ID: 1147648688

View in Genome Browser
Species Human (GRCh38)
Location 17:42049970-42049992
Sequence TGGACAGAGCTGCTATAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147648686_1147648688 -8 Left 1147648686 17:42049955-42049977 CCCAGAAAGTTCTATTGGACAGA 0: 1
1: 2
2: 16
3: 34
4: 186
Right 1147648688 17:42049970-42049992 TGGACAGAGCTGCTATAAACAGG 0: 1
1: 0
2: 3
3: 24
4: 188
1147648687_1147648688 -9 Left 1147648687 17:42049956-42049978 CCAGAAAGTTCTATTGGACAGAG 0: 1
1: 2
2: 11
3: 29
4: 153
Right 1147648688 17:42049970-42049992 TGGACAGAGCTGCTATAAACAGG 0: 1
1: 0
2: 3
3: 24
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147648688 Original CRISPR TGGACAGAGCTGCTATAAAC AGG Intronic
901962246 1:12836639-12836661 TGGATAGTGCTGCAATAAATAGG - Intergenic
905183261 1:36179146-36179168 TGGAGAGGGCTGCTATGAGCTGG + Intronic
905739361 1:40356270-40356292 TGAACAGTGCTGCAATAAACAGG + Intronic
905782853 1:40727914-40727936 AGGACACAGCTGCCATAGACAGG - Intronic
906495092 1:46300018-46300040 TGGACAGAGATGCCATTGACAGG - Intronic
908653364 1:66360765-66360787 AGGAAAGAGCTTCTATAAGCAGG + Intronic
909290651 1:73878863-73878885 TGGAAAGAGCTGGAAAAAACTGG + Intergenic
911223564 1:95278304-95278326 TGGACTGAGCAGCTAGAATCAGG + Intergenic
911877555 1:103187730-103187752 TGGAGAAAGCTGCTTTAAGCTGG - Intergenic
912284765 1:108357405-108357427 TGGACAGAGTTGCTTTCAACTGG - Intergenic
912392928 1:109317294-109317316 TGGACAGTGCTGCTCTAGACGGG - Intronic
912984087 1:114408906-114408928 TGGACACAGCTGAGAGAAACTGG - Intronic
915141866 1:153772988-153773010 TGGACAGAGCTGCTTTTCGCCGG - Exonic
915794085 1:158708369-158708391 TGAATAGTGCTGCTATAAACAGG - Intergenic
919102928 1:193116182-193116204 TGAAAGGAGCTGCTATAAATAGG - Intergenic
919122735 1:193361424-193361446 TGAACTGTACTGCTATAAACAGG - Intergenic
922325653 1:224525896-224525918 TGGACAGGCCTGCCATACACTGG + Intronic
923820008 1:237428301-237428323 TGAATAGTGCTGCAATAAACAGG - Intronic
1062997039 10:1875538-1875560 TGAATAAAGCTGCTGTAAACAGG + Intergenic
1064692055 10:17928405-17928427 TGAACAATGCTGCTATGAACAGG + Intergenic
1067196860 10:44127479-44127501 TGAATAAAGCTGCTATAAAAAGG - Intergenic
1067924942 10:50498751-50498773 TGAATAATGCTGCTATAAACCGG + Intronic
1069233349 10:66039598-66039620 TGGACAAAGCTGACAAAAACAGG + Intronic
1069794281 10:71042361-71042383 TGGACAGAGCTGAGCTACACAGG + Intergenic
1070623834 10:78034400-78034422 TGGAAAGAGATGTTATAAAAAGG + Intronic
1072405091 10:95143963-95143985 TGAATAGTGCTGCTATGAACAGG + Intergenic
1072409443 10:95186340-95186362 TGAATAGTGCTGCAATAAACTGG - Intergenic
1073532055 10:104241283-104241305 TGGTCATCGCTGCTATAAAAGGG - Intronic
