ID: 1147645022

View in Genome Browser
Species Human (GRCh38)
Location 17:42028181-42028203
Sequence CCGGGCGGCCCCGGCTCCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 319}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147645006_1147645022 23 Left 1147645006 17:42028135-42028157 CCCCCTGTGACTCTCTTGGCTTT 0: 1
1: 0
2: 0
3: 23
4: 274
Right 1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 319
1147645004_1147645022 27 Left 1147645004 17:42028131-42028153 CCGGCCCCCTGTGACTCTCTTGG 0: 1
1: 0
2: 1
3: 42
4: 233
Right 1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 319
1147645016_1147645022 -10 Left 1147645016 17:42028168-42028190 CCTCCCCTGGACACCGGGCGGCC 0: 1
1: 1
2: 1
3: 17
4: 150
Right 1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 319
1147645008_1147645022 21 Left 1147645008 17:42028137-42028159 CCCTGTGACTCTCTTGGCTTTGT 0: 1
1: 0
2: 2
3: 26
4: 290
Right 1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 319
1147645009_1147645022 20 Left 1147645009 17:42028138-42028160 CCTGTGACTCTCTTGGCTTTGTG 0: 1
1: 0
2: 1
3: 16
4: 226
Right 1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 319
1147645007_1147645022 22 Left 1147645007 17:42028136-42028158 CCCCTGTGACTCTCTTGGCTTTG 0: 1
1: 0
2: 2
3: 29
4: 251
Right 1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 319
1147645002_1147645022 29 Left 1147645002 17:42028129-42028151 CCCCGGCCCCCTGTGACTCTCTT 0: 1
1: 0
2: 0
3: 42
4: 209
Right 1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 319
1147645003_1147645022 28 Left 1147645003 17:42028130-42028152 CCCGGCCCCCTGTGACTCTCTTG 0: 1
1: 0
2: 1
3: 58
4: 425
Right 1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 319
1147645012_1147645022 -4 Left 1147645012 17:42028162-42028184 CCGGCACCTCCCCTGGACACCGG 0: 1
1: 0
2: 2
3: 30
4: 268
Right 1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG 0: 1
1: 0
2: 1
3: 26
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147645022 Original CRISPR CCGGGCGGCCCCGGCTCCTC CGG Exonic
900323838 1:2097701-2097723 CAGGGGGGCCCAGGCTCCTGGGG + Intronic
900378662 1:2373053-2373075 CAGGGCCGCCCCTGCTCCACCGG + Intronic
900589766 1:3454439-3454461 CCGGGCGGCGGCGGCTCGGCGGG + Exonic
901279932 1:8026159-8026181 CGGGGCAGCCGCCGCTCCTCCGG - Exonic
901477877 1:9503430-9503452 CTGTACGGCCCAGGCTCCTCCGG - Intergenic
901703965 1:11059909-11059931 CCCGACGGCCCCGCCGCCTCCGG - Exonic
901882434 1:12202130-12202152 CCGGGCCTCCCCGGCCCCACTGG - Exonic
903118213 1:21195620-21195642 CCAGGCGGTCCCAGCTACTCAGG + Intergenic
903153248 1:21428110-21428132 CCGCCCGGCCCCGGCTCCCCGGG - Intergenic
904128636 1:28259905-28259927 CCGGGCGGCGTCGGCGACTCGGG + Exonic
904236654 1:29121475-29121497 ACGAGCGGCTGCGGCTCCTCGGG - Exonic
904528948 1:31155396-31155418 CCCGCCGCCCCCGGCTCCTGAGG - Intergenic
904972374 1:34429069-34429091 CAGGGGGGCCCCGGCTCCATGGG + Intergenic
906029303 1:42705018-42705040 CTGGGAGGTCCCGGCTACTCGGG + Intergenic
909957773 1:81800993-81801015 CAGGCCGGCCCCGGCTCCGCCGG - Intronic
910034725 1:82776845-82776867 CCGGGAGGCTCCGGCTGCACAGG + Intergenic
913451077 1:118993083-118993105 CCCGCCGGCCCCGGCTCTGCCGG - Intergenic
917846694 1:179026020-179026042 CCGGCCGCCCCCGCCGCCTCCGG - Exonic
923372476 1:233327678-233327700 CAGGGCCGCCCCGCCCCCTCCGG - Intergenic
