ID: 1147659796

View in Genome Browser
Species Human (GRCh38)
Location 17:42111462-42111484
Sequence CCCAGCATGGTGAAGAGTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147659796_1147659807 12 Left 1147659796 17:42111462-42111484 CCTGAACTCTTCACCATGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 167
Right 1147659807 17:42111497-42111519 CCTGGGGGTGGAGAATGAGCTGG 0: 1
1: 0
2: 2
3: 48
4: 534
1147659796_1147659800 -6 Left 1147659796 17:42111462-42111484 CCTGAACTCTTCACCATGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 167
Right 1147659800 17:42111479-42111501 GCTGGGTCACCAGGTGCACCTGG 0: 1
1: 0
2: 0
3: 30
4: 241
1147659796_1147659808 13 Left 1147659796 17:42111462-42111484 CCTGAACTCTTCACCATGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 167
Right 1147659808 17:42111498-42111520 CTGGGGGTGGAGAATGAGCTGGG 0: 1
1: 0
2: 5
3: 49
4: 548
1147659796_1147659802 -4 Left 1147659796 17:42111462-42111484 CCTGAACTCTTCACCATGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 167
Right 1147659802 17:42111481-42111503 TGGGTCACCAGGTGCACCTGGGG 0: 1
1: 0
2: 2
3: 15
4: 190
1147659796_1147659801 -5 Left 1147659796 17:42111462-42111484 CCTGAACTCTTCACCATGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 167
Right 1147659801 17:42111480-42111502 CTGGGTCACCAGGTGCACCTGGG 0: 1
1: 1
2: 1
3: 28
4: 236
1147659796_1147659803 -3 Left 1147659796 17:42111462-42111484 CCTGAACTCTTCACCATGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 167
Right 1147659803 17:42111482-42111504 GGGTCACCAGGTGCACCTGGGGG 0: 1
1: 0
2: 2
3: 22
4: 209
1147659796_1147659804 0 Left 1147659796 17:42111462-42111484 CCTGAACTCTTCACCATGCTGGG 0: 1
1: 0
2: 0
3: 24
4: 167
Right 1147659804 17:42111485-42111507 TCACCAGGTGCACCTGGGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147659796 Original CRISPR CCCAGCATGGTGAAGAGTTC AGG (reversed) Exonic
905396321 1:37668978-37669000 CCCAGCATGGAGAAGATAACTGG + Intergenic
906460473 1:46032245-46032267 CCCTGCTTGGAGAAGAGTCCCGG - Exonic
909806180 1:79876076-79876098 CCCTGCCTGGTGAAGAGTGGGGG - Intergenic
910065215 1:83143537-83143559 CCCTGCCTGGTGAAGAGTTGGGG + Intergenic
910513948 1:88037163-88037185 CCCTGCCTGGTGAAGAGTTACGG - Intergenic
911086067 1:93978431-93978453 CCAAGAATGGGGAAGAGTTTGGG + Intergenic
912564300 1:110574971-110574993 CACTGCATGGTGCAGAGTTGGGG - Intergenic
912649484 1:111425203-111425225 CCCACCATGGAGAAGAGGCCAGG + Intronic
916587725 1:166163250-166163272 ACCAGGCTGGTGAAGAGTTGTGG - Intronic
917511638 1:175674028-175674050 ACCAGGATGGGGAAGAGTTGAGG - Intronic
919618092 1:199832378-199832400 CCCAGTTTGGCTAAGAGTTCTGG + Intergenic
919647071 1:200105807-200105829 GCCGGCATGGTGGTGAGTTCTGG + Intronic
920508799 1:206535662-206535684 CTCAGCATGGTGATGTTTTCAGG + Intronic
920763963 1:208813207-208813229 TCCAGTAAAGTGAAGAGTTCTGG + Intergenic
921994475 1:221403139-221403161 ACCAGCATGGAGAATAGTTTGGG + Intergenic
922079617 1:222283005-222283027 CCCATCATAGTGGAGATTTCTGG + Intergenic
922807920 1:228400174-228400196 CCCAGCATGGTGTAGACTCAAGG - Intronic
