ID: 1147659608

View in Genome Browser
Species Human (GRCh38)
Location 17:42110607-42110629
Sequence CCTGCCATGGAGAGCCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147659594_1147659608 26 Left 1147659594 17:42110558-42110580 CCATAAGAAACCATTGGAGGCTG 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1147659608 17:42110607-42110629 CCTGCCATGGAGAGCCTGGTAGG 0: 1
1: 0
2: 4
3: 30
4: 243
1147659598_1147659608 16 Left 1147659598 17:42110568-42110590 CCATTGGAGGCTGGGTCTTAGGT 0: 1
1: 0
2: 1
3: 4
4: 131
Right 1147659608 17:42110607-42110629 CCTGCCATGGAGAGCCTGGTAGG 0: 1
1: 0
2: 4
3: 30
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147659608 Original CRISPR CCTGCCATGGAGAGCCTGGT AGG Intronic
900489945 1:2942827-2942849 CCTGACAGGAAGAGGCTGGTCGG + Intergenic
900594268 1:3473350-3473372 CTGGCCATGCAGAGCCTGGAAGG + Intronic
900641613 1:3690390-3690412 CCGGCCCTGGAGATCATGGTAGG - Intronic
900956547 1:5889631-5889653 CCCACCATGCAGAGCCTGCTGGG + Intronic
901173014 1:7277560-7277582 TCTGCCATGGAGGGCCTTCTTGG - Intronic
901718439 1:11175724-11175746 CCTGCTAGGGAGAGCCTGAGAGG - Intronic
901917863 1:12513692-12513714 CATGCCCTGGAGTGCCTGGCTGG - Intergenic
902816022 1:18917259-18917281 CCTGCCCTGGGCGGCCTGGTGGG + Intronic
903620187 1:24692513-24692535 GCTGCTATGGAGAGCCCGCTTGG - Intergenic
903808526 1:26021963-26021985 CCTGCCTTGGAGGGCCAGGAGGG - Exonic
904003618 1:27351804-27351826 CCTTCCATAGAGAACCTGGGAGG + Intronic
904038505 1:27571341-27571363 CCTGCCCTGGGGAGTCTGATGGG + Intronic
905587909 1:39135977-39135999 ACTGCCCTGGAAAGCCAGGTTGG - Intronic
906805845 1:48777896-48777918 CTTGCCAAAGAGAGCCTGGAGGG + Intronic
907108697 1:51906976-51906998 TCAGGCATGGAGACCCTGGTGGG - Intergenic
907779415 1:57552125-57552147 ACAGCCAGGGAGAGTCTGGTGGG + Intronic
909346354 1:74592023-74592045 CCTGTCATGGAGAGCCGGCAGGG - Intronic
912429130 1:109620000-109620022 CCTGCAATCGAGAGGCTGGTAGG - Intronic
912953182 1:114134672-114134694 CCTGACATGGAGAACCTTGTTGG + Intronic
915495591 1:156280527-156280549 CCTGGCATCGAGGGCCAGGTTGG - Intronic
915511766 1:156390549-156390571 CCTGCCAAGAAGAGCAGGGTGGG - Intergenic
916213500 1:162376825-162376847 CCTGCTCTGGAGAGGCTGGCTGG + Exonic
917497296 1:175552346-175552368 CCTGCCATTCAGAGCATTGTGGG - Intronic
917675694 1:177317133-177317155 CCAGAAATGGACAGCCTGGTGGG - Intergenic
920517002 1:206592584-206592606 GCTGCCAGAGAGAGCCTGGCAGG + Intronic
920536135 1:206737678-206737700 CCTGCCCTTGAGAACCTAGTTGG + Intergenic
923676977 1:236088628-236088650 CCTGGCATCCAGAGCCTGGGTGG + Intergenic
923718625 1:236448367-236448389 GCTGCCATGGAAGGCCTGCTGGG + Intronic
924567916 1:245213290-245213312 GCTCACATGGAGACCCTGGTGGG + Intronic
924865153 1:247971295-247971317 CCAGCCATCGAGATCCAGGTTGG + Intronic
1064030921 10:11882183-11882205 CCTGCCCAGGAGAGACTGGGTGG + Intergenic
