ID: 1147646148

View in Genome Browser
Species Human (GRCh38)
Location 17:42035291-42035313
Sequence GTGATCACCTTGGCATCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147646142_1147646148 12 Left 1147646142 17:42035256-42035278 CCCTGCATGTTTCTGGGACATAG 0: 1
1: 0
2: 3
3: 11
4: 182
Right 1147646148 17:42035291-42035313 GTGATCACCTTGGCATCTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 139
1147646139_1147646148 20 Left 1147646139 17:42035248-42035270 CCAGAGTGCCCTGCATGTTTCTG 0: 1
1: 0
2: 2
3: 21
4: 277
Right 1147646148 17:42035291-42035313 GTGATCACCTTGGCATCTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 139
1147646143_1147646148 11 Left 1147646143 17:42035257-42035279 CCTGCATGTTTCTGGGACATAGA 0: 1
1: 0
2: 1
3: 9
4: 134
Right 1147646148 17:42035291-42035313 GTGATCACCTTGGCATCTCTTGG 0: 1
1: 0
2: 2
3: 18
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147646148 Original CRISPR GTGATCACCTTGGCATCTCT TGG Intronic
901864563 1:12095960-12095982 GTGATGACCTGGGCAGCTCTGGG + Intronic
903834966 1:26197861-26197883 GAGATCAGCTTTGCCTCTCTGGG + Intronic
905691946 1:39949828-39949850 GTGGTCCCCTTGGCATTTCTAGG + Intergenic
906275033 1:44509012-44509034 GTGAGGACCGTGGAATCTCTGGG - Intronic
908115957 1:60940502-60940524 GAGATCATCTTGGAATATCTGGG - Intronic
910592902 1:88947166-88947188 GTGGTCACTGTGGCATATCTAGG - Intronic
910623047 1:89276829-89276851 TTGATCACCTTGACATCTAGTGG + Intergenic
911514064 1:98845622-98845644 GTTTTCACTTTGGCATTTCTTGG - Intergenic
912406074 1:109438666-109438688 GTTATCACCTTAGCAGGTCTTGG - Intergenic
917477026 1:175377828-175377850 GTGAGCACATTGGCAGCTCCTGG + Intronic
918526043 1:185466115-185466137 GTGGTCACCTGGGCATCTCTGGG + Intergenic
919076626 1:192821494-192821516 ATGTTCACCATGTCATCTCTGGG + Intergenic
923246058 1:232133495-232133517 GTGACCACATTGGCCACTCTGGG - Intergenic
923633368 1:235670606-235670628 TTGGTCACCATGGCATCTGTAGG - Intronic
924362164 1:243254125-243254147 TTGATCACCTTGGCAGTGCTTGG + Intronic
1064299344 10:14109102-14109124 GTGAGGAGCTTGGAATCTCTTGG - Intronic
1066751591 10:38662978-38663000 ACGATCAACTTGGCATCCCTAGG + Intergenic
1066965443 10:42260112-42260134 ATGATCAAGTTGGCATCCCTAGG - Intergenic
1068097961 10:52515700-52515722 TTGAGCACCCTGACATCTCTAGG + Intergenic
1068688655 10:59894267-59894289 GTGACCAGCTGGGCAACTCTGGG - Intronic
1071397118 10:85235153-85235175 GTGATGAACTTGCCACCTCTAGG + Intergenic
1073358704 10:102878909-102878931 GTAAATAACTTGGCATCTCTTGG - Exonic
1074842597 10:117370319-117370341 TTGAGCAACTTAGCATCTCTAGG + Intronic
1075089153 10:119433520-119433542 GTGATCACCTGGGCAGATGTGGG + Intronic
1075744799 10:124719412-124719434 GAGTTCACCTTGGCATCCCAAGG - Intronic
1080786581 11:35480328-35480350 GTGATAACCCTGGCAACTTTGGG - Intronic
1083718764 11:64593670-64593692 GTGATGACCTTGAACTCTCTGGG + Exonic
1085526814 11:77168828-77168850 GTGAGCACCTTGGCCTCTCTGGG - Intronic
1089815132 11:121166135-121166157 GTGCTCACCTGGGAATCACTAGG + Intronic
1096118419 12:49069940-49069962 GTGATCACGTGGGCAGCTCCGGG - Exonic