1073612174 10:104955461-104955483 TGAATAGAGCTGCTATGAACAGG + Intronic
1074756004 10:116624584-116624606 TGGGCAGACCTGCTGAAAACTGG - Intronic
1074841326 10:117354682-117354704 TAGAACGAGCAGCTATAAACAGG + Intronic
1075093657 10:119457242-119457264 AGGACTGAGCTGCTATGAACTGG - Intronic
1079926882 11:26505272-26505294 GGGACAGAGTTGCAATCAACCGG + Intronic
1084062064 11:66682406-66682428 TGGATAGCACTGCTATAAATGGG - Intergenic
1085369392 11:75985092-75985114 TGGACAGAGGGGAGATAAACTGG - Intronic
1085553580 11:77398623-77398645 TGAACAGTGCTGCAACAAACAGG + Intronic
1086576357 11:88342549-88342571 AGGCCATCGCTGCTATAAACTGG - Intergenic
1088043834 11:105422910-105422932 CGAACAAAACTGCTATAAACAGG + Intergenic
1088126319 11:106428527-106428549 TCAACAGAGCTGCTATAAGCAGG + Intergenic
1091623875 12:2108120-2108142 TGGACAGTGTTGCTATAGACTGG + Intronic
1091948562 12:4571831-4571853 TGGACAGTGCTGCTCTAGAATGG + Intronic
1093914373 12:24784675-24784697 TGTACAGATGTGCTATACACAGG - Intergenic
1095213161 12:39517587-39517609 TGAACAGTGCTGCAACAAACAGG - Intergenic
1097138001 12:56875452-56875474 CTGACAGATCAGCTATAAACTGG - Intergenic
1097610810 12:61817693-61817715 TGCACAGAGCAGCCATAAAAAGG + Intronic
1101483405 12:105125045-105125067 TGGAGAGCGCTGCTTTAAGCAGG + Intronic
1103942406 12:124508222-124508244 TGGACAGAGCTGACGTAAAGTGG - Intronic
1105335899 13:19468456-19468478 TGAACAGTGCTGCAACAAACAGG + Intronic
1105770067 13:23600839-23600861 TAGAAGGAGCTGCTATAAACAGG - Intronic
1105790560 13:23794092-23794114 TGGATAGAGCAGCTCTAGACTGG - Intronic
1107326757 13:39252127-39252149 TGGACAGACAAGCTGTAAACTGG - Intergenic
1108391218 13:49949725-49949747 TGAATTGTGCTGCTATAAACAGG - Intergenic
1109796352 13:67318287-67318309 TGGACTCAACTGCTTTAAACTGG + Intergenic
1110448206 13:75611978-75612000 TGGATAGTGCTGCGCTAAACAGG + Intergenic
1113430890 13:110249363-110249385 TGGATAGTGCTGCTGTGAACAGG - Intronic
1113562893 13:111297830-111297852 TGGAAACAGATGATATAAACAGG + Intronic
1114347776 14:21814883-21814905 TGAACAGTGCTGCAACAAACGGG - Intergenic
1118128259 14:62933914-62933936 AAGACAGAGCTGAGATAAACCGG - Intronic
1121448576 14:93993751-93993773 AGGACAGAGCTGCAATTAAATGG - Intergenic
1122266818 14:100550522-100550544 AGGACAGAGCTGCTCAGAACAGG + Intronic
1122436923 14:101706725-101706747 TGGACAGAGCTGGTAAATATTGG + Intergenic
1122748787 14:103917820-103917842 TGGAGAAAGCTCCTATAAAGCGG + Intronic
1123673093 15:22680219-22680241 TGGAAAGAGCTCCTCTAAATGGG - Intergenic
1124325148 15:28753512-28753534 TGGAAAGAGCTCCTCTAAATGGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1126567787 15:50117705-50117727 TGAATAGTGCTGCAATAAACAGG - Intronic