1064552882 10:16520812-16520834 CCGGGTGGCCCGGGCTCTCCGGG + Exonic
1065099804 10:22321528-22321550 CGTGGCGGCCGCGGCTGCTCGGG + Exonic
1065557520 10:26931480-26931502 CCAGCCTGCCCCGCCTCCTCTGG - Intergenic
1069698347 10:70404324-70404346 CGGGGCTGCTTCGGCTCCTCAGG - Intergenic
1070641958 10:78176758-78176780 CGGGGAGGCCCAGGCTGCTCAGG + Intergenic
1071603166 10:86968814-86968836 CAGCGCAGCTCCGGCTCCTCCGG - Intronic
1073059381 10:100724345-100724367 CCGGCCGGCCTCGGCGGCTCAGG + Intergenic
1073067744 10:100773732-100773754 CCAGGCTGCCCCGGCCCCCCAGG + Intronic
1075802189 10:125160482-125160504 CGGGCCGCCGCCGGCTCCTCCGG + Intronic
1075824633 10:125344857-125344879 CCGTGCCGCCCCCACTCCTCCGG - Intergenic
1076814951 10:132910007-132910029 CCGGTGGGCACCGTCTCCTCGGG + Exonic
1076899425 10:133330039-133330061 CCGGGCACCCTCGGCTTCTCTGG - Intronic
1076947845 10:133664560-133664582 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076948835 10:133667870-133667892 CTACGCCGCCCCGGCTCCTCCGG + Exonic
1076949819 10:133671169-133671191 CTACGCCGCCCCGGCTCCTCCGG + Intronic
1076950803 10:133674468-133674490 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076951793 10:133677778-133677800 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076952782 10:133681088-133681110 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076953766 10:133684387-133684409 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076954750 10:133740739-133740761 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076955739 10:133744049-133744071 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076956729 10:133747359-133747381 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076957716 10:133750668-133750690 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076958701 10:133753967-133753989 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076959690 10:133757277-133757299 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1076960674 10:133760576-133760598 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
1077024081 11:431639-431661 GCGGACGGCCCCGCCTCCTGCGG - Intronic
1077477647 11:2797919-2797941 CCAGGCAGCCCAGGCTGCTCAGG + Intronic
1080386948 11:31816058-31816080 CCGGCCAGACCCCGCTCCTCAGG + Intronic
1080628609 11:34052506-34052528 CGCGGCGGCCCCGGCTCCCGCGG - Exonic
1082066551 11:47905533-47905555 CCGGGCGGCCACGGCTTTGCTGG + Intergenic
1083418328 11:62539553-62539575 CAGGGCAGCCCTGGTTCCTCTGG - Intronic
1083721866 11:64607464-64607486 CCCGGCGGGCCCCGCTCCCCAGG + Exonic
1083753789 11:64778324-64778346 CCGGGCTGCCCCCGCTCCCCGGG - Exonic
1083778811 11:64907572-64907594 TCGGGCTTCCCCGGCCCCTCAGG - Exonic
1084207944 11:67606829-67606851 GCCAGCGGCCCCGCCTCCTCGGG - Intergenic
1084973042 11:72781727-72781749 CCGCGCGGCCCCGGGTCTCCCGG - Intronic
1085011060 11:73142104-73142126 CCGGGCGGCCCGGGCGGCCCGGG + Exonic
1085561276 11:77474237-77474259 CGGGGCGGGCACGGCTCCACCGG - Intronic
1087761847 11:102110773-102110795 CCCGGACGCCCCGGCTCCACGGG - Exonic
1090086371 11:123654332-123654354 ACGGGCGGCCCCGGCGGCTTCGG - Exonic
1091219160 11:133920249-133920271 CCGTGCGCCCCCGGCTCAGCCGG + Exonic
1094405363 12:30110711-30110733 CCGGCCGGCCCCGCCTGCCCCGG - Intergenic
1094838374 12:34332792-34332814 CTGGGAGGCCCAGGGTCCTCTGG - Intergenic
