ID: 1147652320

View in Genome Browser
Species Human (GRCh38)
Location 17:42069628-42069650
Sequence GTGGCTGTTGGCTGACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147652320_1147652334 16 Left 1147652320 17:42069628-42069650 CCTCCATGTCAGCCAACAGCCAC No data
Right 1147652334 17:42069667-42069689 CCTACTTCCCAGACCAGGCCAGG No data
1147652320_1147652331 11 Left 1147652320 17:42069628-42069650 CCTCCATGTCAGCCAACAGCCAC No data
Right 1147652331 17:42069662-42069684 CCCAGCCTACTTCCCAGACCAGG No data
1147652320_1147652339 28 Left 1147652320 17:42069628-42069650 CCTCCATGTCAGCCAACAGCCAC No data
Right 1147652339 17:42069679-42069701 ACCAGGCCAGGCTGGCTGGCCGG No data
1147652320_1147652335 20 Left 1147652320 17:42069628-42069650 CCTCCATGTCAGCCAACAGCCAC No data
Right 1147652335 17:42069671-42069693 CTTCCCAGACCAGGCCAGGCTGG No data
1147652320_1147652338 24 Left 1147652320 17:42069628-42069650 CCTCCATGTCAGCCAACAGCCAC No data
Right 1147652338 17:42069675-42069697 CCAGACCAGGCCAGGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147652320 Original CRISPR GTGGCTGTTGGCTGACATGG AGG (reversed) Intergenic
No off target data available for this crispr