1128177639 15:65570242-65570264 AGAACAGAGCTGCTGCAAACAGG - Intronic
1128521729 15:68379773-68379795 AGGAGAAAGCTGCTATAAAGTGG - Intronic
1129429833 15:75491552-75491574 TGGACAGAGCTGATAGAATTTGG + Intronic
1129469801 15:75745714-75745736 AGGGCAGAGCTCCCATAAACAGG - Intergenic
1130319147 15:82825448-82825470 TGGAAAGAGCTCCTCTAAATGGG - Intronic
1131869847 15:96752006-96752028 TGGAAAGACAAGCTATAAACTGG + Intergenic
1131965243 15:97835201-97835223 TGGACTGAGCTGGTAAAAGCAGG - Intergenic
1134305590 16:13029188-13029210 TGAACAGTGCTGCAACAAACAGG - Intronic
1135803930 16:25524902-25524924 TGAATAGTGCTGCAATAAACAGG + Intergenic
1137315740 16:47320255-47320277 TTGAAAGGGCTGCTACAAACTGG - Intronic
1137480718 16:48849803-48849825 AGCACAGAGCTGCTTTAAAAAGG - Intergenic
1139490370 16:67282694-67282716 TGAAGAGAGCTGCTATGGACTGG - Intronic
1140566711 16:76051348-76051370 TGAACAGTGTTGCAATAAACAGG + Intergenic
1143685088 17:8507394-8507416 TGGAAAGAGCAGCTAGAGACTGG - Intronic
1144963836 17:19063018-19063040 TGGATAAAGCTGCTATAAACAGG - Intergenic
1144984108 17:19189119-19189141 TGGATAAAGCTGCTATAAACAGG - Intergenic
1145263498 17:21368306-21368328 TGGAAAGAGATGCCAGAAACTGG - Intergenic
1145847944 17:28059506-28059528 TGGACACAGTTTCTATTAACTGG - Intronic
1146314911 17:31799069-31799091 TGGACAGTGCTGCTATAAAGAGG - Intergenic
1147648688 17:42049970-42049992 TGGACAGAGCTGCTATAAACAGG + Intronic
1148144015 17:45349482-45349504 TGAATCGTGCTGCTATAAACAGG - Intergenic
1149158527 17:53663451-53663473 TGAATAGTGCTGCAATAAACAGG - Intergenic
1149923867 17:60683175-60683197 TAGACTGACCTGCTATATACAGG + Intronic
1150297694 17:64022227-64022249 TGAATAGTGCTGCTACAAACAGG + Intergenic
1150297900 17:64023830-64023852 TGAATAGTGCTGCTATCAACAGG + Intergenic
1152207456 17:78981771-78981793 TGGACAGAACTGCTGTCATCAGG + Intergenic
1157398289 18:47362534-47362556 TGACTAGAGCTGCTATTAACAGG + Intergenic
1157519337 18:48334625-48334647 TGGCCAGAGCTGCCATTCACAGG + Intronic
1158866410 18:61641835-61641857 TGCACAGAGCTGATAAAACCTGG - Intergenic
1159388200 18:67754665-67754687 TGAACACAGCTCCTCTAAACAGG + Intergenic
1165101089 19:33439189-33439211 TGGACAGGGCTCCCATAACCTGG + Intronic
925032379 2:660922-660944 AGGACAGAGCTGCTGTGCACCGG + Intergenic
925954449 2:8948781-8948803 TGAACAGTGCTGCGATTAACAGG + Intronic
926181811 2:10651339-10651361 TGGACAGTGCTGGTCTAAACTGG - Intronic
926455760 2:13067278-13067300 TGGAAAGAGCTGGTATGAAAAGG + Intergenic
928799997 2:35077627-35077649 TGCAAACAGCTGCTATAAAGAGG + Intergenic
928907709 2:36384832-36384854 TGGACAGTAGTGCTATAAACTGG - Intronic