1096478885 12:51924860-51924882 GTGAGGACTTTGCCATCTCTTGG - Intergenic
1096992227 12:55814220-55814242 GTGATCAGCTTGTATTCTCTTGG - Intronic
1098198936 12:68034542-68034564 GTAATCTCCTTGGCATATCTGGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1102463854 12:113116440-113116462 GTGTTCCCATTGGCCTCTCTTGG - Intronic
1102998434 12:117366953-117366975 GGAAACTCCTTGGCATCTCTGGG + Intronic
1103436842 12:120933303-120933325 GTGAGTAGCTTGGCCTCTCTGGG - Intergenic
1105759826 13:23503531-23503553 CTGTGCACCTTGGCGTCTCTGGG - Intergenic
1106678865 13:31989464-31989486 GTTATCACTTTGTCATTTCTTGG + Intergenic
1107428940 13:40321327-40321349 GTGATCACTTTGAAAGCTCTAGG + Intergenic
1110925274 13:81142937-81142959 TTGATCATCTTGGCATCCCATGG + Intergenic
1112463728 13:99625105-99625127 TTCATCACCTTGGCCTGTCTTGG + Intronic
1112924831 13:104661213-104661235 GTGATGCCCTTGGCAACTCTGGG + Intergenic
1116340987 14:43722867-43722889 ATGAGCACATGGGCATCTCTGGG - Intergenic
1119132771 14:72190131-72190153 CTGATCATCTGGGCCTCTCTGGG + Intronic
1122022645 14:98851817-98851839 GTGTTCACCTGGTCCTCTCTGGG - Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122139616 14:99654822-99654844 GTGATAAACTTGGTCTCTCTTGG - Intronic
1126183659 15:45810308-45810330 GTGATTAAATTGGAATCTCTGGG + Intergenic
1126717401 15:51533602-51533624 GTGCACACCTTGACATCACTTGG - Intronic
1130081471 15:80737741-80737763 GTCATCACCTGGACAACTCTGGG - Intronic
1131023865 15:89123012-89123034 GCGATTACCTTTGCATCTCTGGG - Intronic
1132559411 16:586572-586594 GTAGTCACGTTGGCATCACTGGG - Intergenic
1136731134 16:32414124-32414146 ATGATCAAGTTGGCATCTCTAGG - Intergenic
1137492607 16:48945327-48945349 GTTTTCACCTTTGCATTTCTAGG + Intergenic
1137559676 16:49494625-49494647 CTGAGCACCTGGGCACCTCTGGG - Intronic
1138118396 16:54378714-54378736 GTGATTTCCTTTGAATCTCTGGG + Intergenic
1139970479 16:70771093-70771115 TGGGTGACCTTGGCATCTCTGGG - Intronic
1202995259 16_KI270728v1_random:103146-103168 ATGATCAAGTTGGCATCTCTAGG + Intergenic
1203021946 16_KI270728v1_random:415488-415510 ATGATCAAGTTGGCATCTCTAGG + Intergenic
1142815039 17:2418718-2418740 CTGGTGACCTTGGCATGTCTTGG - Exonic
1146278704 17:31531373-31531395 CTGATCACATTGGAATCTCTGGG + Intronic
1147646148 17:42035291-42035313 GTGATCACCTTGGCATCTCTTGG + Intronic
1150248684 17:63694199-63694221 GAGACCACCAGGGCATCTCTGGG + Exonic
1150811047 17:68357491-68357513 GGGATCACCTTGGATTCTCCTGG - Intronic
1151131416 17:71901009-71901031 TTCATTACCTTGGCATCTCAGGG - Intergenic
1153545628 18:6202446-6202468 AAGATCACTTTGGCATCTTTGGG + Intronic
1155703333 18:28777623-28777645 GTGTTCACTTTTGAATCTCTAGG + Intergenic
1156097473 18:33552246-33552268 TTCTGCACCTTGGCATCTCTTGG + Intergenic
1157739232 18:50077449-50077471 CGGATCACCTTAGCATCTCATGG - Intronic
1158048351 18:53184721-53184743 GGGACCACCTTGGTATATCTGGG + Intronic
1159211158 18:65324296-65324318 GTGATCCCTTAGGTATCTCTTGG - Intergenic
1165322849 19:35096915-35096937 GGGAGCACCTTGTCATCACTGGG - Intergenic