1095261718 12:40105830-40105852 CCGGGGGGACGCGGCTCCGCGGG + Exonic
1096372914 12:51083526-51083548 CCGGGCGTCTCCGGCAACTCGGG + Exonic
1096459502 12:51814473-51814495 CCGGGCGGCCGCTGCGCCGCAGG + Intergenic
1096649413 12:53054520-53054542 CCTGGCGGCCTCGCCTCCGCTGG - Intronic
1097166786 12:57090202-57090224 CCGGGCGGGCCCGGTGGCTCAGG + Intronic
1097872404 12:64611601-64611623 CCGGGTTGGCCCGGCTCCCCTGG - Intronic
1102349052 12:112178900-112178922 CTGGGCTGCCCAGGCTCCTTGGG + Intronic
1103559871 12:121788020-121788042 ACCTGCGGCCCCAGCTCCTCAGG - Intronic
1103562669 12:121800484-121800506 CCGGGTCCCACCGGCTCCTCCGG - Intronic
1103764429 12:123271000-123271022 CCCGGCGGCCCCGCGACCTCAGG + Intronic
1103856343 12:123973163-123973185 GCGTGCGGCCCCCGCTCCCCCGG + Exonic
1103922401 12:124405745-124405767 CCGGGTCCCCCCAGCTCCTCAGG - Intronic
1104918262 12:132277652-132277674 CCCCGCGGCCCCGGCTCTGCTGG + Intronic
1105801194 13:23904089-23904111 CTGGGCGGCCCAGGCTCAGCTGG + Intergenic
1106087640 13:26557746-26557768 CCGGGCGGCCGCGGCGCGGCGGG + Exonic
1112507299 13:99982551-99982573 CCGTGCGGCCCGTGCTGCTCTGG - Exonic
1112580633 13:100674379-100674401 CCGGGCGCACCCGGCGCCTGCGG - Intronic
1113483894 13:110640879-110640901 CCTGGCTGCCCTGACTCCTCCGG + Intergenic
1115399176 14:32938908-32938930 CCGGGCCGCCCCGGCTCCCGAGG - Intronic
1117830633 14:59746283-59746305 CCGGGTGTACCCAGCTCCTCAGG + Exonic
1121016361 14:90551763-90551785 CCGGGCGGCCCTTTCTTCTCTGG + Intronic
1122803886 14:104247118-104247140 CCCTGTGGCCCCAGCTCCTCTGG - Intergenic
1123001968 14:105300689-105300711 GCGGGCGGCGCGGGCTGCTCCGG - Exonic
1202864238 14_GL000225v1_random:104834-104856 CTAGGCCGCCCTGGCTCCTCCGG - Intergenic
1123707282 15:22959522-22959544 CCGGGCAGTCCCGCCTGCTCAGG + Intronic
1124999458 15:34755101-34755123 GCGCGCGTCCCCGGCCCCTCGGG - Intergenic
1125631590 15:41151780-41151802 CCAGCCGGCCCCGCCGCCTCGGG + Intergenic
1127071177 15:55289684-55289706 CCGCGCGCCTCCCGCTCCTCAGG + Intronic
1128073200 15:64810121-64810143 GCGGGAGGGCCCGGCTGCTCCGG + Intergenic
1128319041 15:66679911-66679933 AGGGGCGGCCCTGTCTCCTCTGG + Intronic
1129464955 15:75719050-75719072 CCGGGCAGCCTCATCTCCTCTGG - Intergenic
1130613372 15:85380958-85380980 CCGGGCGGCGCCGGGACCTCAGG + Intronic
1131827371 15:96332032-96332054 CGGGGCGGCGGCGGCTCCCCGGG - Exonic
1132398059 15:101489046-101489068 CCGCGCCGCCCCGGCTTCTGAGG + Intronic
1132398377 15:101489998-101490020 CGGGGAGGCCCCGGCGTCTCAGG + Intronic
1132805768 16:1774406-1774428 CCGGGAGGCGCCTGCTCCGCCGG + Intronic
1132942301 16:2514282-2514304 CCGGGCGCCCCCGACAGCTCGGG - Intronic
1133228937 16:4357224-4357246 CCGAGAGGCCCCTGCTCGTCGGG - Exonic
1134411062 16:14003602-14003624 CCGGCCGGCCCCAGCTCTGCTGG - Intergenic
1135480002 16:22814409-22814431 CCCGGGGGCAGCGGCTCCTCGGG - Exonic
1136498737 16:30659331-30659353 GGGGGCGGCGCCGGCTCCCCGGG + Exonic
1137412935 16:48244649-48244671 GCGGGCGGCGCGGCCTCCTCCGG + Intronic
1137678043 16:50313886-50313908 CCAGGCTGCCCCTGCTTCTCAGG - Intronic
1137683162 16:50368639-50368661 CCGGGCCGCCCCGGAGCCACTGG + Intronic
1141556217 16:84838442-84838464 CGGGGCAGCCTGGGCTCCTCGGG - Exonic
1141989476 16:87602236-87602258 CGGGGCGCCCCCGCCCCCTCCGG - Intronic
1142671892 17:1491416-1491438 CCAGGCTGCGCCGGCGCCTCCGG + Intronic