1067079243 10:43204059-43204081 CCTTCCATCGAGATCCTCGTGGG + Intronic
1069602103 10:69714513-69714535 CCTGCCAAGGACAGGGTGGTGGG + Intergenic
1069746997 10:70721845-70721867 CCTGCCATCGAGAGCAGGGATGG + Intronic
1073214047 10:101826899-101826921 CCAGCCATTGAGAGCCCTGTGGG - Intronic
1075686390 10:124367807-124367829 CAGGCCATGGAGGGCCTGGCAGG - Intergenic
1075969977 10:126643904-126643926 CCGGCCATGGAGAGCCCAGAGGG + Intronic
1076444156 10:130500412-130500434 GCTGCTATGCAGCGCCTGGTGGG + Intergenic
1076909654 10:133380518-133380540 GGTGCCCTGGGGAGCCTGGTGGG - Intronic
1077097823 11:806557-806579 CCTTCCATGTAGGGCCTGGAGGG + Intronic
1078534187 11:12160206-12160228 CCTGCCAGGAGGAGCCTGCTGGG - Intronic
1078655067 11:13231050-13231072 CCAGCCATGGAGTACCTAGTAGG - Intergenic
1079021079 11:16909521-16909543 GCTGCCTTGGAGAGTGTGGTGGG - Intronic
1081733959 11:45390880-45390902 CCCTCCATGGAGTGCCTGTTTGG - Intergenic
1082770160 11:57201680-57201702 CCTGCAATGGAGGGTCTGGGAGG + Intergenic
1082996631 11:59260861-59260883 CCAGCCATGGGGTGCTTGGTGGG + Intergenic
1083095541 11:60247069-60247091 CCTGCCACTGGTAGCCTGGTGGG + Intergenic
1084312268 11:68324047-68324069 CCTGCCATGCAGGGCCCCGTGGG + Intronic
1084744268 11:71157980-71158002 CCAGCCACGGACAGCCTGGGGGG + Intronic
1084936921 11:72591805-72591827 CCTGCCATGGTGAGGATGGACGG + Intronic
1085516859 11:77116605-77116627 CTTGCCGGGGAGATCCTGGTGGG - Intronic
1087080866 11:94169763-94169785 CCTGCCATGGAGACTCGGGAGGG + Intronic
1087288347 11:96291780-96291802 CCTTCCAAGGAGACCATGGTTGG - Intronic
1089059808 11:115617200-115617222 CATGCTCTGGGGAGCCTGGTGGG + Intergenic
1090106134 11:123854992-123855014 CCTGGCAGGGAGTTCCTGGTAGG + Intergenic
1090465880 11:126932618-126932640 CCTGGCCTGAAGAGCCTGCTGGG - Intronic
1092238057 12:6822005-6822027 TCTGCCCTGGAGAACCTGGAGGG + Intronic
1092277252 12:7070663-7070685 CCACCCTTGGAGAGGCTGGTGGG - Exonic
1096794986 12:54071117-54071139 CCTGCCATGGAGAGCAAGCTTGG + Intergenic
1100394393 12:94171904-94171926 GCTGCCCTAGGGAGCCTGGTGGG - Intronic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1103990597 12:124796791-124796813 CTTGCCCTCGAGAGCCTGGTGGG + Intronic
1104033043 12:125079012-125079034 GCTGCCAGGGAAAGCCTGTTTGG + Intronic
1104089145 12:125500187-125500209 CCTGCAATAGAGAGCCTCTTTGG + Intronic
1104933144 12:132351007-132351029 CCAGCAACGGGGAGCCTGGTTGG + Intergenic
1105576232 13:21654963-21654985 CCTTTGATGGAGAGTCTGGTGGG - Intergenic
1105745803 13:23375757-23375779 CCTGGCAGGCGGAGCCTGGTGGG - Intronic
1106923689 13:34590695-34590717 CATGTCAGGGAGAGCCTTGTAGG - Intergenic
1112146472 13:96705750-96705772 CCTGCTCTGGTGAGCCTGATGGG - Intronic
1112335638 13:98513199-98513221 CCTGCCACGGACATCATGGTGGG + Intronic
1113468073 13:110525855-110525877 CATGCCATGCACAGCCTGCTCGG - Intronic
1113747732 13:112756632-112756654 CCTCACCTGGAGAGCCTGGACGG + Intronic