1166046925 19:40235315-40235337 ATGACCTCCTTGGCATCGCTGGG + Exonic
1167025452 19:46913365-46913387 GGGATCACGGTGGCATTTCTAGG + Intergenic
1168199329 19:54803670-54803692 GTCATCATCCTGGCATGTCTTGG + Exonic
926225789 2:10966106-10966128 GTGGTCACCGTGGTAGCTCTGGG - Intergenic
934314577 2:91905133-91905155 ATGATCAAGTTGGCATCCCTAGG + Intergenic
935058399 2:99587611-99587633 GCACTCACCTTGGCATTTCTTGG + Intronic
935718071 2:105955930-105955952 ATGATCACATTGGCAACACTTGG - Intergenic
936812576 2:116419587-116419609 CTGCTCAACTTTGCATCTCTAGG + Intergenic
941573425 2:167200278-167200300 GTGATCACCTGGGCTGGTCTAGG + Intronic
942342396 2:174961944-174961966 GTAATTTCCTTGGCATATCTAGG + Intronic
945764501 2:213958255-213958277 GTGGTTGCCTTGGCATGTCTTGG + Intronic
1169200646 20:3707545-3707567 GTGAGTAACTGGGCATCTCTGGG - Intergenic
1169582750 20:7043190-7043212 TTTATCACCTTGGAATCTTTGGG + Intergenic
1171256607 20:23693358-23693380 GTCATCTCCTCGACATCTCTGGG + Intergenic
1171263962 20:23755289-23755311 GTCATCTCCTTGACATCTCTGGG + Intergenic
1171273156 20:23832135-23832157 GTCATCTCCTTGACATCTCTGGG + Intergenic
1171284572 20:23926410-23926432 GCAATCCCCTTGGCATCTCTGGG + Intergenic
1172631559 20:36381905-36381927 CTGATCCCCTTGGAATCTCATGG + Intronic
1174663218 20:52233808-52233830 GTGCTCACCAGGGCATCTCTGGG + Intergenic
1174927661 20:54778241-54778263 GTGCTCACTGTGGCATCTCCTGG - Intergenic
1175602195 20:60283897-60283919 GTTATCACTTTGGCAGCTTTAGG - Intergenic
1179110814 21:38443449-38443471 GTGATCACGCTGGCATATATGGG + Intronic
1179133924 21:38662418-38662440 GAGCTCATTTTGGCATCTCTAGG - Intergenic
1180023075 21:45141719-45141741 AGGATCACCTTAGCATCCCTGGG + Intronic
1180023100 21:45141817-45141839 AGGATCACCTTAGCATCCCTGGG + Intronic
1181411295 22:22721628-22721650 GTGAGCACTGTGGCATCCCTTGG + Intergenic
1183210706 22:36449616-36449638 GTGAGCGCCTTCCCATCTCTGGG + Intergenic
1184842626 22:47061325-47061347 CTGCACACCTGGGCATCTCTGGG - Intronic
950477762 3:13224580-13224602 GTGCTCACCAGGGCATGTCTTGG + Intergenic
961774806 3:129277398-129277420 GACATCATCTTGGCATCTGTGGG + Exonic
962579359 3:136783889-136783911 GTGATCACTCTGGCATCCCAAGG + Intergenic
963146690 3:142001717-142001739 GGGATCAACATGGCTTCTCTTGG - Intronic
963336909 3:143985774-143985796 ATGATTACCTTCCCATCTCTAGG - Exonic
963517502 3:146326654-146326676 GGAATCACACTGGCATCTCTTGG + Intergenic
964296428 3:155239378-155239400 GGGAACACCTTGGCCTCTCCAGG - Intergenic
964636185 3:158860371-158860393 GTGACAACCTTGGCATCTCCAGG + Intergenic
967256773 3:187601156-187601178 GAGATCACTTTGACATCTCTGGG + Intergenic
969364393 4:6685741-6685763 GTGTTGACCTTGGCAGCACTGGG + Intergenic
969983176 4:11179796-11179818 GTGTTTTCCTTGGCATCCCTGGG + Intergenic
970455442 4:16219136-16219158 GAGATCTCCTTAGCCTCTCTGGG - Intronic
970728002 4:19069952-19069974 GTGATCACTTTGGGGACTCTTGG + Intergenic
975704225 4:77095922-77095944 TTGATCAGCTTGGTTTCTCTGGG - Intergenic
978349758 4:107809257-107809279 GTGATCATCTTTGCTTCCCTGGG - Intergenic