1143068192 17:4266275-4266297 CCAGGCAGGCCAGGCTCCTCTGG + Intergenic
1144522612 17:15963969-15963991 CCGGGCTGCTCTGGCTCCTGTGG - Intronic
1144595769 17:16569050-16569072 CCGAGCGGCAGCGGATCCTCGGG + Exonic
1144791666 17:17863003-17863025 CTGGCCCGCCCTGGCTCCTCCGG - Intronic
1146890268 17:36502140-36502162 CCGGGGGGCCCCGCCTCGGCAGG - Intronic
1146896321 17:36544772-36544794 CAGGGCGGCCCCGCACCCTCTGG + Intergenic
1146926376 17:36748735-36748757 TCTGGCTGCCCAGGCTCCTCCGG + Intergenic
1146926381 17:36748753-36748775 TCCGGCTGCCCAGGCTCCTCCGG + Intergenic
1146935171 17:36808619-36808641 CCTGGTGCCCCCAGCTCCTCAGG + Intergenic
1147156707 17:38547787-38547809 CCGGGGGGCCCCAGGTCCTGGGG + Intronic
1147374611 17:40016257-40016279 CCGAGCAGCACCAGCTCCTCGGG - Exonic
1147382292 17:40062992-40063014 GCGGGCGGCCCGGGCCCCACCGG + Exonic
1147645022 17:42028181-42028203 CCGGGCGGCCCCGGCTCCTCCGG + Exonic
1147684002 17:42276261-42276283 TCGGGCGCCCGCGGCTGCTCCGG + Exonic
1147951946 17:44112358-44112380 CTGGCCTGCCCCTGCTCCTCAGG + Intronic
1147994594 17:44353909-44353931 CCGGGCGGCCACGGTACCCCGGG - Exonic
1148645930 17:49219709-49219731 CCTGGCGCCCCCGGGTGCTCAGG + Intronic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1149347201 17:55751006-55751028 CCGGGCTGCCCCGGCTGCCCCGG - Exonic
1152468415 17:80477895-80477917 CCCGCCGCCCCCGGCTTCTCTGG + Intergenic
1152568174 17:81109539-81109561 CCTGGCCGCCCCGGCCCCTGTGG + Intronic
1152613600 17:81328082-81328104 CCAGGCAGCCCCGGCTGCTTCGG - Intronic
1152649901 17:81488024-81488046 CAGGGCGGCCCCGGCGCCCCCGG + Intergenic
1152737237 17:82003560-82003582 GGGGGCGGCGCCGTCTCCTCTGG + Intronic
1153006150 18:500378-500400 CCTGGCAGCCCCGACTCCCCGGG + Intronic
1153201924 18:2655817-2655839 CCGCGCGTCCCCTTCTCCTCAGG + Exonic
1154132769 18:11750984-11751006 CCAGCCCGCCCCGGCTCCCCAGG - Intronic
1157095146 18:44680367-44680389 CCCGGCGGCTCCGGCTCCGCTGG - Intronic
1157867132 18:51197034-51197056 CCGGGCGGAGCCCGCTCCTCTGG + Exonic
1158893576 18:61894259-61894281 GCCGGCGGCCGCCGCTCCTCCGG + Intergenic
1160232373 18:77058151-77058173 CAGGGCTGCACCGGCTCTTCAGG + Intronic
1160453357 18:78979813-78979835 CCGCGCGGCGCCGTCTCCGCCGG - Intergenic
1160499185 18:79394122-79394144 CGCCCCGGCCCCGGCTCCTCAGG + Intergenic
1160518017 18:79489092-79489114 CCAGGTGGCCCGGGCCCCTCTGG + Intronic
1160552623 18:79704709-79704731 GGGGGCGGCCGGGGCTCCTCAGG + Intronic
1160592441 18:79951840-79951862 CCGGGCGGGGCCGGTCCCTCAGG + Intergenic
1160904594 19:1446270-1446292 CGGGGCGGCCGCGGCTCCATGGG + Intergenic
1160942298 19:1626104-1626126 CAGGGCAGCCCTGGCTCCCCAGG - Intronic
1160983448 19:1827086-1827108 TTGGGCGGCCCCTGCGCCTCCGG + Exonic
1162248941 19:9426227-9426249 CCGAGTGGCCCCGGGTCCTCTGG - Intronic
1162398366 19:10430817-10430839 CGGGGCGGCCCCGCCTCGGCGGG - Intronic
1163020973 19:14480567-14480589 CCGGGGTGCCCCGTCTCCCCAGG + Intronic
1163155673 19:15438856-15438878 CCTGCCAGCCCCAGCTCCTCGGG + Intronic
1163462730 19:17448559-17448581 CCCTGCGGCCCCGCCCCCTCGGG - Exonic
1163708611 19:18832351-18832373 CCCGGCGGCCCCGGCGGCCCGGG + Exonic
1164061326 19:21678014-21678036 CGGGGCGGCTCCTGCACCTCTGG + Intergenic
1164592971 19:29516265-29516287 CCAGGCAGCCCCAGCTCCCCAGG + Intergenic
1164671975 19:30077494-30077516 CACGGTGGCCCAGGCTCCTCTGG - Intergenic