1063686048 10:8237971-8237993 GGCAGCTTGGTGAAAAGTTCAGG + Intergenic
1067719962 10:48720893-48720915 CTCAGCATGGTGTAGATTTCAGG + Intronic
1068587694 10:58817663-58817685 CCCAGTTTGCTGAAGAGCTCAGG - Exonic
1069861616 10:71475262-71475284 CCCAGCAGGCTGGAGAGGTCAGG - Intronic
1069907971 10:71743226-71743248 ACAAGGAAGGTGAAGAGTTCAGG + Intronic
1073869265 10:107843810-107843832 CCAATCATGGTGAAAAGTTCTGG - Intergenic
1074242963 10:111657301-111657323 TCCATCTTGGTTAAGAGTTCAGG + Intergenic
1074565507 10:114573860-114573882 CACAGCCTGGTTAAGAGTCCTGG - Intronic
1077209584 11:1362907-1362929 GCCAGCATGGTGGAGAATCCTGG - Intergenic
1077799369 11:5522825-5522847 CACAGCATGGAGATGAGTCCTGG - Intronic
1081840889 11:46200679-46200701 CCCAGCATGCTGAGGAGTGGGGG + Intergenic
1081867564 11:46367856-46367878 CCCAGGATGGTGAGGGGTGCAGG + Intronic
1082618074 11:55386624-55386646 CCCACCATGGGGGAGAGATCTGG - Intergenic
1083816132 11:65133459-65133481 CCCAGCATGGCAGTGAGTTCAGG - Exonic
1083861701 11:65423426-65423448 CCCAGCCTGGTGGAGCGTCCAGG + Intergenic
1083893792 11:65610305-65610327 CTCAGCTTGATGAAGTGTTCAGG - Intronic
1085961681 11:81469380-81469402 TCCAGCAAGGTGAAGAGAACAGG + Intergenic
1086822043 11:91446390-91446412 CCCTGCCTGGTGACGAGTTGGGG - Intergenic
1088128084 11:106452614-106452636 CCCAAGGTGGTGAAGATTTCAGG + Intergenic
1088575081 11:111263759-111263781 CACAGCATAGCGAAGAGTTTGGG + Intronic
1089151727 11:116369591-116369613 CCCAGCCTGGAGAAGAGAGCTGG - Intergenic
1089260285 11:117219536-117219558 CCCAGCCTGCTCCAGAGTTCGGG - Intronic
1089357770 11:117866371-117866393 CCCAGCTTGGTCAGGAGTTAGGG - Intronic
1089389269 11:118088953-118088975 CCCACCATGGTGATGGGGTCTGG + Intronic
1090771280 11:129921697-129921719 CCCAGCATGGTTCCGAGTTGGGG + Intronic
1091215539 11:133899185-133899207 CCAAGCATGGGGAAGAGCTCAGG + Intergenic
1092579263 12:9820909-9820931 CCCTGCCTGGTGAAGAGTTAGGG - Intergenic
1093477672 12:19573680-19573702 CCCTGCTTGGTGAAGAGTGGGGG + Intronic
1093477743 12:19573963-19573985 CCCTGCCTGGTGAAGAGTGGGGG + Intronic
1093498053 12:19779895-19779917 CCCTGCCTGGTGAAGAGTTTTGG + Intergenic
1093690261 12:22101997-22102019 CCCTGCCTGGTGAAGAGTGTGGG + Intronic
1101572852 12:105971062-105971084 TGCAGCATGGTAAAGAGTTCTGG + Intergenic
1103390218 12:120567064-120567086 CTCAGCATGGTGTGGACTTCAGG + Intronic
1103443562 12:120980107-120980129 CCCTTCATGGTGAGGAGTCCTGG + Intronic
1103899537 12:124295986-124296008 CCCAGCATGTTGCAGACATCTGG + Intronic
1103994553 12:124820649-124820671 CCCAGGCTGGTGAAGGGGTCTGG - Intronic
1112420167 13:99241621-99241643 TCTAGGATGATGAAGAGTTCTGG + Intronic
1115636430 14:35294440-35294462 AGCAGTATAGTGAAGAGTTCAGG + Intronic
1117443503 14:55781285-55781307 CCCAGCATGGTGTACATTTCTGG - Intergenic
1119621578 14:76135782-76135804 CCAAGCATGGTGCAGAAGTCTGG - Intergenic
1122578730 14:102757908-102757930 CCGCGCTTGGTGAAGAGTTCAGG - Intergenic
1122805889 14:104256811-104256833 CCAAGCATGGTGAGGGATTCTGG + Intergenic
1124042155 15:26115647-26115669 CACAGCATGGAGAAAAGTGCTGG - Intergenic
