ID: 1147659895

View in Genome Browser
Species Human (GRCh38)
Location 17:42111886-42111908
Sequence GCTCCATTCTGGGAATGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 2, 1: 0, 2: 1, 3: 16, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147659887_1147659895 -2 Left 1147659887 17:42111865-42111887 CCTCCCATTGGTAGGACCGAAGC 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1147659895 17:42111886-42111908 GCTCCATTCTGGGAATGGCAGGG 0: 2
1: 0
2: 1
3: 16
4: 199
1147659888_1147659895 -5 Left 1147659888 17:42111868-42111890 CCCATTGGTAGGACCGAAGCTCC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1147659895 17:42111886-42111908 GCTCCATTCTGGGAATGGCAGGG 0: 2
1: 0
2: 1
3: 16
4: 199
1147659883_1147659895 19 Left 1147659883 17:42111844-42111866 CCTCCAGGGCAGGCATGATCACC 0: 1
1: 0
2: 4
3: 20
4: 183
Right 1147659895 17:42111886-42111908 GCTCCATTCTGGGAATGGCAGGG 0: 2
1: 0
2: 1
3: 16
4: 199
1147659882_1147659895 20 Left 1147659882 17:42111843-42111865 CCCTCCAGGGCAGGCATGATCAC 0: 1
1: 0
2: 2
3: 19
4: 163
Right 1147659895 17:42111886-42111908 GCTCCATTCTGGGAATGGCAGGG 0: 2
1: 0
2: 1
3: 16
4: 199
1147659889_1147659895 -6 Left 1147659889 17:42111869-42111891 CCATTGGTAGGACCGAAGCTCCA 0: 1
1: 0
2: 0
3: 5
4: 36
Right 1147659895 17:42111886-42111908 GCTCCATTCTGGGAATGGCAGGG 0: 2
1: 0
2: 1
3: 16
4: 199
1147659884_1147659895 16 Left 1147659884 17:42111847-42111869 CCAGGGCAGGCATGATCACCTCC 0: 1
1: 1
2: 1
3: 21
4: 223
Right 1147659895 17:42111886-42111908 GCTCCATTCTGGGAATGGCAGGG 0: 2
1: 0
2: 1
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147659895 Original CRISPR GCTCCATTCTGGGAATGGCA GGG Exonic
900419673 1:2550455-2550477 GCTTCCTTCTGGGAAAGCCATGG + Intergenic
901193366 1:7425704-7425726 GAGCCCTTCTGGGACTGGCAGGG + Intronic
903194073 1:21672018-21672040 GCACCATTCTGAGACTGTCAGGG + Intergenic
903725842 1:25443813-25443835 TCTCCACTTTGGGAATGGTAAGG + Intronic
904494873 1:30880877-30880899 TCTCCTTTAAGGGAATGGCATGG - Intronic
905127272 1:35724458-35724480 GCTCCATCCTGGGGACAGCAGGG + Intronic
905792412 1:40797242-40797264 GCCCCAATCTGGGCATGGCTGGG + Intronic
905792465 1:40797599-40797621 ACTCCTTTCTGGGACTGGCGAGG + Intronic
906300011 1:44674739-44674761 GCTGTATTCTGGGAATGGGCAGG + Exonic
906537199 1:46558045-46558067 CCTCAATTCAGGGAAGGGCAAGG - Exonic
907238104 1:53065061-53065083 GCTCCATTCTTAGAAGAGCAAGG + Intronic
907603630 1:55794283-55794305 GCTCCAATCTTGGAATGGGTTGG + Intergenic
910277197 1:85462412-85462434 GCTACAGTGTGGGAATGGAATGG + Intronic
913420571 1:118663503-118663525 TCTTCATTGTGAGAATGGCATGG - Intergenic
913971656 1:143421823-143421845 GCTCCGTTCTGGGAACTGAAAGG + Intergenic
914066033 1:144247436-144247458 GCTCCGTTCTGGGAACTGAAAGG + Intergenic
914113118 1:144718918-144718940 GCTCCGTTCTGGGAACTGAAAGG - Intergenic