980655374 4:135776094-135776116 GTGATCAGTCTGGCATCTCATGG + Intergenic
981104808 4:140868147-140868169 CAGATCACCTTGGCAACTCCAGG - Exonic
985718249 5:1475019-1475041 GAGCTCACTTTGGCGTCTCTGGG - Intronic
985964584 5:3330234-3330256 GAGATCATCCTGGCCTCTCTGGG - Intergenic
986095141 5:4547260-4547282 CTGATGACCTTGGCATGTCTGGG - Intergenic
986284679 5:6350659-6350681 GTGATCACTTCGGCTTCTTTGGG + Intergenic
990488693 5:56283281-56283303 CTGATCACCTTGGTGTCTCCTGG + Intergenic
992177583 5:74165473-74165495 GCCATCACCTGGGAATCTCTTGG + Intergenic
997090394 5:130849835-130849857 GGAAGCACCTTGGCATCTTTAGG + Intergenic
1001050966 5:168414213-168414235 TTGATCAGCTTGTCATCTCAAGG - Intronic
1002129067 5:177068479-177068501 GTGGCCACCTTGGCACCTCTTGG - Intronic
1002424600 5:179167687-179167709 GAGGTCACCTGGGCAGCTCTAGG + Intronic
1005141952 6:22642238-22642260 CTAATCATCTTTGCATCTCTAGG + Intergenic
1006621647 6:35368978-35369000 GTGCTAACCTAGGTATCTCTAGG - Intronic
1011891142 6:92161562-92161584 GTCAACACCTAGGCATATCTTGG - Intergenic
1015356523 6:132283295-132283317 TCGATCACCTTGACATCTTTAGG - Intergenic
1017407516 6:154136100-154136122 GTGATCACCCAGGACTCTCTGGG - Intronic
1021918443 7:25458692-25458714 GTGAGCATTTTGGCACCTCTAGG - Intergenic
1027261852 7:76470405-76470427 ATGATTACCTTGACTTCTCTGGG - Exonic
1029113035 7:98223195-98223217 GTGGTCACCTTGGGGTCCCTGGG - Intronic
1038578716 8:28728302-28728324 GTGCTCACCTTAGCAGCTGTCGG - Intronic
1039374863 8:37023260-37023282 GTGCTCACCCTGGCGTCTTTTGG - Intergenic
1039957441 8:42218157-42218179 GGGATGCCTTTGGCATCTCTGGG - Intergenic
1041343880 8:56875266-56875288 TTGCTCACATTGGCCTCTCTCGG - Intergenic
1044021730 8:87113134-87113156 AGGATCACCTGGGCATCCCTGGG + Intronic
1047025270 8:120816738-120816760 TTGATCATCTTTGCATCCCTGGG - Intergenic
1049152726 8:141045845-141045867 GTAATCTCATTGGCATCTCCTGG - Intergenic
1049407248 8:142457276-142457298 GTGATCACCTTGCCTTCTGCAGG + Intronic
1049532327 8:143160584-143160606 GAGATCCCCTTGGAATTTCTCGG + Exonic
1051137967 9:13944588-13944610 GTGAGCTCTGTGGCATCTCTGGG - Intergenic
1051399847 9:16668906-16668928 GTCATCTCCTTTGCATCTCATGG - Intronic
1052340338 9:27358858-27358880 GTGGACATCTTGGCATCTCCTGG + Intronic
1055121066 9:72661449-72661471 GCAATCACCTTAGCCTCTCTAGG + Intronic
1055464411 9:76550073-76550095 GTGATCACTGTGGCATATCTGGG - Intergenic
1056590692 9:87963880-87963902 GTGATCACCTTGGCTGCTGGGGG + Intergenic
1059446385 9:114340823-114340845 TTGATGACCTGGACATCTCTGGG - Intronic
1059651122 9:116316985-116317007 ATGATCATCTTGGCATCTAGTGG + Intronic
1060559586 9:124531819-124531841 TTTATCTCCTTGACATCTCTTGG + Intronic
1060679714 9:125551413-125551435 GAGACTACCTTGGCTTCTCTTGG - Intronic
1061877074 9:133549466-133549488 CTGATGCCCTGGGCATCTCTTGG - Intronic
1186545279 X:10442633-10442655 GAGATTACCTTGGCTGCTCTGGG + Intergenic
1186625419 X:11287997-11288019 GTGTTCGCCTGAGCATCTCTGGG - Intronic
1199676190 X:150191188-150191210 GTGATGATCTTGCCATCTCCTGG + Intergenic
1201182491 Y:11362594-11362616 ATGATCAAGTTGGCATCCCTAGG + Intergenic