1165745836 19:38229213-38229235 CGGGGCAGGCCCGGCACCTCCGG + Intronic
1165928678 19:39342655-39342677 GCGGGCGGCCCCGCCCCCTCAGG + Intronic
1166121630 19:40690491-40690513 CCGGGCGCCCCCGCCTCCCGCGG + Exonic
1167075201 19:47244245-47244267 CCGGGCGGCCCCGTGGCTTCCGG + Intergenic
1167311625 19:48740541-48740563 CCCGGAGGCCCTGGCTCCACTGG + Exonic
1167433526 19:49466096-49466118 CAGGGCTGCCCGGGCTCCTGGGG - Exonic
1168154023 19:54463378-54463400 CCAGGCGGCGCCGGCGCCCCAGG + Exonic
1168239444 19:55081871-55081893 CCGCCCGGCGCCGGCTCCTGCGG - Exonic
1168689751 19:58369226-58369248 TCGAGGGGCCTCGGCTCCTCGGG + Exonic
926718581 2:15942567-15942589 CAGGGCGGCCCCGGCGCGGCCGG - Exonic
926901307 2:17754108-17754130 CCGCGCGGCCCCGCCTCTTCCGG - Intronic
927652343 2:24920201-24920223 CCGCGCGGCGCCGGCGGCTCCGG + Intergenic
929188623 2:39120525-39120547 CCGGACGGCCCGGCCCCCTCCGG + Intronic
931321464 2:61177664-61177686 CAGGGCAGCCCCGGCTCCCGCGG - Exonic
934655446 2:96114817-96114839 ACGGGCGGCACAGGATCCTCCGG + Exonic
935237408 2:101150792-101150814 CAGGGCGGCCCCGAGCCCTCCGG + Intronic
936371260 2:111904117-111904139 CAGGGCGGGCCCTGCTTCTCTGG - Intronic
937083800 2:119157971-119157993 CCAGGCGGGCCCGGCTCTCCAGG + Exonic
938073133 2:128318733-128318755 CCGCCCGGCCCCGGCTCCCCGGG + Intergenic
939003125 2:136758558-136758580 CCAGCCGGCCCCGCCTCCCCAGG + Intergenic
941367081 2:164621737-164621759 CTGGGCGGCCCCGGCGCCGCTGG + Exonic
942034736 2:171999867-171999889 TCGGGCGGCCTCGACGCCTCAGG + Exonic
944070124 2:195658019-195658041 CCGTGCGGCCGCGCCACCTCCGG - Intronic
948116001 2:235494571-235494593 GCCGGCGGGCCCGGCTCCCCGGG + Exonic
948431857 2:237923751-237923773 CTGGGCAGCCCCGGGTCCACAGG - Intergenic
948449494 2:238060575-238060597 CCGCGCGGCCCCGGCTCTCCCGG + Intronic
948559908 2:238845919-238845941 CAGGGCGTCCCCGGGGCCTCTGG + Intergenic
948877256 2:240836422-240836444 CCGGGAGGCCCCAGATGCTCAGG + Intergenic
949079815 2:242088234-242088256 CGGGGCTGCCCAGGCTCCTGTGG + Intergenic
1168802607 20:653109-653131 CCGCTCGGCCCGGGCCCCTCGGG + Exonic
1171891794 20:30724265-30724287 CCGGGCGGCCCCAGGATCTCAGG + Intergenic
1173516210 20:43667185-43667207 CCGGGCTGCTCCGGCCGCTCCGG - Exonic
1174046410 20:47736983-47737005 CCGGGCGGCACCGGCACCAGGGG + Intronic
1174606897 20:51768025-51768047 TGGGGCGGGCCCGGCTTCTCGGG + Intronic
1176002814 20:62840589-62840611 CCGGGAGGCCCAGGCTCGCCGGG - Exonic
1176039098 20:63055069-63055091 TCCGGCTGCCCCGGCCCCTCTGG - Intergenic
1176125119 20:63471768-63471790 TCGGGCGGCCCCAGCCCCGCGGG + Intronic
1176311511 21:5153238-5153260 TGGGGCCGCCCGGGCTCCTCTGG - Intronic
1179209484 21:39313356-39313378 CCGGGCTCCCCCGGCTCCCCTGG - Intronic
1179218507 21:39386973-39386995 CCGTGTGGCCCCAGCTACTCAGG - Intronic
1179845539 21:44108797-44108819 TGGGGCCGCCCGGGCTCCTCTGG + Intronic
1179874057 21:44258644-44258666 CTGGTCGGCCCCGGGACCTCGGG - Exonic
1179977135 21:44874547-44874569 GCGGGCGGCCCCGGCTCTCGCGG - Intergenic
1180159347 21:45992170-45992192 CCGGGGGGCCCAGGCTCTCCCGG - Exonic
1180205368 21:46256240-46256262 CCGAGCAGAACCGGCTCCTCAGG - Intronic
1180871639 22:19150105-19150127 TCGGGCGCCCCGGGCTCCTCTGG + Exonic
1181787226 22:25236040-25236062 CCGGGCGGCCCGAGCTGCGCAGG + Intergenic
1182278601 22:29205777-29205799 CCTGGCCGCCCGGGCCCCTCCGG + Intergenic
