ID: 1147654507

View in Genome Browser
Species Human (GRCh38)
Location 17:42081162-42081184
Sequence CTGGGTTAGGGGAAGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147654499_1147654507 -3 Left 1147654499 17:42081142-42081164 CCCTCATGGAACTTGCAAATCTG No data
Right 1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG No data
1147654498_1147654507 5 Left 1147654498 17:42081134-42081156 CCAAAGGGCCCTCATGGAACTTG No data
Right 1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG No data
1147654500_1147654507 -4 Left 1147654500 17:42081143-42081165 CCTCATGGAACTTGCAAATCTGG No data
Right 1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147654507 Original CRISPR CTGGGTTAGGGGAAGAAGGA TGG Intergenic
No off target data available for this crispr