ID: 1147661885

View in Genome Browser
Species Human (GRCh38)
Location 17:42121195-42121217
Sequence GCTGAAGCCGGGCTGGGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 453}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147661878_1147661885 0 Left 1147661878 17:42121172-42121194 CCGGGGTGGGAGTCGGAATCGGG 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1147661885 17:42121195-42121217 GCTGAAGCCGGGCTGGGTGCAGG 0: 1
1: 0
2: 2
3: 40
4: 453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147661885 Original CRISPR GCTGAAGCCGGGCTGGGTGC AGG Exonic
900150866 1:1178906-1178928 GCTGAGCTCGGCCTGGGTGCCGG - Intronic
900151307 1:1180394-1180416 GCGGAGGCCGGGCTGGGCCCCGG - Intronic
900203065 1:1419953-1419975 GCTGGAGCCAGGCTGGGGGACGG - Intronic
900307875 1:2019745-2019767 GCTGAACCTGGGCTGGGCGAGGG + Intronic
900349111 1:2226797-2226819 GCCCAAGCTGGCCTGGGTGCTGG - Intergenic
900364586 1:2305879-2305901 GCTGATGGCGCGCTGGGGGCGGG + Intronic
900436502 1:2633620-2633642 CCGCAAGCAGGGCTGGGTGCAGG - Intergenic
900516616 1:3085226-3085248 TCTGAAGCCTGGGTGGGTGCTGG + Intronic
900544747 1:3222356-3222378 GCTCCAGCAGGCCTGGGTGCTGG + Intronic
900594256 1:3473302-3473324 GCAGAAGCTGGGCTGGGAGCAGG - Intronic
900609124 1:3537063-3537085 GGCGAAGCTGGGCTGGGTGTGGG + Intronic
901210875 1:7525340-7525362 GCTGGAGCTGGGATGGGTGAGGG - Intronic
901630964 1:10647969-10647991 ACGGAGGCCGGGCTGGGAGCGGG + Exonic
901660501 1:10795610-10795632 GCTGGAGCCCGCCTGGGTCCCGG - Intronic
901865574 1:12104684-12104706 GCAGCAGAAGGGCTGGGTGCTGG - Intronic
902818114 1:18927490-18927512 ACTGCAGCAGGGCTGGATGCAGG + Intronic
904041816 1:27589885-27589907 GCAGAAGGCGGCCTGGGTGGGGG - Intronic
904534820 1:31192318-31192340 GATGAACCCTGGCTGGGTGAGGG - Intronic
905605555 1:39296102-39296124 GCTGCAGACAGGCTGGGGGCTGG + Intronic
905920547 1:41716084-41716106 GCAAAGGCCGGGCAGGGTGCAGG + Intronic
906205833 1:43985825-43985847 GCTGAGGCTGGGCTGGGGGTTGG - Intronic
906294629 1:44641923-44641945 GCTGCTGCCCGGCTGGGAGCTGG + Intronic
906607473 1:47182019-47182041 GGAGAAGCTGGGCTGGCTGCTGG + Intergenic
907305674 1:53511765-53511787 GCTGAAGCTGGGCTGGGGCCTGG + Intronic
907523386 1:55039676-55039698 GCGGAATCCTGGCTGGGAGCTGG - Exonic
907662718 1:56407915-56407937 GATGGAGAGGGGCTGGGTGCTGG - Intergenic
908173463 1:61530572-61530594 GCTGAAGCCTGGCTTTATGCTGG - Intergenic
908396806 1:63732782-63732804 GCTGAAGGCTCTCTGGGTGCAGG + Intergenic
909261265 1:73491874-73491896 GCTGCAGCCGGGCAGGGGGATGG - Intergenic
909439118 1:75678166-75678188 GCTGAAGCGAGGCTGGGGGAGGG + Intergenic
910490751 1:87766972-87766994 TCAGAAACTGGGCTGGGTGCTGG - Intergenic
911700773 1:100949727-100949749 GCTGCAGCCTGGCTGGGGGAGGG - Intronic
912492089 1:110068058-110068080 TCTGAACCCAGGCTGCGTGCTGG - Intronic
912681088 1:111729506-111729528 GCTGCAGCGGGGCGGGGTGGGGG + Intronic
913158156 1:116120659-116120681 GCAGGTGCCAGGCTGGGTGCTGG - Intronic