1182421553 22:30250989-30251011 CCGGGCACCCCCGGCTGCCCAGG + Intergenic
1182729476 22:32475268-32475290 ACGGGAGGCCCGGGCTCTTCCGG + Intronic
1183063191 22:35347726-35347748 CTGGGCCGCCGCAGCTCCTCAGG - Exonic
1183257452 22:36771548-36771570 CCGGCTGGTCCCGGCACCTCAGG - Intronic
1184094811 22:42310840-42310862 GCGGGCGGCCCAGGCTCTGCGGG - Intronic
1184468622 22:44683366-44683388 CCTGGCAGCCCCAGCTCCTGAGG + Intronic
1185055140 22:48575483-48575505 CGGCTCGGCGCCGGCTCCTCGGG - Intronic
1185321274 22:50201211-50201233 CCGGGCGGCGGCGCCTCCACGGG - Exonic
1185395130 22:50582870-50582892 CCGGCCGGCCTGGGCTTCTCCGG + Exonic
949105765 3:198064-198086 CCGCGCGGCTGCTGCTCCTCCGG - Intronic
953031905 3:39185109-39185131 CAGTGGGGCCCCGGCCCCTCAGG - Exonic
954198088 3:49007957-49007979 GGAGGCGGCCCCGGCCCCTCAGG + Intronic
954401051 3:50319881-50319903 CAGTGCGGCCCCGGCACCTCTGG - Exonic
954717263 3:52533084-52533106 CCGGGCGGAACGGGCTCCTAGGG - Intronic
961330351 3:126134647-126134669 CTGGGCTGCCCCGGCTTTTCTGG + Intronic
963299644 3:143584298-143584320 CCTGGCGGCCCTGGTTCCACAGG + Intronic
965520251 3:169663113-169663135 GAGGGCTGCCCAGGCTCCTCCGG + Intronic
965576404 3:170222490-170222512 CCGCGCGGTTCCGGCTGCTCCGG + Exonic
966787845 3:183636460-183636482 CCCGCCCGCCCCGGCTCCCCGGG - Intronic
966911834 3:184564130-184564152 CCGGGCCGCCCCAGCACATCAGG - Intronic
968238265 3:197051296-197051318 CAGGGAGGCCCCAGCTACTCGGG + Intronic
968262834 3:197339091-197339113 CAGGGAGGCCCCAGCTACTCGGG - Intergenic
968405493 4:336737-336759 CCCGGTGGCCCCGGCTCCAGCGG + Intergenic
968512937 4:1003292-1003314 CCGAGCGTCCCCAGCTCCCCTGG + Intronic
968548056 4:1208515-1208537 TCGGGCAGCCCCAGCACCTCAGG - Intronic
968565286 4:1309436-1309458 CGGGGCTGGCCTGGCTCCTCTGG + Intronic
968599856 4:1503739-1503761 CCGGGCTCCCCCGGCTCCCCGGG + Intergenic
968600213 4:1505182-1505204 CAGGGAGGCCCCGGGTCCGCAGG + Intergenic
968850493 4:3074627-3074649 CGGCGCGGCCCCGCCTCCGCCGG + Intergenic
972311934 4:37890660-37890682 CCCCGCGCCCCCGGCTCCCCAGG + Intergenic
980774479 4:137421119-137421141 CCGGCCGGCCCCGCCTGCCCGGG + Intergenic
982707172 4:158723151-158723173 CCGGGAACCCCCGCCTCCTCGGG + Intronic
982734688 4:158993240-158993262 CCGGGTAGTCCCAGCTCCTCAGG + Intronic
983850135 4:172570199-172570221 CTGGGCTGCCCGGGCTCGTCTGG - Intronic
984206547 4:176793060-176793082 CCCGGCGGCCCCACCTCCCCCGG + Intergenic
984265702 4:177495890-177495912 CCGGGAGGCCCGGGCTGCACAGG - Intergenic
985445399 4:190018816-190018838 CCGGGCAGCCCTGGCTTCTCTGG + Intergenic
985446083 4:190021924-190021946 CTACGCCGCCCCGGCTCCTCCGG - Intergenic
985451298 4:190065359-190065381 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
985452289 4:190068654-190068676 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
985453274 4:190071951-190071973 CTACGCCGCCCCGGCTCCTCCGG + Exonic
985454264 4:190075244-190075266 CTACGCCGCCCCGGCTCCTCCGG + Exonic
985455252 4:190078537-190078559 CTACGCCGCCCCGGCTCCTCCGG + Exonic
985456240 4:190081837-190081859 CTACGCCGCCCCGGCTCCTCCGG + Exonic
985457224 4:190085131-190085153 CTACGCCGCCCCGGCTCCTCCGG + Intergenic
985458211 4:190088424-190088446 CTACGCCGCCCCGGCTCCTCCGG + Exonic
985459200 4:190091724-190091746 CTACGCCGCCCCGGCTCCTCCGG + Exonic
985463452 4:190174493-190174515 CTACGCCGCCCCGGCTCCTCCGG + Exonic