1125609995 15:40963504-40963526 CCCAGCATGGAGCACAGTTCCGG + Intergenic
1127181862 15:56429143-56429165 ATCTGCTTGGTGAAGAGTTCAGG - Exonic
1129257295 15:74340907-74340929 CCTAGCGTGGGGAAGACTTCTGG - Intronic
1129443177 15:75597290-75597312 CCCTGCATGTTGATTAGTTCTGG - Intergenic
1135503807 16:23019333-23019355 TCCAAAATGATGAAGAGTTCAGG + Intergenic
1137679742 16:50330159-50330181 CCCAGAAAGCTGAAGAGATCAGG - Intronic
1139923564 16:70473879-70473901 CCCATAGTGGTGAAGAGCTCAGG - Intronic
1140286920 16:73612096-73612118 CTGAGCATGGTGGAGAGTTGTGG + Intergenic
1141282717 16:82643680-82643702 CCTACCCTGGTGTAGAGTTCTGG + Intronic
1142312603 16:89322767-89322789 CCCCGCATGGTGATGAGGTGTGG + Intronic
1143948899 17:10617536-10617558 CCCAGCATCTTGAAGAGTTATGG - Intergenic
1146070798 17:29679301-29679323 CACAGTATGGTTAAGAGCTCTGG + Intronic
1147659796 17:42111462-42111484 CCCAGCATGGTGAAGAGTTCAGG - Exonic
1151479220 17:74360542-74360564 GGCAGCATGGAGATGAGTTCTGG - Intronic
1151892137 17:76957058-76957080 GCCAGCCTGGTGAGGAGCTCGGG - Intergenic
1152583180 17:81178004-81178026 CCCAGCCAGGTGTAGAGGTCAGG - Intergenic
1156108306 18:33692343-33692365 CCCAGCAAGGTGGAGAGTCTGGG - Intronic
1156994367 18:43448073-43448095 CCCTGCCTGGTGAAGAGTGGTGG - Intergenic
1158092955 18:53736849-53736871 CCCATCATGGCCAAGAATTCAGG - Intergenic
1158748380 18:60227963-60227985 ACCAGCATGGTGAGGACCTCAGG + Intergenic
1161057808 19:2199464-2199486 CCCAGCATGGTGGGGACTGCAGG + Intronic
1161846858 19:6716650-6716672 ACCAGCATTGTGCTGAGTTCAGG + Intronic
1163785777 19:19274226-19274248 GCCAGTTTGGTGAAGAGTTTGGG + Intergenic
1164002265 19:21112963-21112985 CCCAGCATGGTGGTGGGTGCTGG - Intronic
1164260776 19:23567086-23567108 CCCAGGTTGATGAAGAGATCAGG + Intronic
1164399668 19:27893932-27893954 AGCAGCCTGGTGAAGAGCTCTGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165119785 19:33551735-33551757 CTCAGCATTGTGAAGAGCTTGGG + Intergenic
1166727440 19:45037536-45037558 TCCAGCATGGTGAAGAGTGTGGG - Exonic
926227404 2:10978202-10978224 CTCAGCCGGGTGCAGAGTTCTGG - Intergenic
926635616 2:15175614-15175636 CCCTGCATGGTATAGACTTCTGG - Intronic
927985746 2:27409379-27409401 CCCAACACGGTGAAGTGCTCCGG - Exonic
932373785 2:71216452-71216474 CCCAGCCTAGTGTGGAGTTCAGG - Intronic
935044895 2:99472419-99472441 TCAGGCAAGGTGAAGAGTTCTGG + Intronic
936621849 2:114108333-114108355 CCCAGAATGGTTAAGAATTTAGG + Intergenic
937096432 2:119238556-119238578 CTCAGAATGGAGAAAAGTTCAGG - Intronic
937397226 2:121547395-121547417 CCCTGCCTGGTGAAGAGTAGGGG - Intronic
941405790 2:165085960-165085982 CCCAGTATGTTGAAGTGTTGTGG + Intergenic
941680623 2:168394702-168394724 CCAAGGATGGTGAAGACTTCAGG + Intergenic
948776821 2:240293505-240293527 CTAAGCATGGTGGGGAGTTCTGG + Intergenic
948936471 2:241168414-241168436 CTCAGAATGGTGCAGAGTGCGGG + Intronic
1170657841 20:18306315-18306337 TCCAGCTGGGTGATGAGTTCTGG - Exonic
1172896253 20:38302329-38302351 TCCAAAATGGTGAAGAGGTCAGG + Intronic
1173188415 20:40858543-40858565 CCCAGCTGGGTGAGGAGTGCAGG - Intergenic