915598136 1:156906825-156906847 GCTCCAGTCTGGGGATCGCAGGG - Exonic
915906465 1:159881726-159881748 GCTCAGGTCTGGGAAAGGCAGGG - Intronic
916270687 1:162938488-162938510 GCTCCATTCTGGGAAAAGCAGGG + Intergenic
917705118 1:177624674-177624696 ACTCCATCATGAGAATGGCAAGG + Intergenic
917733313 1:177897814-177897836 GGCGCATTCTGGGCATGGCAGGG - Intergenic
919743476 1:200994308-200994330 GTTCCATTCTGTGAATCGCTGGG + Intronic
920375360 1:205505203-205505225 CCTTCATTCTGGGAAGGGCAAGG + Intronic
920919021 1:210282703-210282725 GCCACATGCTGAGAATGGCATGG + Intergenic
924205116 1:241704219-241704241 GCTCCCTTCTCAGGATGGCAGGG - Intronic
1062946396 10:1465057-1465079 GCTCCTTCCTGGGCATGGCTGGG - Intronic
1063292377 10:4762421-4762443 GCTCCCTACTGGGAATGTCAAGG - Intergenic
1063567077 10:7180470-7180492 GGGCCCTTCTGGGAAGGGCAGGG - Intronic
1066620675 10:37345740-37345762 GCTAGATTCAGGGAATGGGAGGG + Intronic
1067131673 10:43570863-43570885 ACTCCATTCTGAGAAGGGAAAGG + Intronic
1069483630 10:68806479-68806501 TCTTCATTCTGGGCCTGGCAAGG + Intergenic
1069621572 10:69840685-69840707 GGTCCAGGCTGGGAATGTCATGG + Intronic
1070923049 10:80200985-80201007 GTTCCCTTCTGGGATTGGAAAGG + Intronic
1070954652 10:80455709-80455731 GCTTCATTCTGGGGGTGCCAGGG - Intronic
1074197518 10:111202500-111202522 TCTCCACACTGTGAATGGCAAGG - Intergenic
1075615729 10:123889881-123889903 GCTCCGTCCTGGGCATGGTAGGG - Intronic
1077307770 11:1875672-1875694 GCACCCTGCTGGGCATGGCAGGG - Intronic
1077308216 11:1877204-1877226 GCTCCGTTCTGGGAACTGAAAGG - Intronic
1077399154 11:2344780-2344802 GCAGCATTCTGGGAATGCAAAGG - Intergenic
1077539393 11:3139473-3139495 AGCCCATTCTGGGAAAGGCAGGG + Intronic
1077967101 11:7146609-7146631 GTTCATTTTTGGGAATGGCAAGG - Intergenic
1078734315 11:14006142-14006164 GCTATAATCTGGGAATGACAAGG + Intronic
1083577762 11:63804669-63804691 GCCCAATTGTGGGAAGGGCAGGG - Intergenic
1086988755 11:93279414-93279436 GGCCTATTCTGGAAATGGCATGG + Intergenic
1089751902 11:120657679-120657701 GCCCCATTCTGGCCATGGCAGGG + Intronic
1089831466 11:121331866-121331888 GCTCCATTCTTTGAAAGACAAGG - Intergenic
1096617877 12:52844516-52844538 GCACCATGCTGGAAATGGCTAGG - Intronic
1098673733 12:73263907-73263929 CCTCCATGTTGTGAATGGCAAGG + Intergenic
1099794721 12:87384981-87385003 GCTCCATTCTGGGGCTGGACAGG + Intergenic
1101529276 12:105559543-105559565 CCTCCCTTCCGGGAAAGGCAAGG + Intergenic
1103333120 12:120168597-120168619 GCCCCAGTCAGGGAAGGGCAGGG - Intronic
1104306202 12:127612761-127612783 GATCCATACTGGGGATGGCTTGG - Intergenic
1110323510 13:74187074-74187096 GCTTCCTTCTAGGAATGACAGGG + Intergenic
1115751909 14:36502566-36502588 AATTCATTCTGGGAAGGGCAAGG - Intronic
1116802114 14:49453816-49453838 AGACCATTCTGGGAGTGGCAGGG + Intergenic
1119160346 14:72447117-72447139 GTTGCATTCTGGGAAGGGAAAGG + Intronic