985778434 5:1857286-1857308 CCGTGGGGACCCGGCTGCTCAGG - Intergenic
989043022 5:37248984-37249006 CCGGGTGACCCCGGCCCCTTGGG + Intronic
991676618 5:69094487-69094509 CCGGGCTCCCCGGGCTCTTCGGG + Intronic
992563318 5:77973386-77973408 GCGCGAGGGCCCGGCTCCTCTGG + Intergenic
995725966 5:115180356-115180378 CGCGGAGGCCCCGCCTCCTCGGG + Intronic
998797521 5:145835497-145835519 CCGCGGGGCCCCGGGTGCTCTGG - Intergenic
999768075 5:154755719-154755741 TCGGGCGCGCCCGGCTTCTCCGG + Intronic
1000352072 5:160359917-160359939 CCTGGCTCCCTCGGCTCCTCTGG + Intronic
1001070222 5:168579348-168579370 CCGCGCGGCCCAGCCACCTCCGG - Exonic
1002425326 5:179171544-179171566 GCGGGCAGGCCCGGCTCTTCTGG + Intronic
1002484408 5:179524450-179524472 ACGGGCTCCCCCGGCTCCTCTGG + Intergenic
1002500167 5:179643038-179643060 ACGGGCTCCCCTGGCTCCTCTGG - Exonic
1002501805 5:179651723-179651745 ACGGGCTCCCCTGGCTCCTCTGG + Intergenic
1006391466 6:33761386-33761408 CTGGCCAGCCCCGGCCCCTCAGG - Intergenic
1007630311 6:43269754-43269776 CCCGGCGGCGGCGGCTCCTCGGG + Intronic
1015054475 6:128883189-128883211 CAGGGCGGCAGCGACTCCTCTGG + Exonic
1015328463 6:131950931-131950953 CAGCGCGGCGCCGGCTCGTCCGG + Exonic
1017073955 6:150600510-150600532 CCGCGCGTCCCCGGGTCCTCGGG - Intronic
1017497781 6:154996051-154996073 CCGGACGGGCGCGGCTCCTGGGG + Intronic
1017940755 6:159050887-159050909 CCAAGCGGCCCCTGCTCCTCGGG + Intergenic
1019386565 7:760055-760077 CCGCGCGGCCCCGTCTCCCTCGG - Intronic
1019549128 7:1593588-1593610 CCGGGCGGCCCCCAGGCCTCGGG + Intergenic
1019645987 7:2129174-2129196 CCTGGTGGCCCCAGCTCCCCCGG - Intronic
1019732314 7:2634871-2634893 CAGGCTGACCCCGGCTCCTCGGG - Intronic
1020084371 7:5302730-5302752 CCTGGTGGCCACGGCTGCTCGGG - Intronic
1020288779 7:6706640-6706662 CGGCCCGGCCCCGGCTCCGCAGG - Exonic
1022092325 7:27115704-27115726 CTGGGCTCCCACGGCTCCTCAGG - Intronic
1023501966 7:40860355-40860377 CCAGGCCGCCCCCGCTGCTCGGG + Exonic
1023881832 7:44325239-44325261 CCGCGCGCCGCCGGCTTCTCTGG - Intronic
1025662028 7:63562382-63562404 CCTGGTGGCCACGGCTGCTCGGG - Intergenic
1026923713 7:74174483-74174505 CCTGACGGCCCCGACTCCGCCGG - Intronic
1027170274 7:75866861-75866883 CCGGGTGGTCCCAGCTTCTCAGG - Intronic
1029736197 7:102467289-102467311 CCGGCCCACCCCAGCTCCTCCGG - Intronic
1032083147 7:128869929-128869951 CCGGGCAGCAGGGGCTCCTCGGG - Intronic
1033025388 7:137767013-137767035 GTGGGTGGCCCCGGCTCGTCTGG - Intronic
1034129134 7:148699265-148699287 CCTGGCCGCCCCGGCCCGTCCGG - Intronic
1034435596 7:151061450-151061472 CAGCCCGGCCCCGGCTCCACGGG + Intronic
1035160763 7:156948920-156948942 CTGGGCAGGGCCGGCTCCTCAGG + Intergenic
1035269365 7:157710813-157710835 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269378 7:157710858-157710880 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269391 7:157710903-157710925 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269404 7:157710948-157710970 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269417 7:157710993-157711015 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269430 7:157711038-157711060 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269442 7:157711083-157711105 CCGGGCTGCCCCGGAACCTCCGG - Intronic