1174802874 20:53579875-53579897 CCCAGCTTGGCGTTGAGTTCTGG - Intronic
1175292430 20:57885138-57885160 CTCATCCTGGTGGAGAGTTCTGG - Intergenic
1175743964 20:61440819-61440841 CACAGCATGGGGAGAAGTTCTGG + Intronic
1176249801 20:64115088-64115110 CCCTGCATGGTCAAACGTTCTGG - Intergenic
1176375981 21:6087107-6087129 CACAGCATGCTGAGGAGCTCGGG - Intergenic
1179627773 21:42658263-42658285 CCCAGCAGGGTGCAGAGGCCTGG - Intronic
1179747494 21:43451137-43451159 CACAGCATGCTGAGGAGCTCGGG + Intergenic
1180237963 21:46476488-46476510 ACTAGCATGGGGAAGAGCTCAGG + Intronic
1180624048 22:17182137-17182159 CCCAGTATGGGGATGACTTCTGG + Intronic
1182472487 22:30557128-30557150 CACAGCATGGTGCAGGGTGCAGG + Intronic
1183279849 22:36926169-36926191 CCCAGCATGGTGAGGGGCTGGGG + Exonic
1183505718 22:38207827-38207849 GCCAGCATGGGGTAGAATTCAGG - Intronic
1184187535 22:42874778-42874800 CCCAGCAAGGTGAGGAGTCCAGG + Intronic
952565330 3:34650415-34650437 GACAGAATGGTGATGAGTTCAGG + Intergenic
954869686 3:53758292-53758314 GCCAGCATGGGTAAGAGATCTGG + Intronic
955341812 3:58130779-58130801 CCCAGCAAGGTCAAGATTGCCGG + Exonic
959520284 3:107317013-107317035 CCCTGCCTGGTGAAGAGTGAGGG + Intergenic
959645522 3:108695445-108695467 CTCAGCAGGGTGGAGTGTTCTGG - Intergenic
959698576 3:109275908-109275930 CCCAGCACGGTGCGGAGTTCTGG + Intergenic
959950375 3:112174615-112174637 CCCTGCCTGGTGAAGAGTTGGGG + Intronic
961091250 3:124114499-124114521 CCTGGCATAGTGAAGACTTCGGG + Intronic
963168936 3:142231865-142231887 CCCAGCATAGTGCAGAGATTAGG - Intergenic
965403878 3:168247960-168247982 CACAGAATGCTGAAGAATTCAGG + Intergenic
965811084 3:172592360-172592382 CCCTGCCTGGTGAAGAGTAGCGG + Intergenic
966500452 3:180633828-180633850 CCCTGCCTGGTGAAGAGTCAGGG - Intronic
968422938 4:500148-500170 CTCAGTATGGTGAAGAGTACTGG - Intronic
968626149 4:1627557-1627579 CACAGCATGGTGGAGAGCTGGGG + Intronic
971089128 4:23319658-23319680 CTCAACATGATGAATAGTTCAGG - Intergenic
972828327 4:42786815-42786837 CCCTGCCTGGTGAAGAGTTGGGG + Intergenic
972861024 4:43169291-43169313 CCCCGCATGGTGAAGAGGAATGG - Intergenic
973861195 4:55066641-55066663 CCCAGCAGGTTGCAGAGGTCAGG + Intergenic
975254928 4:72222818-72222840 CCCAGCAGCAAGAAGAGTTCAGG + Intergenic
977002242 4:91518877-91518899 CCCAGATTGGTGAAGAGTGGGGG + Intronic
977678605 4:99774329-99774351 CCCAGCCTGGTGAAGAGGAGTGG - Intergenic
977979647 4:103307062-103307084 CCCTGCCTGGTAAAGAGTCCGGG + Intergenic
979509517 4:121536398-121536420 CCCCGCATGGTGAAGTTTTGAGG - Intergenic
979959691 4:127002375-127002397 CCCTACATGGTGAAGACATCTGG - Intergenic
980352220 4:131698171-131698193 CCCTGCCTGGTGAAGAGCACGGG + Intergenic
983426414 4:167589340-167589362 CCCAGCAGGGTTAAGGGTCCTGG - Intergenic
984805317 4:183746571-183746593 CTCTGCATGGGGAAGAGCTCGGG - Intergenic
985527148 5:411715-411737 CCCAGCATGGTCCAGATTTAAGG + Intronic
995840247 5:116437010-116437032 CCTAGCCTGATAAAGAGTTCTGG - Intergenic
996443337 5:123515212-123515234 CCCAGCATGGAGAGGATTACAGG - Intronic
997065791 5:130556959-130556981 CCCTGCATGGTGAAGAGCAGCGG - Intergenic