1119513557 14:75230335-75230357 CCCCCATACTGGGAGTGGCAAGG - Intergenic
1119959551 14:78839174-78839196 GCTCTATTCTGGGATGGCCATGG + Intronic
1120750769 14:88195857-88195879 GCTCCATTCTGTAAGTGGCAGGG - Intronic
1121220067 14:92278249-92278271 TCTCCAGTCTGGGAAAGGGAGGG + Intergenic
1121972923 14:98375327-98375349 GCTGCTTTCTGGGAGTGGAAAGG + Intergenic
1123133549 14:106007352-106007374 GCTCCATCCTGGGCATGGGGAGG + Intergenic
1123134776 14:106017767-106017789 GCTCCATCCTGGGCATGGGGAGG + Intergenic
1123135936 14:106027324-106027346 GCTCCATCCTGGGCATGGGGAGG + Intergenic
1123583571 15:21737798-21737820 GCTCCATCCTGGGCATGGGGAGG + Intergenic
1123620221 15:22180401-22180423 GCTCCATCCTGGGCATGGGGAGG + Intergenic
1125484700 15:40103908-40103930 GCTACAGTCTGGGAATAGGATGG - Intronic
1128314993 15:66654781-66654803 GCTCCAGTTTGGGGAGGGCAGGG - Intronic
1129188670 15:73925419-73925441 TGTTCCTTCTGGGAATGGCAGGG - Intergenic
1130158516 15:81375072-81375094 GCTCCATTCTGCTGATGGCTGGG - Intergenic
1130255666 15:82325017-82325039 GCTCCTTCCTGGGATTGGCTTGG - Intergenic
1130666927 15:85877765-85877787 GCTACATGCTGGGAATATCAAGG - Intergenic
1130841768 15:87707387-87707409 GCTAGACTCTGGTAATGGCAAGG - Intergenic
1131469089 15:92680421-92680443 GTTCCATTCTGGGGATGGTACGG - Intronic
1132461117 16:55343-55365 GCTCCATTTTACGAAGGGCAAGG - Intronic
1132905200 16:2278905-2278927 ACTCCACTCTGGGAAGGGCCAGG + Intronic
1134659025 16:15969883-15969905 GCTCCATGCTGGGAATCGAGCGG + Intronic
1135280795 16:21152536-21152558 GCTCCTTTCTGGGCTGGGCAAGG + Intronic
1136549759 16:30976679-30976701 GAGCCATTCTGGGATTGACAAGG + Intronic
1136717028 16:32289310-32289332 GCTCCTGTCTAGGACTGGCAAGG + Intergenic
1136835405 16:33495555-33495577 GCTCCTGTCTAGGACTGGCAAGG + Intergenic
1141717879 16:85737235-85737257 GGGCCATTCTGGGAACAGCAAGG - Intronic
1203009398 16_KI270728v1_random:228477-228499 GCTCCTGTCTAGGACTGGCAAGG - Intergenic
1143973859 17:10815590-10815612 GCTGCTTTCTGGGACAGGCAGGG - Intergenic
1147480293 17:40755031-40755053 GCTCCTTTCTGGCAATGAGAAGG - Exonic
1147659895 17:42111886-42111908 GCTCCATTCTGGGAATGGCAGGG + Exonic
1147660008 17:42112393-42112415 GCTCCATTCTGGGAATGGCAGGG + Intronic
1151140226 17:71984498-71984520 GTTATATTCTGGGAATGACACGG - Intergenic
1152580589 17:81164011-81164033 GCTCCAATTCGGGGATGGCAAGG + Intronic
1153997239 18:10453894-10453916 GCCCCAACCTGGGAAGGGCACGG - Intergenic
1154387894 18:13911988-13912010 GCTCCATGGTGTGGATGGCATGG + Intronic
1157716289 18:49889842-49889864 GCTACAGTCTGGGAGTGCCATGG + Intronic
1158626701 18:59077788-59077810 GATCCACGCTGGGAATGGGATGG + Intergenic
1158999819 18:62963071-62963093 GCTCTCTCCTGGGAATGACAAGG - Intronic
1160019096 18:75166635-75166657 GCTTAATTCTGGGACTGGGAGGG + Intergenic
1160032406 18:75273854-75273876 TTTCCATTTTGGGAATGGTAGGG + Intronic