1114316553 14:21515047-21515069 GATTCCATGGAGTGCCTGGTAGG - Intergenic
1115801975 14:37004763-37004785 CCTGCTGTGGAGAAACTGGTAGG + Intronic
1116301447 14:43188540-43188562 CCTGGGATGGAGCTCCTGGTGGG + Intergenic
1117993762 14:61459511-61459533 CAGGCCATGAAGAGCCTTGTAGG + Intronic
1119390310 14:74287135-74287157 CCTGCCAGGCACAGCTTGGTGGG + Intronic
1119416870 14:74476756-74476778 CCTGGTTTGGAGAGCCTGGTAGG + Intronic
1120732927 14:88023082-88023104 CCTGCCCTGGAGAGTAGGGTCGG + Intergenic
1121044506 14:90778104-90778126 CAGGCCCTGGAGAGCCTGGTGGG - Intronic
1122920162 14:104876662-104876684 CCTGCCAGGGGGAGCCTTCTGGG - Intronic
1123059708 14:105588970-105588992 CCTGTCCTGGAGGGCCTGGCAGG - Intergenic
1123084032 14:105709219-105709241 CCTGTCCTGGAGGGCCTGGCAGG - Intergenic
1125343360 15:38696026-38696048 CCTGCCACTGGAAGCCTGGTTGG + Intergenic
1127632168 15:60837571-60837593 CCTTCCATGGGGAGCCTGTTTGG + Intronic
1128239855 15:66094424-66094446 CCTGCCACTGCGAGCCTGGCTGG - Exonic
1128506837 15:68278412-68278434 GCGGCCATGGAGGGCCTGGCTGG + Exonic
1128759914 15:70209584-70209606 TCTGCCATGTAGGGCCTAGTAGG - Intergenic
1128761152 15:70216798-70216820 CATGCCATGGCGTGCCAGGTAGG + Intergenic
1129110132 15:73332359-73332381 CCTGCCCTGGAGCTGCTGGTGGG + Intronic
1130025772 15:80269270-80269292 CCTGCCATGGAGTGATTGGAGGG + Intergenic
1131959530 15:97773788-97773810 CCTGCGATGGAGAGTCTTGGAGG + Intergenic
1132498097 16:273348-273370 CCTGCCTTGGAGCTCCTGGTGGG - Intronic
1133570853 16:7038594-7038616 CTGGCCATGAAGAGCCTGGCTGG - Intronic
1136684528 16:31986445-31986467 CCAGCCACGGAGAACCAGGTGGG + Intergenic
1136785154 16:32929988-32930010 CCAGCCACGGAGAACCAGGTGGG + Intergenic
1136884628 16:33923816-33923838 CCAGCCACGGAGAACCAGGTGGG - Intergenic
1137586203 16:49665177-49665199 TCTGCCATCAAGAGCTTGGTGGG + Intronic
1138460723 16:57146214-57146236 GCTGCCATGGAGTTCCTGGATGG + Exonic
1138646024 16:58425504-58425526 CATGTCATGGAGGGCCTGGTGGG + Intergenic
1139958678 16:70705417-70705439 CCTGCCCTTGAGCGCCAGGTTGG - Intronic
1140857518 16:78990977-78990999 CCTGGCAAGGACAGCCTGTTTGG + Intronic
1141561146 16:84868474-84868496 CCTGCCCTGCAGAGCCCTGTGGG + Intronic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1141669993 16:85486650-85486672 CCTGCCCTGGCGAGGATGGTGGG + Intergenic
1141897478 16:86967810-86967832 CCTTCCGTGGACAGCCTGCTTGG - Intergenic
1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG + Intergenic
1203087814 16_KI270728v1_random:1193997-1194019 CCAGCCACGGAGAACCAGGTGGG + Intergenic
1143795026 17:9329575-9329597 CCTGCCATTCAGACCCAGGTGGG - Intronic
1145209305 17:21001398-21001420 CAGGCCATGGAGAAGCTGGTGGG - Exonic
1145778076 17:27543361-27543383 CCAGCTATGGAGAGGCAGGTTGG + Intronic
1147438687 17:40433563-40433585 CCTGGCATGGAAAGCCTGCTGGG + Intergenic
1147659608 17:42110607-42110629 CCTGCCATGGAGAGCCTGGTAGG + Intronic