913498305 1:119448284-119448306 GGTGCAGCGGGGCTTGGTGCAGG - Intergenic
913506019 1:119516831-119516853 GGTGCAGCAGGGCTTGGTGCAGG - Intergenic
913516757 1:119611754-119611776 GGTGCAGCGGGGCTTGGTGCAGG - Intergenic
915141778 1:153772498-153772520 CCTGGAGCCAGGCTGGGGGCAGG + Intronic
915468760 1:156113687-156113709 GGGGAAGCAGGGCTGGGGGCTGG - Intronic
916480785 1:165212432-165212454 GCTGTGGCCCAGCTGGGTGCAGG - Intronic
917713529 1:177711098-177711120 GCGGGAGCGGGACTGGGTGCTGG + Intergenic
918042294 1:180920704-180920726 GCTGGGGGCGGGCTGGGGGCGGG + Intronic
918616571 1:186551024-186551046 GCTGCAGCCGGGCCGGGGGAGGG - Intergenic
919887048 1:201942203-201942225 GCTGAAGGCCTGCTGTGTGCTGG + Intronic
919903510 1:202061327-202061349 GGAGAAGCAGGGCTGGGTGTGGG - Intergenic
920132238 1:203741256-203741278 GCTGAAGCGGGGCTGGAGGAAGG - Exonic
920314271 1:205066359-205066381 GCTCAAGCCTGGCTGGGAGGAGG + Intronic
920320941 1:205121917-205121939 GCTGAAGCCGGCCGGGGAGAAGG - Exonic
922127618 1:222743902-222743924 GCTGAAGCCGAGATGGTTGCTGG - Intronic
922502937 1:226110229-226110251 GCGGAGGCCGGGCTGGGGGGCGG + Intergenic
923546518 1:234927487-234927509 GCTGAGGCCAGGCTGGGTGGAGG - Intergenic
923585208 1:235263697-235263719 GCAGAAGGAGGGCTGGGCGCGGG + Intronic
923658728 1:235940529-235940551 GATGAAACCGGGTTGGGTGGTGG - Intergenic
1062803736 10:399031-399053 GCTGTATCCCGGCTGGGTGAGGG - Intronic
1062826180 10:570562-570584 GCTGAAGTAGTGTTGGGTGCAGG - Intronic
1062933583 10:1368827-1368849 CCTGGGGCCGGGCTGGGTGAGGG + Intronic
1063004171 10:1952624-1952646 GCAGAGGCCGGGGAGGGTGCTGG - Intergenic
1063138878 10:3239449-3239471 GCTGCAGCCACGATGGGTGCTGG + Intergenic
1063384496 10:5607645-5607667 GCTGGCCCAGGGCTGGGTGCAGG - Intergenic
1065197575 10:23281509-23281531 GCTGTGGCGGGGCTGGGGGCTGG + Intronic
1069559053 10:69416841-69416863 CTGCAAGCCGGGCTGGGTGCTGG + Exonic
1069626788 10:69873086-69873108 GCTGCAGCCGGTCAGGGGGCCGG + Intronic
1069820380 10:71223919-71223941 GCAGGAGCTGGGCTTGGTGCAGG + Intronic
1069990953 10:72315699-72315721 GCTGAAGCAAGCCTGGGAGCTGG - Intergenic
1069992096 10:72322273-72322295 CATGAAGCCGGGCTGGGCGAGGG + Intergenic
1071146005 10:82572951-82572973 GCTCAAGCAGGGCTGGAGGCAGG + Intronic
1071968555 10:90878206-90878228 GCTGAGGCAGGGCAGGGTCCAGG - Intronic
1073076846 10:100829683-100829705 ACTGGAGCCTGGCTGGGCGCCGG - Exonic
1073351241 10:102821594-102821616 GGTGAAGCCTGGCTGGGTGTGGG - Intergenic
1073694510 10:105849760-105849782 GCTGGAGCCTGGCTAGGGGCAGG + Intergenic
1075144620 10:119872652-119872674 GCTGAAGAGGAGCTGGGCGCCGG - Exonic
1075638693 10:124048989-124049011 GCAGAGGCCGGGCTGGTTGGTGG - Intronic
1075838546 10:125477261-125477283 GCTGGAGCCAGGCAGGGTGCAGG - Intergenic
1076586948 10:131555844-131555866 TCAGAAGCTGTGCTGGGTGCTGG + Intergenic
1076916408 10:133424777-133424799 GGTGGAGCGGGGCCGGGTGCGGG - Intergenic