998017265 5:138742319-138742341 GCCAGGCTGGTGAAGAGTTAAGG + Intronic
1004447580 6:15714339-15714361 CCCAGCAGGGTTAGGAGTTTGGG + Intergenic
1005432548 6:25773509-25773531 ACCAGCCTGGTGAACAGTCCTGG - Exonic
1007835403 6:44670055-44670077 CCCAACATGGTGAACACTGCAGG + Intergenic
1009946527 6:70347421-70347443 CCCTACCTGGTGAAGAGTTGAGG + Intergenic
1010019170 6:71139516-71139538 CCCTGCCTAGTGAAGAGTTGGGG - Intergenic
1010465908 6:76166471-76166493 CCCTGCCTGGTAAAGAGTTAGGG - Intergenic
1012258095 6:97056828-97056850 CCCAGCCTGGTGTCGAGCTCCGG - Intronic
1014255860 6:119159629-119159651 CCCAGCATGGTGAAGTGGTGTGG - Intergenic
1014362207 6:120493174-120493196 CCCAGCAGTGTGATGAATTCTGG + Intergenic
1015228303 6:130883912-130883934 CCCAGCATGGAGAAGGTCTCAGG - Intronic
1016885964 6:148959914-148959936 GCCAGCATGGTGGGGAGGTCTGG - Intronic
1018462054 6:164007729-164007751 CCCAGCATGGTGGAGAGGGCAGG + Intergenic
1019040850 6:169103279-169103301 CCCAGCATGGTGCACACTTCAGG + Intergenic
1020513706 7:9090557-9090579 CCCTACTTGGTGAAGAGTTGGGG - Intergenic
1020513760 7:9090837-9090859 CCCCACTTGGTGAAGAGTTGGGG - Intergenic
1021247052 7:18275963-18275985 CCCAGCACCTTGAAGAGTACAGG + Intronic
1026152994 7:67803829-67803851 GCCAGCAGGGTGAAGACTCCAGG + Intergenic
1027278893 7:76591210-76591232 CCCTGCCTGGTGAAGAGTTGGGG - Intergenic
1029900688 7:104036266-104036288 CCCAGCCTGGAGAAGAGAGCAGG - Intergenic
1035365759 7:158348743-158348765 CCCAACAAGGTGAACAGTTCTGG + Intronic
1035774708 8:2179204-2179226 CCCGGCGTGGTTAAGAGTCCTGG + Intergenic
1035776821 8:2194382-2194404 GCCAGCATACTGAGGAGTTCAGG + Intergenic
1037304126 8:17487135-17487157 CCCGGCATGGCGAAAAGTTGTGG - Intergenic
1039027158 8:33270532-33270554 CCCAGCTTGGTGAAAAAATCTGG + Intergenic
1041647170 8:60264694-60264716 ACCAGCATGTTGAAGAGTGGAGG - Intronic
1046133422 8:109996415-109996437 GACAGCATAGTCAAGAGTTCAGG + Intergenic
1046674848 8:117095926-117095948 CCCAGTTTGGGTAAGAGTTCAGG + Intronic
1050945820 9:11515733-11515755 CACAGCATGGAAAAGAGTTTTGG - Intergenic
1052538127 9:29773953-29773975 CCAAGCATGGTGGAAAGCTCTGG + Intergenic
1053635913 9:40003506-40003528 CCCATCTTCGTGAGGAGTTCAGG + Intergenic
1056803176 9:89708271-89708293 CCCTGCATGGTGAACAGTATGGG + Intergenic
1059658641 9:116379362-116379384 CCCAGCATGGTGCAGAAAACAGG - Intronic
1060293682 9:122328338-122328360 TTCTGCATGGTAAAGAGTTCTGG - Intergenic
1060736820 9:126071372-126071394 CCCAGGATCCTGAAGAGCTCTGG - Intergenic
1061373549 9:130211372-130211394 CTCAGCATGGTCAGGGGTTCAGG - Intronic
1062441161 9:136570495-136570517 CCCAGCCTGGTTGATAGTTCAGG - Intergenic
1186546458 X:10454948-10454970 CCCTGGCTGGTGAAGCGTTCAGG + Exonic
1191156886 X:57283646-57283668 CCCTGCTTGGTGAAGAGTGTGGG + Intergenic
1193330674 X:80232528-80232550 CCCTGCCTGGTGAAGAGATGGGG + Intergenic
1193496466 X:82219463-82219485 CCCTGCCTGGTGAAGAGTGGGGG + Intergenic
1195148777 X:102044352-102044374 CCCTGCCTGGTGAAGAGTGGGGG - Intergenic
1195856577 X:109338612-109338634 CCCAGCCTGGTGAGGAGTGGGGG + Intergenic
1197913855 X:131513985-131514007 CCCTGCCTGGTGAAGAGTGAGGG + Intergenic