1147934926 17:44005890-44005912 CCTGGCATGGGGAGCCGGCTCGG - Exonic
1148977743 17:51544449-51544471 CCAGGCCTGGAGAGCCTGGTTGG - Intergenic
1151354182 17:73548773-73548795 CCCACCATGCAGAGCCTGGTTGG - Intronic
1151376917 17:73695496-73695518 CCTGCTATCCAGAGCCTGGAGGG + Intergenic
1153675396 18:7452331-7452353 CCTGTGGTGGAGGGCCTGGTGGG - Intergenic
1154297248 18:13161929-13161951 ACTGCCATGGGGAGGCTGCTTGG - Intergenic
1155464642 18:26120956-26120978 CCTGGGATGGAGTGCCTGGAGGG + Intergenic
1156851429 18:41732334-41732356 CCTGCCATATAGAGCTTGATCGG + Intergenic
1160091913 18:75834940-75834962 ACAGCCATGGAGAGCTTGGCTGG - Intergenic
1160222411 18:76986709-76986731 TCTGCCATGTAGAGCCAGGCTGG - Intronic
1160368513 18:78350174-78350196 CATGCCCTGGAGAGCCTTGGTGG + Intergenic
1160853900 19:1207344-1207366 CGTGCCAGGGAGAGCGTGGTTGG + Intronic
1160970746 19:1766742-1766764 ACTGCCCTGGAGCGCCGGGTGGG - Intronic
1161326665 19:3667551-3667573 CCTGCCATGGTCACCCTGGTTGG + Intronic
1163087775 19:14994619-14994641 CCTGCCTTGGAGAATCTGGTGGG + Intronic
1163847658 19:19646559-19646581 GCTGCCATGGGGAGCCTGGATGG - Intronic
1163849924 19:19656966-19656988 GCTGCCAGGGAGACCCAGGTTGG - Intronic
1164539121 19:29109158-29109180 CCCGCCAAGGAGGGCCTTGTAGG + Intergenic
1164713788 19:30377038-30377060 CCTGACATGGGGACCCTGGAAGG + Intronic
1164718827 19:30416458-30416480 CATGCCATGGAGAGCCTGATGGG - Intronic
1164802611 19:31090234-31090256 CTTCCCATGGAAAGCCCGGTAGG + Intergenic
1165139190 19:33688894-33688916 CCTGCCTTGGGGAGCCCAGTTGG - Intronic
1165448298 19:35868739-35868761 CCCGCCATCGGGAGCCTGGCCGG + Exonic
1165558677 19:36659132-36659154 TCTCCCATGGAGAGCTTGTTAGG - Intronic
1168126844 19:54288812-54288834 CCACCCATGGAGATGCTGGTGGG - Intergenic
1168274777 19:55271610-55271632 CCAGCCATGCAGAGGCTGGGAGG - Intronic
1168474335 19:56665055-56665077 CCTGCAAGGGAGACCCTGCTGGG - Exonic
925599875 2:5597342-5597364 CCTGCCACTGGGAACCTGGTTGG + Intergenic
925625973 2:5842334-5842356 CCGGCGATGGAGGGCCTGGTAGG + Intergenic
925867494 2:8241534-8241556 CCAGCAGTGGGGAGCCTGGTGGG + Intergenic
925869897 2:8261041-8261063 CCTTCCATGCAGAGAGTGGTAGG - Intergenic
926086469 2:10023304-10023326 ACAGCCAGGGAGAGCCAGGTGGG - Intergenic
929882796 2:45851904-45851926 CCTGCCATGGAGAGGCAGGTGGG + Intronic
930424334 2:51194164-51194186 CCTGGGATGGAGCTCCTGGTGGG - Intergenic
931343509 2:61425612-61425634 CCCTCCATGGTGAGGCTGGTGGG - Intronic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
934078536 2:88448459-88448481 GCTGCCAGGGAGAGCCCGCTGGG + Exonic
935800624 2:106691593-106691615 CCTGCCATGGAGGAGCTCGTTGG - Intergenic
938713797 2:134000400-134000422 CCTGCCATGTCCAGCCTGGATGG + Intergenic
940891798 2:159042555-159042577 CCAGCCCTGGAGAGACTGGTAGG + Intronic
942374571 2:175323937-175323959 TTTGCCATGGAGAGGCAGGTAGG - Intergenic