1161572385 19:5037682-5037704 GCGCCATCCTGGGCATTGCAGGG + Intronic
1161744595 19:6047994-6048016 GGCCCATTCTGGGCACGGCAGGG + Intronic
1163001689 19:14372268-14372290 GCTTCTTTCTGGGACTGGCTGGG + Intergenic
1163578190 19:18122884-18122906 GCCCCATTCTGGGAAATGCAGGG + Intronic
1164825090 19:31278992-31279014 GCTCCTTGCTGGAAATGGAAGGG - Exonic
1165038504 19:33052221-33052243 GCTCCATTCTGGGCAGTGCCTGG + Intronic
1167553176 19:50175154-50175176 GCTCCATCTTGGGACTGACAAGG - Intergenic
925105132 2:1284246-1284268 CCTCCATCCTGGGAAGAGCATGG + Intronic
927108194 2:19845392-19845414 CCTCCATACTGGGGCTGGCAGGG + Intergenic
928104211 2:28457411-28457433 TCTCCAGGCTGGGAAAGGCAAGG + Intronic
928224464 2:29436300-29436322 GCTCCTGTCTGAGAAAGGCACGG + Intronic
928642628 2:33316381-33316403 GTTCCATTCTGGTACTAGCAAGG - Intronic
929574616 2:43043892-43043914 GCTCCAGTCTGGGAATGAGGAGG - Intergenic
929805162 2:45138600-45138622 TCTACATTCTGAGAATGGCAGGG + Intergenic
932283353 2:70513315-70513337 GGGCAATTCTGAGAATGGCATGG + Intronic
932430596 2:71671774-71671796 GCTCCATTCTGGCAATGTTGTGG + Intronic
932794855 2:74685520-74685542 GCTCCAATCCGGGAATCCCAGGG + Intergenic
934176351 2:89582756-89582778 GCTCCGTTCTGGGAACTGAAAGG + Intergenic
934286661 2:91657117-91657139 GCTCCGTTCTGGGAACTGAAAGG + Intergenic
935816211 2:106848306-106848328 GTTCCATGCTGGGAATACCAAGG + Intronic
936448991 2:112619293-112619315 GCACCTTTCTGGGTATGGCATGG - Intergenic
937320391 2:120957245-120957267 ACACCATGCTGGGAAAGGCAAGG - Intronic
937635181 2:124147670-124147692 GCTCCATTGAGGGGATGGAACGG + Intronic
938160384 2:128980135-128980157 GCTCAACTCTGAAAATGGCAAGG + Intergenic
942855007 2:180534982-180535004 GCTACATTCAGGGAAGAGCAGGG - Intergenic
944277209 2:197852419-197852441 TCTCTATGCTTGGAATGGCATGG + Intronic
946189266 2:217999175-217999197 TCTCCATTCTGGGAATGCTTTGG - Intronic
947912366 2:233809659-233809681 GCTATTTTCTTGGAATGGCAAGG + Intronic
948427134 2:237895295-237895317 GCTCCCATCAGAGAATGGCATGG + Intronic
1169303678 20:4469608-4469630 TCTCCATTCTGGGTGTGGCCTGG - Intergenic
1169651090 20:7868227-7868249 CTTCCATTCTGGGCCTGGCAAGG - Intergenic
1171232553 20:23499461-23499483 GCTCATTTCTGGAAAAGGCAGGG - Intergenic
1172109924 20:32538642-32538664 GCTCCACTCTGGGAGGGCCAAGG + Intronic
1173859610 20:46274267-46274289 GCTCCTTTCTGGGGCTGGGAAGG + Intronic
1175033200 20:55975197-55975219 GCTCAACTCTGTGGATGGCAGGG - Intergenic
1175947931 20:62567314-62567336 GCCCCGTCCTGGGGATGGCAAGG - Intronic
1175987685 20:62772053-62772075 GCTCCTTGCTGGAAGTGGCAGGG - Intergenic
1176256377 20:64155186-64155208 GCTCCATTCTTGGGAATGCAGGG + Intronic
1179188496 21:39103743-39103765 GCTCCATCCCTGGAATGGAAGGG - Intergenic
1180922934 22:19531176-19531198 ACACCATTCTGGCAATGACAGGG - Intergenic
