
1196792102 X:119473195-119473217 TTTATGTTTGTCCTCTGGCCAGG + Intergenic
1197560302 X:128012306-128012328 ATTATGTATTTAATGTATCCTGG + Intergenic
1197871448 X:131066148-131066170 TTTATATTATTCATGAGTCGGGG - Intronic
1198559191 X:137830368-137830390 TTTATGGTTTCCATGTGTTTTGG + Intergenic
1198913911 X:141644994-141645016 TTTTTGTTATTCTTGTTTCCTGG - Intronic
1199273689 X:145916657-145916679 TTTATTTTTTTAATGTGTTGAGG - Intergenic
1200015263 X:153157208-153157230 TTTATGGTTTACATGTTTCAAGG + Intergenic
1201281136 Y:12343280-12343302 TTGATGTTTTTCATCTTTTCTGG + Intergenic