944471102 2:200054867-200054889 CCTGGCATGGAGCTCCTGGAGGG + Intergenic
944677012 2:202042071-202042093 CATGCCAGGGAGAGTATGGTGGG + Intergenic
945761856 2:213923868-213923890 TTTGCCATGGACAGCCAGGTGGG - Intronic
948562961 2:238866172-238866194 CGTGCCATGGGGAACCTGGGCGG - Intronic
948942828 2:241204588-241204610 CCAGAGGTGGAGAGCCTGGTGGG + Intronic
1171869337 20:30513251-30513273 CCGCCCATGGGGAGCCCGGTGGG - Intergenic
1174619689 20:51864604-51864626 CCTTCCAGGTAGAGCCTGGGTGG - Intergenic
1175029579 20:55938695-55938717 CATGCCATGGGGGGCCTTGTGGG - Intergenic
1175691101 20:61066542-61066564 CCAGCCACGGTCAGCCTGGTGGG - Intergenic
1176288812 21:5033738-5033760 CCCGCCCTGGACACCCTGGTCGG - Intronic
1176738548 21:10575364-10575386 CCTGAAATGGAGCTCCTGGTGGG + Intronic
1178164449 21:29957343-29957365 CTTGGGATGGAGAGCATGGTAGG + Intergenic
1179868370 21:44229737-44229759 CCCGCCCTGGACACCCTGGTCGG + Intronic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180879612 22:19194610-19194632 CCTGCCATGGACCACTTGGTCGG + Intronic
1181021541 22:20106116-20106138 CCAGCCATGAAGAGGCCGGTGGG + Intronic
1183774962 22:39958070-39958092 CAGCCCATGGGGAGCCTGGTGGG - Intronic
1184037548 22:41925903-41925925 CCTGCCCCTGAGACCCTGGTCGG - Intronic
1184681042 22:46072175-46072197 CCTGCCGCGGAGAGCCCGGCCGG - Intronic
1185208758 22:49554991-49555013 GCTGCTGTGGAGAGCCGGGTGGG - Intronic
1185347756 22:50317834-50317856 CCTGCCAGGGTCAGGCTGGTAGG - Intronic
953044179 3:39280752-39280774 CCTGCAGTGGGGAGCCTGGTGGG + Intronic
953422014 3:42761504-42761526 CCTGCCATTGTGAAGCTGGTGGG - Intronic
954132464 3:48567581-48567603 CCTGGCAAGGAGGGCCTGATCGG - Exonic
954139091 3:48595757-48595779 CCTGTCAAGGAGATCCGGGTGGG - Intergenic
954305667 3:49724089-49724111 GCTGCCATGGAGACCCGGGCCGG + Intergenic
954580173 3:51698988-51699010 CCTGGGATGGAAAGTCTGGTAGG + Intronic
954988069 3:54813271-54813293 CCAGCAAGGCAGAGCCTGGTTGG + Intronic
955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG + Intronic
955710160 3:61770149-61770171 TCTGCCATGGAAAGCCTGGGTGG + Intronic
958431858 3:94048881-94048903 GCTGCCATGCATAGCCTTGTAGG + Intronic
959579550 3:107969578-107969600 GATGCCATGGAGACCCTGTTTGG - Intergenic
961444508 3:126972840-126972862 CCAGCCATGGAGAGCCTGCTGGG - Intergenic
961909189 3:130296905-130296927 CCTGCCATGGGGTGCAGGGTGGG + Intergenic
962890946 3:139672571-139672593 CCTGCCTTGCACAGACTGGTGGG - Intronic
963900308 3:150727083-150727105 CCTGCCCTGTAGGGCCAGGTTGG - Intergenic
966819160 3:183911257-183911279 CCTGCCATGAAGAGGCTGTGAGG - Intergenic
967397506 3:189024133-189024155 CCTGGGATGGAGTGCCTGGAGGG - Intronic
969140730 4:5069280-5069302 CCTGCCATTGTGAACCTGGGAGG - Intronic
969333985 4:6495964-6495986 GCCGCCATGGAGAGCCGGGAGGG - Intronic
972451659 4:39206322-39206344 ACTGCCATGGGGAGACTGCTTGG - Intronic