1181007402 22:20020579-20020601 GGTACATACTGGGAATGGCAGGG + Intronic
1183225198 22:36545095-36545117 GCTCCTTTAAGGGACTGGCAAGG - Intergenic
949140574 3:628042-628064 GCTCCAGCCTGGGAAAGCCACGG - Intergenic
950226092 3:11235646-11235668 GCTCCCTGCTAGGAATGGCGGGG + Intronic
953917192 3:46927594-46927616 GCTCCGCTCTGGGGGTGGCAGGG - Intronic
954387359 3:50251161-50251183 GCCACATTTTGAGAATGGCAGGG + Intronic
955008252 3:54989915-54989937 ACTGCATGCTGGGAAAGGCAAGG - Intronic
956421067 3:69086535-69086557 ATTGCATTCTGGGAATGGCTTGG + Intronic
957198573 3:77102186-77102208 GCTCCATTCTAGGAAAGACCCGG - Intronic
958101295 3:89014746-89014768 GCTCTATTCTAGGAATGGCTTGG + Intergenic
960150041 3:114239969-114239991 GCTGCATTTTGGGAAGGGGAGGG - Intergenic
960621194 3:119638362-119638384 GCCCCATTCTGGCAAGGGTAAGG - Intronic
961471296 3:127114825-127114847 GCTCCACTCTGAGACAGGCAGGG + Intergenic
963864870 3:150349843-150349865 CTTCCATGCTGGGAAAGGCAGGG - Intergenic
966640822 3:182187708-182187730 CCTCCATTCAGGGAATGTAATGG + Intergenic
967991541 3:195135229-195135251 GCAGAATTCTGGGAATGGGAGGG - Intronic
969897754 4:10321027-10321049 CCTGGATTCTGGGAGTGGCATGG + Intergenic
970581036 4:17474287-17474309 GCTACATACTGGGAGTTGCAAGG + Intronic
971770633 4:30891658-30891680 ACTCCATCATGGGAAGGGCAGGG + Intronic
976068703 4:81217914-81217936 CTGCCATACTGGGAATGGCAGGG - Intergenic
976123248 4:81805610-81805632 CCTCCATTCAGGGAAGGGGAAGG - Intronic
977105036 4:92871783-92871805 GCTCCATACTGTGAAAGACAGGG + Intronic
977494694 4:97760287-97760309 GCTAGATTCTGGGAAGGGTATGG - Intronic
978678358 4:111347074-111347096 TTACCAGTCTGGGAATGGCAGGG - Intergenic
983399449 4:167244663-167244685 GCTCCAACCTGGAAGTGGCAAGG - Intergenic
985171128 4:187151417-187151439 GCTCCATTCTATGACTTGCATGG + Intergenic
985668453 5:1193877-1193899 GCTCCTTTCTGGAAGTGGGATGG + Intergenic
986198720 5:5561605-5561627 CCTGCCCTCTGGGAATGGCAGGG + Intergenic
990061868 5:51660262-51660284 GCCCCATTTTGGCAATGGAATGG - Intergenic
991959972 5:72034759-72034781 GGCCCACACTGGGAATGGCAGGG + Intergenic
994157553 5:96520832-96520854 GCTCCATTCAGGGTCTGGAATGG - Intergenic
996026685 5:118654232-118654254 GCTAGATCCTGGGAATGGAAAGG + Intergenic
996517985 5:124394849-124394871 GCTGCATTCTGGGCTTTGCAGGG + Intergenic
998084060 5:139301610-139301632 GCTCCATTCTGGGCTGGGCGCGG - Intronic
998349884 5:141493660-141493682 GCACCATTCTGGGGCTGCCATGG - Intronic
999189882 5:149739509-149739531 CCTCTCTTCTGGAAATGGCAAGG - Intronic
999867957 5:155721682-155721704 GCAACATTCTGGGAAAGGCAAGG - Intergenic
1002920858 6:1572167-1572189 GTTCCATGCTGGGAGGGGCAAGG - Intergenic
1004489434 6:16100232-16100254 CCTCTATTCTGGGAATGACAGGG + Intergenic
1004613696 6:17269564-17269586 GCTCCATCATGAGAAGGGCATGG + Intergenic
1006401515 6:33820680-33820702 GCTCCACTCTGGCAGGGGCAGGG - Intergenic