1035269456 7:157711128-157711150 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269469 7:157711173-157711195 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269482 7:157711218-157711240 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269495 7:157711262-157711284 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269508 7:157711307-157711329 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035269520 7:157711352-157711374 CCCGGCTGCCCCGGAACCTCTGG - Intronic
1035269533 7:157711397-157711419 CCCGGCTGCCCCGGAACCTCCGG - Intronic
1035537867 8:406519-406541 CGGGGCTGCCCAGGCTCCTGTGG + Intronic
1035725831 8:1824299-1824321 CGCGGCGCCCCCGGCCCCTCAGG + Intronic
1035751742 8:2001550-2001572 GCGGGCTCCCCGGGCTCCTCGGG - Exonic
1036775963 8:11613339-11613361 CCGGGCGGCAGCGGCTCCAGAGG + Intergenic
1036932736 8:12972288-12972310 CCGGCCAGCCCCGCCTCCACGGG - Intronic
1037273773 8:17156640-17156662 CTGGGCGGGCCCGGCACCCCTGG - Exonic
1037803921 8:22049158-22049180 GCGGGCCGCCCGGGCTCCGCCGG - Intronic
1037985816 8:23289973-23289995 CCGGCCAGCCCGGGCACCTCGGG - Exonic
1038575658 8:28701684-28701706 GGGCGCGGCCCCCGCTCCTCGGG - Intronic
1039504690 8:38043487-38043509 CCGGGTGGTCCCAGCTACTCAGG - Intronic
1040565617 8:48564464-48564486 CTGGGCAGCCCAGGCACCTCTGG + Intergenic
1041511616 8:58659696-58659718 CCCGCCCTCCCCGGCTCCTCCGG - Intronic
1044591496 8:93917467-93917489 CCGGCCGGCCCCTGTTCGTCTGG + Intronic
1045432073 8:102123852-102123874 CCTGGCGGCCCGGGGACCTCTGG - Intronic
1046108185 8:109691465-109691487 CGGGCCGGGCCCGGCTCCCCGGG - Exonic
1046740172 8:117819574-117819596 CCGGGCTCCCCAGGCTCCCCGGG - Intronic
1049212216 8:141392054-141392076 CCGGGCGGCGCCGGCACGACGGG - Intronic
1049419481 8:142510580-142510602 CCCGCCGCCCCCAGCTCCTCCGG - Intronic
1049452557 8:142669941-142669963 CCGGCCGGCGGCGGCTGCTCCGG - Exonic
1049585470 8:143430708-143430730 CCGGCCGGCCCCGCCTCCCACGG + Intergenic
1049684513 8:143933937-143933959 CAGGGCGGGGCAGGCTCCTCCGG + Intronic
1049748569 8:144273179-144273201 GCTGGCGGCCTCCGCTCCTCCGG - Intronic
1059234500 9:112750690-112750712 CCGGGCGGCCGCGGCGCCTCGGG + Intergenic
1060811474 9:126613397-126613419 CCGGGCGGCGGCGCCTGCTCGGG - Intergenic
1060936985 9:127521697-127521719 CCGGGTGGCCCCTTCTCCCCAGG - Intronic
1061052155 9:128203349-128203371 CCGCGGGGCCCCCGCCCCTCGGG - Intronic
1062360475 9:136185754-136185776 CCAGGCGGCACCTGCCCCTCAGG + Intergenic
1062491716 9:136808095-136808117 CCCGGCGGCCCCGGCCCCCCCGG - Exonic
1062567269 9:137168836-137168858 CCAGGCGGCCGCGGCCGCTCAGG + Exonic
1062635346 9:137487687-137487709 CCTGGCAGCCTCTGCTCCTCTGG + Intronic
1062658349 9:137615445-137615467 CAGGGCAGACCCTGCTCCTCAGG + Exonic
1062696213 9:137877647-137877669 CCGCCCCGCCCCGGCCCCTCCGG - Intergenic
1185464063 X:345054-345076 CTGGGCGGCACCGGCTCCCGCGG + Intronic
1187933480 X:24314148-24314170 CCAGGCGCCCCCTGCTTCTCTGG + Intergenic
1188003996 X:25005142-25005164 CCGGCCCGGCCCGGCCCCTCGGG - Intronic
1193094082 X:77527884-77527906 GTGGGCGGCCCCTCCTCCTCTGG - Intronic
1195175579 X:102312306-102312328 CAGGGCAGCCCCGGCTCCAGTGG - Intronic
1195183285 X:102374787-102374809 CAGGGCAGCCCCGGCTCCAGTGG + Intronic
1197806317 X:130401906-130401928 CCGGTACGCCCCGGCTCTTCCGG + Intergenic
1202124516 Y:21556546-21556568 CCCGCAGACCCCGGCTCCTCAGG + Intergenic
1202154492 Y:21872834-21872856 CCCGCAGACCCCGGCTCCTCAGG - Intergenic