1077236987 11:1486581-1486603 GGAGAAGCGGGGCGGGGTGCCGG + Exonic
1077477058 11:2795530-2795552 GCTCAAGCCAGGCTGGGTTGGGG - Intronic
1077532111 11:3102146-3102168 GCTGCAACCGGCCTGGGTGCTGG - Intronic
1077579443 11:3407510-3407532 GCTCAAGCCAGGCTGGGGGTTGG - Intergenic
1077634926 11:3835913-3835935 GCTGCAGCTGGGCTGGGAGGAGG + Intronic
1079023492 11:16927071-16927093 GCTGAGGCGGGGGTGGGGGCAGG + Intronic
1079309998 11:19356676-19356698 GCTGCAGCTGGGATGGATGCTGG + Intronic
1079426848 11:20351782-20351804 GCAGAAGCTTGGGTGGGTGCAGG - Intergenic
1080643647 11:34173189-34173211 GCAGCAGCCGGGCTGCCTGCCGG + Exonic
1080667075 11:34345370-34345392 CCTGAAGGAGGGCAGGGTGCAGG - Intronic
1081488121 11:43547425-43547447 TCGGAAGCCGGGCAGGGTGGGGG + Intergenic
1081669249 11:44934011-44934033 GCTGAACTCAGGCTGGTTGCAGG + Exonic
1081705754 11:45181139-45181161 GCTGAAGCCCGGCGCGGTGGTGG + Intronic
1083177107 11:60957294-60957316 GCTGAAGGCAGGGTGGGAGCAGG - Intergenic
1083849069 11:65354907-65354929 TCGGGAGCCGGGCTGGGGGCAGG + Exonic
1084003798 11:66313001-66313023 GCTGAGCCCGGGCTGGGCGCAGG + Intergenic
1084554680 11:69868705-69868727 GCTGCGGCCGGGCTGGGGGCTGG - Intergenic
1084645213 11:70452854-70452876 GATGAGGCAGGGCTGCGTGCAGG + Intergenic
1084835946 11:71801942-71801964 GCTCAAGCCAGGCTGGGGGTTGG + Intergenic
1086612862 11:88778169-88778191 GCTGTAGCCTGGCTGGGGGAGGG - Intronic
1087311159 11:96545411-96545433 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1088004637 11:104926050-104926072 GCGGAAGCCTGGCTGGGGGAGGG - Intergenic
1089123933 11:116162772-116162794 GAGGCAGCCGGGCTGGGGGCTGG - Intergenic
1089579079 11:119470336-119470358 GTTGACACCAGGCTGGGTGCTGG - Intergenic
1089588078 11:119522591-119522613 GCTGGAGCCTGGCTCGGTGGGGG - Intergenic
1089650264 11:119908334-119908356 GGTGGAGCAGGGCTGGGTGGTGG + Intergenic
1090398771 11:126435377-126435399 GCTTGAGCGGGGCTGGGTGAGGG + Intronic
1090434779 11:126677635-126677657 GCTGAAGCAGGGCTGGGATGGGG + Intronic
1090827280 11:130396673-130396695 GTTGAAGCCATGCTGGGTGAGGG + Intergenic
1091281355 11:134383554-134383576 CGGGAAGCCGGGCTGGGAGCGGG - Intronic
1091773950 12:3172218-3172240 GCTGAGGCTGGGGTGGGGGCGGG - Intronic
1092407377 12:8230461-8230483 GCTCAAGCCAGGCTGGGGGTTGG - Intergenic
1094135395 12:27120017-27120039 GCTGTAGCCTGGCTGGGGGAGGG - Intergenic
1094759980 12:33521143-33521165 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1095038914 12:37421675-37421697 GCTGCAGCCGCGGTGGCTGCTGG + Intergenic
1095891641 12:47240302-47240324 GCTGAAGCCTGCCAAGGTGCTGG - Intergenic
1096114935 12:49050256-49050278 GCTGGGGCAGGGCTGGGGGCGGG + Exonic
1097716200 12:62969257-62969279 CCTGAAGTCGGTCTGTGTGCAGG + Intergenic
1097905242 12:64912800-64912822 GGTGAAGCGAGCCTGGGTGCAGG + Intergenic
1098425807 12:70365623-70365645 GCTGAGGCCGGGAGGGCTGCAGG - Intergenic
1098665224 12:73153205-73153227 GCGGCAGCCAGGCTGGGTGAGGG - Intergenic