1006521461 6:34573571-34573593 CCTCCTTTCTGGGAATGGGGAGG - Intergenic
1006639122 6:35479966-35479988 GCTCCAGCCTGGGACAGGCAAGG - Intronic
1008563497 6:52744823-52744845 GATTCATTGGGGGAATGGCATGG + Intergenic
1011434392 6:87321911-87321933 ACTCCATCATGGGAATGGCAAGG + Intronic
1014891308 6:126849594-126849616 GCGCCATTCACGGACTGGCAAGG + Intergenic
1031442777 7:121813930-121813952 TCACCCATCTGGGAATGGCATGG + Intergenic
1033443464 7:141400535-141400557 GCACTATTCTGGGAATGGGTGGG - Intronic
1034873742 7:154706439-154706461 TCTCCAGTCTGGGAATTGCTGGG - Intronic
1035486985 7:159233682-159233704 TCTTCATGCTGGGAATGGGATGG + Intergenic
1036662915 8:10719477-10719499 AATTCATTCTGGGAATGGAAAGG + Intergenic
1037497610 8:19455371-19455393 TCTCCAGTCTGGGGATGGAAAGG + Intronic
1039679645 8:39717003-39717025 GCTCCATTTTGGCATTTGCATGG + Intronic
1044821045 8:96155991-96156013 GGACCATTCTGGGAATAGCCCGG - Intronic
1044939003 8:97321547-97321569 GCTACTTTCTGGTCATGGCATGG + Intergenic
1045489614 8:102658106-102658128 GCTCCATACTGTGACTGGAATGG + Intergenic
1045510297 8:102807848-102807870 ACTGCGTTCTCGGAATGGCAGGG + Intergenic
1045535349 8:103021976-103021998 GCGCCGCTCTGGGAATGGAACGG + Intronic
1045771578 8:105746868-105746890 GTTCTATTCCAGGAATGGCAGGG - Intronic
1046055494 8:109073434-109073456 GCTCCATGCTTGGAAGAGCAGGG - Intergenic
1048865512 8:138758314-138758336 GCAGGAATCTGGGAATGGCATGG - Intronic
1049735095 8:144200574-144200596 GCTCCATCCTGGACATGGCCAGG - Intronic
1049825398 8:144664391-144664413 CTTCCATTCTGTGAAGGGCAAGG + Intergenic
1049831608 8:144704632-144704654 GCCCCAGGCTGGGAATGGCAGGG - Intergenic
1052476853 9:28971383-28971405 GCTCCCTTCTGGCAATGGGCAGG - Intergenic
1055043807 9:71904289-71904311 TCACTATTCTGGGAATGGGAGGG - Intronic
1055720622 9:79169401-79169423 CCTTCATTCTTGGAAAGGCATGG + Intergenic
1058212991 9:102196422-102196444 TCTCTATTCTGGGAGTGGCTGGG + Intergenic
1059189466 9:112310596-112310618 GCTCCATTAAGGTAAGGGCAGGG - Intronic
1061569855 9:131470552-131470574 CCTCCATTGTGATAATGGCATGG + Intronic
1062496987 9:136836577-136836599 GCTCCATTCTGGGGCTGGCCTGG - Intronic
1062537443 9:137027204-137027226 GCTCCAGCCTGGGAAGGGAAGGG - Intronic
1185814915 X:3145808-3145830 GCTCCCTTGTGTGCATGGCATGG - Intergenic
1186738756 X:12495171-12495193 TCTCCATTCTGGCAAGAGCAGGG - Intronic
1188540418 X:31243670-31243692 ACTCCATGCTGGGAAGGACATGG + Intronic
1193503625 X:82310688-82310710 GCTACATTCTGGAATGGGCATGG + Intergenic
1194077668 X:89417067-89417089 GCTCCTCTCTGGGACTGGCGAGG + Intergenic
1195758533 X:108222741-108222763 GCTTCATTCTGGGAATGATGGGG + Intronic
1199280815 X:145997202-145997224 GCTCCTTTCTGGGTAGAGCAAGG - Intergenic
1199689769 X:150299832-150299854 GTTCCATTATGAGTATGGCAGGG - Intergenic
1201401771 Y:13611317-13611339 GGTCCTTTTTGGGCATGGCATGG + Intergenic