930167283 2:48215282-48215304 TGCACAGTGCTACTATAATCTGG + Intergenic
930569626 2:53069105-53069127 TGATAACAGCTGCTATAAACAGG + Intergenic
932063892 2:68532913-68532935 TGGATAATGCTGCTATAAAAAGG + Intronic
934547436 2:95229878-95229900 CTGACAGAGGTGCTGTAAACTGG - Intronic
936812805 2:116422362-116422384 TAGAAAGAACTGCTATAAGCTGG + Intergenic
937095439 2:119232442-119232464 TGGGCACAGCTGCAATAACCAGG - Intronic
937159702 2:119748286-119748308 TGGCCAGGGCTGCTATCATCTGG - Intergenic
937985629 2:127636949-127636971 AGGACAGAGCTGCTGGAGACTGG + Intronic
939222335 2:139318327-139318349 TGGACAGAGTTAATTTAAACTGG - Intergenic
941302538 2:163821639-163821661 TGAACAGTGCTGCAACAAACAGG + Intergenic
942454432 2:176128620-176128642 TGGAGAGAGCTGCTAAAATCGGG + Intergenic
942798037 2:179844071-179844093 TGGACCGATCTGCTATAAAAAGG - Intronic
942994575 2:182245789-182245811 TGAATAAAGCTCCTATAAACAGG + Intronic
945013938 2:205494474-205494496 TGTAGAGAGCTGGTATAAAACGG - Intronic
946655504 2:221941658-221941680 TGGACAAAACTGTTGTAAACTGG - Intergenic
1169201821 20:3714235-3714257 TGGACACAGGAGCTATAAAGAGG - Intergenic
1169663920 20:8012834-8012856 TCTACATAGCTGCTATACACTGG + Intronic
1172613055 20:36266006-36266028 TGGAAAGAGCTGCTGGAACCGGG + Intronic
1173972727 20:47164976-47164998 TGGACAGCGCTGCTCTAGAGGGG - Intronic
1174373298 20:50108848-50108870 TGGCCAGAGATGCTATAAAAAGG + Intronic
1177224991 21:18242975-18242997 TGCCCAGAGCTACTGTAAACAGG - Intronic
1178058657 21:28827914-28827936 TTGACAGAGATGATATATACTGG - Intergenic
1178857971 21:36266067-36266089 TTGACAGACCAGCTCTAAACTGG + Intronic
1181507681 22:23371410-23371432 TGGACAGAGGTGCTAGAAAATGG - Intergenic
1181965199 22:26651592-26651614 TGAATAGCGCTGCTATGAACAGG - Intergenic
1182127004 22:27823196-27823218 TGAATAATGCTGCTATAAACAGG - Intergenic
1184445133 22:44542671-44542693 TGGGCAGAGCTGAAATGAACAGG - Intergenic
1184609620 22:45594505-45594527 TGCACAGAGGAGCTTTAAACAGG - Intronic
950568690 3:13787003-13787025 CGGACAGCGCAGCTATAAAGGGG + Intergenic
952371727 3:32729119-32729141 TGGAAAGAGCTGCATTAAGCTGG + Intronic
957814938 3:85285120-85285142 AGGACAAAGCTGCTATTTACTGG + Intronic
959250495 3:103936175-103936197 TGGATAGTGCTGCAATAAACAGG + Intergenic
961986790 3:131142911-131142933 TAGAAAGAGCTGGTATGAACAGG + Intronic
962637888 3:137349413-137349435 CCAACAGAGCTGCTATACACCGG - Intergenic
963011989 3:140778664-140778686 TTTAAAGAGCTGTTATAAACAGG + Intergenic
965077908 3:164002679-164002701 TGTACAGAGCAGCTCTAAGCTGG - Intergenic
969955025 4:10880310-10880332 TGGGCAGAGATGATATAATCTGG - Intergenic
970243539 4:14034346-14034368 TGAATAGTGCTGCAATAAACAGG - Intergenic