975165170 4:71170056-71170078 CCAGCCATGCAGAGCATGTTGGG - Intergenic
980936710 4:139232767-139232789 GCGGCCGTAGAGAGCCTGGTAGG + Intergenic
985272631 4:188208644-188208666 CCAGCCAAGGAGAGCCTGCGGGG - Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
986366551 5:7038558-7038580 TCTGCCATGAAGAGCCTGTCAGG - Intergenic
986571443 5:9170179-9170201 CCTTCCATGTCCAGCCTGGTAGG + Intronic
987723064 5:21663430-21663452 CCTGACATGGAGTCCCTGCTGGG - Intergenic
991295747 5:65078468-65078490 ACTCCCATGGAGAGCCTGGAAGG + Intergenic
996306482 5:122053520-122053542 CCTGCCACTGATAGCCAGGTAGG - Intronic
996405954 5:123103020-123103042 TCAGCCATGGAGAGCTTGTTTGG + Intronic
996765407 5:127030580-127030602 CCTCCCCTCCAGAGCCTGGTCGG - Exonic
997267371 5:132502681-132502703 GCTGCCATGCTGAGGCTGGTGGG + Intergenic
997640392 5:135445110-135445132 CCTGCCAAGGAGACCCTGGAGGG - Exonic
997732348 5:136191021-136191043 CCTGCCCTGGAGAACCTGGCAGG - Intergenic
999181841 5:149675371-149675393 CCTTCCTTGGAGAGGCTGATAGG - Intergenic
1002132084 5:177087705-177087727 CCTGCCAAGCCGAGCTTGGTAGG + Intronic
1002988611 6:2216837-2216859 CCTGCCCAGGAGAGGCGGGTGGG - Intronic
1003492142 6:6632300-6632322 GCTGCCATGGACAGTCTGGAGGG + Intronic
1004286163 6:14322780-14322802 CCTTTCACGGAGAGCCTTGTGGG + Intergenic
1004425211 6:15502428-15502450 CCAGCCCTCGTGAGCCTGGTGGG + Intronic
1004882512 6:20022919-20022941 GCTGCCAGAGAGAGCATGGTGGG - Intergenic
1005806168 6:29476170-29476192 CCTGCAATGGAGAATCTGGGAGG - Intergenic
1005823855 6:29620332-29620354 CCTGCTTTGGAGAGCATGTTAGG - Intronic
1005973906 6:30782640-30782662 CCTGGCCTGGAGAGCAGGGTTGG - Intergenic
1006460456 6:34154894-34154916 CCCGCGATGGGGAGCCTGGCTGG - Intronic
1006712183 6:36083705-36083727 CCTGGGATGGAGCCCCTGGTGGG + Intronic
1007075874 6:39065778-39065800 CCTGCCCTGGAGGGACTTGTCGG + Exonic
1007251738 6:40500015-40500037 CCTGCCACGGAGAGGATGGGAGG - Intronic
1009289784 6:61868337-61868359 CCTGGGATGGAGTGCCTGGCAGG - Intronic
1013480683 6:110550395-110550417 CCTTCCCGGGAGAGCCAGGTGGG + Intergenic
1013989311 6:116234834-116234856 CCTGCAGTAGAGAGCCTGTTCGG - Intronic
1017747860 6:157462779-157462801 CCAGCCCTGGAGGGCCTGGCGGG + Intronic
1018262645 6:161985799-161985821 CCTGCCATGGAGACCCTTTGAGG + Intronic
1019056198 6:169225251-169225273 TCTGTCATGGTCAGCCTGGTTGG + Exonic
1019556461 7:1633914-1633936 CCTGACATGCAGCCCCTGGTGGG + Intergenic
1022508868 7:30922778-30922800 CCTGCCATGTAGAGGCAGGCTGG + Intronic
1024239204 7:47421036-47421058 CCTGCCAAGGTGACCCTGGGAGG - Intronic
1025029647 7:55546827-55546849 CAGGCCATGCAGAGCCTGGGAGG + Intronic
1026767865 7:73171847-73171869 CCTGCCAAGGAGGGCCTGCCTGG - Intergenic
1026852672 7:73734976-73734998 CCTGCCAGGGAGTGCCTTGCTGG + Intergenic
1027044333 7:74981555-74981577 CCTGCCAAGGAGGGCCTGCCTGG - Intronic
1027079308 7:75220803-75220825 CCTGCCAAGGAGGGCCTGCCTGG + Intergenic