970447205 4:16134227-16134249 GGGGCAGAGCTACCATAAACAGG + Intergenic
974618882 4:64329440-64329462 TGGACAGAGCCTCTATTAATAGG + Intronic
977280581 4:95034716-95034738 TGAATTGTGCTGCTATAAACAGG + Intronic
978947924 4:114521332-114521354 TGAATTGTGCTGCTATAAACAGG + Intergenic
980933616 4:139205389-139205411 TGGACAGTGCTGCTCTGAACAGG + Intergenic
983943191 4:173557989-173558011 TGGACAGGGAAGCTCTAAACAGG + Intergenic
984058696 4:174964155-174964177 TGGAGATAGCTTCTATAAAGAGG + Intronic
984773045 4:183454870-183454892 TGGAAAGAGCTGCTAAAGAAAGG + Intergenic
985746166 5:1649259-1649281 TGAACAGTGCTGCAGTAAACAGG - Intergenic
986945467 5:13013182-13013204 TCGACAAAGCTGATAAAAACAGG - Intergenic
986991799 5:13562479-13562501 TGGAAAGACAAGCTATAAACTGG + Intergenic
987820496 5:22960355-22960377 TGGAATAAGCTGCTATAAAAAGG + Intergenic
990157228 5:52891169-52891191 TAAACAGTGCTGCAATAAACAGG + Intronic
990544663 5:56810877-56810899 TGGCCAAAGCTGCTATAAAGAGG - Intergenic
992878129 5:81077784-81077806 TGAGGAGAGCTGCTATAAAGAGG + Intronic
994656757 5:102603746-102603768 TTGACAGAGCTGACAAAAACAGG - Intergenic
995020164 5:107358079-107358101 TGTACAGAGCAGCTCTGAACAGG + Intergenic
997104640 5:131005049-131005071 TGAATTGTGCTGCTATAAACAGG - Intergenic
1003686278 6:8306040-8306062 TGAATAGTGCTGCAATAAACGGG + Intergenic
1003981473 6:11394294-11394316 TGTTCAGAGCTGGAATAAACTGG + Intergenic
1004001044 6:11597614-11597636 TGAATAGTGCTGCAATAAACAGG + Intergenic
1004891654 6:20106739-20106761 TGGACAGAGCTGATCTAGACAGG + Intronic
1005236500 6:23768099-23768121 TGGACACAGCAGCTCTAAAAAGG - Intergenic
1007804466 6:44429835-44429857 TGGGCAGAGCCGCTACACACGGG + Exonic
1010467142 6:76181428-76181450 TGAACAGTGCTGCAATGAACAGG - Intergenic
1012748495 6:103125354-103125376 TGAATAGTGCTGCAATAAACAGG + Intergenic
1015327849 6:131944301-131944323 TGGATAGTGCTGCAATGAACAGG - Intergenic
1016312819 6:142753009-142753031 AGGACAGGCATGCTATAAACTGG + Exonic
1017565911 6:155686367-155686389 TGGTCAGAGCTGCTATGATGAGG + Intergenic
1019752742 7:2742478-2742500 TGGACAGCGATGAGATAAACAGG - Intronic
1019889594 7:3935940-3935962 TGAATAGTGCTGCTATAAACAGG - Intronic
1022770654 7:33468946-33468968 TGAATAGTGCTGCTTTAAACAGG + Intronic
1023025898 7:36049347-36049369 TGGACAGGGCTGCCATCCACAGG - Intergenic
1023489318 7:40721104-40721126 TGAAGAGAGCTGCTACAGACTGG - Intronic
1024050495 7:45618913-45618935 TGAATAGTGCTGCAATAAACAGG - Intronic
1028415349 7:90574580-90574602 TGGGCAGGGCTGCTTTAAAAGGG + Intronic
1028788668 7:94827320-94827342 TGTGCACAGCTGCTATAAGCTGG + Intergenic
1029332185 7:99867761-99867783 TGAATAGTGCTGCAATAAACTGG + Intergenic
1030653466 7:112140719-112140741 TGTGCAGAGCTGCTATAAAGAGG - Intronic
1031386346 7:121156388-121156410 TGAATAGCGCTGCAATAAACAGG - Intronic
1032894742 7:136237779-136237801 TGGACAGAGTTGCTCTAGCCGGG + Intergenic
1033297127 7:140150156-140150178 TGGTCAAAGCTGCTAGAAACAGG - Intronic
1036526759 8:9541987-9542009 TGAACTGTGCTGCTATAGACTGG - Intergenic
1036926495 8:12911498-12911520 TGAATAGTGCTGCTATGAACAGG - Intergenic
1038235652 8:25751375-25751397 TGAACAAAGCTACTTTAAACAGG - Intergenic
1040640227 8:49324872-49324894 TGGCCAGAGTTGCATTAAACTGG + Intergenic
1044476041 8:92627675-92627697 TGGCCAGAGCTGCATTAACCAGG + Intergenic
1047144928 8:122187716-122187738 TGGAAAGAACTGCAAGAAACAGG - Intergenic
1049033067 8:140051296-140051318 TGGACAGAGCAGCTCCACACTGG + Intronic
1050354478 9:4769865-4769887 AGGTCAAAGCTGCTCTAAACGGG + Intergenic
1051463001 9:17345154-17345176 TGAATACAGCTGCTATAGACAGG + Intronic
1052726433 9:32233512-32233534 TGAATAGTGCTGCAATAAACAGG - Intergenic
1055700491 9:78939815-78939837 TAGACAGAGATGCTTTAAAGGGG + Intergenic
1055749384 9:79487907-79487929 TAGCCCGAGCTGCCATAAACAGG + Intergenic
1056571083 9:87815375-87815397 TGAACAGTGCTGCAGTAAACTGG + Intergenic
1057134719 9:92679789-92679811 TGGACAGAGCCTCTATAGGCAGG + Intergenic
1061561906 9:131410055-131410077 TGGACAGATGTGCTATACAAAGG - Intronic
1185818501 X:3179672-3179694 TGGACAGTTCTGCTTTAAACTGG + Intergenic
1187588215 X:20687469-20687491 TGAACAGCGCTGCAACAAACAGG + Intergenic
1187877802 X:23818589-23818611 TGAACAGTACTGCTATGAACAGG + Intergenic
1188675050 X:32929259-32929281 TGGACACAGCTGATATAATTTGG - Intronic
1189192924 X:39126459-39126481 AGGATAGAGCTTCTAGAAACTGG - Intergenic
1190890321 X:54561749-54561771 TCGAGAGAGCTGCTATATATGGG + Intergenic
1193195032 X:78621349-78621371 TGGACAGAGCAGGTCTAAAGTGG + Intergenic
1195528215 X:105919615-105919637 TGTACATTGCTGCTATAAAAAGG + Intronic
1196106350 X:111900209-111900231 TGGTCAGAACTGCTGAAAACTGG + Intronic
1196212319 X:113009944-113009966 TGGTCACAGCTGGTATAAGCCGG - Intergenic
1196305144 X:114093411-114093433 TGAATAGTGCTGCAATAAACAGG - Intergenic
1196308354 X:114130714-114130736 TGAACAGTGCTGCAACAAACAGG + Intergenic
1196849066 X:119920263-119920285 TTAAGAGAGCTGCTATAAAAGGG - Intronic
1199035575 X:143046200-143046222 TGAACAGTGCTGCAACAAACAGG + Intergenic
1199163602 X:144644594-144644616 TGGATAGTGTTGCAATAAACAGG - Intergenic
1199906019 X:152231715-152231737 TGAATAAAGCTGCTATAAACAGG - Intronic
1200476420 Y:3645837-3645859 TGGCCAGAGCTGTTTTAACCTGG + Intergenic
1202595918 Y:26539856-26539878 TGAACAGTGCTGCAACAAACAGG - Intergenic