1029388536 7:100259384-100259406 CCTGCCAAGGAGGGCCTGCCTGG + Intronic
1031935020 7:127727232-127727254 CCTGCCCTGGAGAGCCAGGCGGG - Intronic
1033458110 7:141520700-141520722 CCTGCCATGGAGAACAGGGACGG - Intergenic
1033820576 7:145129881-145129903 CCTGGCATGAAGAGGCTGCTGGG + Intergenic
1035777015 8:2196084-2196106 CCGGCCATGCAGAGGCTGGCGGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1040091979 8:43408238-43408260 CCTGGGATGGAGTGCCTGATGGG - Intergenic
1040286188 8:46101606-46101628 CCTGCCCTGGAGAGCCCTGGGGG + Intergenic
1042325979 8:67528328-67528350 GCTTCCATGCAGAGGCTGGTTGG + Intronic
1044487621 8:92770969-92770991 CCTACCATGGGGAGAATGGTGGG - Intergenic
1044581135 8:93827469-93827491 CCTCCCAGGCTGAGCCTGGTAGG - Intergenic
1047356820 8:124129743-124129765 CCTGCCATTGGTAGCCAGGTGGG + Intergenic
1048395183 8:134007588-134007610 CATGCCCTGGAGTGCCAGGTAGG + Intergenic
1048886161 8:138911581-138911603 CCAGCCATGGACAGCCTTGCAGG + Intronic
1048886749 8:138915119-138915141 CCTGACATGGTGAGGGTGGTGGG - Intergenic
1049166231 8:141128139-141128161 CCTACCCTGGAGAGCGTGGGGGG - Intronic
1049210656 8:141385041-141385063 CCCTCCATGGGGAGCCTGGTGGG - Intergenic
1049309010 8:141923570-141923592 CCTGCCAGGGAAAGCCAGGGAGG - Intergenic
1049593021 8:143471230-143471252 CGTGCCCTGGAGGGCCTGGTGGG - Intronic
1050147355 9:2583469-2583491 GCTGCTATGGAGGGCATGGTGGG + Intergenic
1051120066 9:13743124-13743146 ACAGCCATGGACAGCCTGCTGGG + Intergenic
1051122074 9:13762198-13762220 CTTGCCATGGAGAGGCTGGTCGG + Intergenic
1051966761 9:22837005-22837027 CATGCCATGCAGTGGCTGGTGGG + Intergenic
1054769674 9:69071668-69071690 CATGACATTGAGAGCCTGGTGGG - Intronic
1056126473 9:83539608-83539630 CCTGCCCTGGACAGTCTGGTGGG + Intergenic
1057040135 9:91842022-91842044 CCTGGCCTGGTGAGGCTGGTGGG - Intronic
1058700768 9:107598234-107598256 CCTGCCATTGAGAGGTTGCTTGG + Intergenic
1059023274 9:110598844-110598866 CCTGGGATGGAGTGCCTGGGGGG - Intergenic
1060134972 9:121144723-121144745 CTTTTCATGGACAGCCTGGTAGG + Intronic
1060591333 9:124818951-124818973 CCTGCCCTTGAGAGCCTGCTGGG + Intergenic
1060819790 9:126654743-126654765 CATGCCACGGAGAGCCAGGTGGG + Intronic
1185633193 X:1531619-1531641 CCAGCCATGGAGAGTCTCATAGG + Intronic
1186508166 X:10110402-10110424 CCTGACGTGGTGAGCATGGTGGG + Intronic
1187272685 X:17793017-17793039 CCTTCCCTGGACAGCCTGGAGGG + Intergenic
1187431118 X:19225924-19225946 CCTTACATGGAGGGCTTGGTAGG - Intergenic
1189873084 X:45404700-45404722 CCTGCCACTGATAGCCAGGTGGG + Intergenic
1195091157 X:101460342-101460364 CTTACCCTGGGGAGCCTGGTGGG + Intronic
1195172457 X:102282182-102282204 CCTGCCATGGTGAGGTTTGTGGG + Intergenic
1195186407 X:102404913-102404935 CCTGCCATGGTGAGGTTTGTGGG - Intronic
1196851204 X:119940809-119940831 CCTGCTATTTACAGCCTGGTAGG - Intronic
1201147930 Y:11075653-11075675 CCAGCCACGGACAGCCTGGGGGG + Intergenic