1099514813 12:83584685-83584707 GCGGAAGCCAGGCTGGGGGAGGG + Intergenic
1103125814 12:118421464-118421486 CTTTATGCCGGGCTGGGTGCTGG + Intergenic
1103443844 12:120981277-120981299 GAAGAAGCCGGGGTGGGTCCTGG + Intronic
1104039779 12:125122199-125122221 GCTGATGCGGGGCTGGGGGCAGG + Intronic
1104091540 12:125521745-125521767 CCTGAGGCAGGGCTGGGAGCGGG + Intronic
1105458821 13:20565669-20565691 GCTGAAGGCAGTCTGGGGGCAGG + Intergenic
1106226850 13:27792649-27792671 GCAGAGGGCGGGCTGGCTGCGGG + Exonic
1107016265 13:35710061-35710083 GCTGGAGCCAGGGTGGGTGCAGG + Intergenic
1107159381 13:37208523-37208545 CCTGAAGCAGGACGGGGTGCAGG - Intergenic
1112500146 13:99936658-99936680 CCTGAAGTTGGTCTGGGTGCTGG - Intergenic
1113255547 13:108500884-108500906 GCTGGAGCTGGGCAGGGAGCGGG - Intergenic
1113274197 13:108709974-108709996 GATGATGCCGGGCTGGATGGAGG + Intronic
1113966946 13:114158174-114158196 GCTGAAAACGGGGTGGGGGCTGG - Intergenic
1114981297 14:28168388-28168410 GCTGCAGCCTGGCTGGGGGATGG + Intergenic
1115644773 14:35361238-35361260 GTTGAAGCGGGGCTGGGACCAGG + Intergenic
1115689250 14:35826466-35826488 GCGGTGGCCGGGCTGGGCGCCGG + Exonic
1115889765 14:38013179-38013201 GCTGAAGGTGGGCTGGGTTGTGG + Intronic
1116331081 14:43598318-43598340 GCAGAAGCCAGGCTGGGGGAGGG + Intergenic
1116820415 14:49621398-49621420 GCCGAACCCGCGCGGGGTGCCGG + Exonic
1118757224 14:68853860-68853882 GCTAGAGCTGGGCAGGGTGCGGG - Intergenic
1121733839 14:96204715-96204737 GCTGGAGCCAGGCTGGCTGTGGG - Intronic
1121751803 14:96363573-96363595 GCGGCAGCCGGGGTGGCTGCGGG + Exonic
1122111052 14:99502894-99502916 GCTGCTGCTGGGCTGGTTGCTGG - Exonic
1122816996 14:104318861-104318883 CCTGAGGCCGGCCTGGGTGACGG - Intergenic
1122929312 14:104926126-104926148 TCTGCAGCCAGGCTGGGCGCTGG - Intronic
1122967813 14:105139400-105139422 CATGAAGCCGGGCTAGGTTCTGG - Intergenic
1123063668 14:105605746-105605768 GCTGGGGCCTGGCTGGGGGCTGG + Intergenic
1124343165 15:28902971-28902993 GATGCAGCCTGCCTGGGTGCTGG + Intronic
1124364547 15:29062812-29062834 GCTGCAGCCGGGTGGGATGCCGG - Intronic
1124371110 15:29105287-29105309 GCTGCGGCAGGGCTGGGTGCAGG - Intronic
1124635989 15:31365597-31365619 GCTGGAGCCGGGTGGGGTGGGGG + Intronic
1124646587 15:31441269-31441291 GCTGACGCCGGGTGGGTTGCGGG - Intergenic
1124890444 15:33727136-33727158 GCTGAAGACAGGCTGTGTGGGGG - Intronic
1125200007 15:37095173-37095195 GCTGAGGGCGGGCTGGGGGTGGG - Intronic
1125930090 15:43594056-43594078 GCTGGAGCCGGAATGGGAGCCGG - Exonic
1125943258 15:43693888-43693910 GCTGGAGCCGGAATGGGAGCCGG - Exonic
1126372811 15:47964925-47964947 GCTGATGCGGGGCTGGGGGTTGG - Intergenic
1127193733 15:56561817-56561839 GCTGAAGCCTGGCCGGGGGAGGG + Intergenic
1128611075 15:69074170-69074192 CCCGGAGCAGGGCTGGGTGCAGG + Intergenic
1128678167 15:69627022-69627044 GCTGGACCTGGGCTAGGTGCTGG - Intergenic
1129539226 15:76337716-76337738 GCCGAGGCCGGCCTGGGTCCGGG + Intronic
1129682893 15:77667985-77668007 GGTGAACCAGGGCTGGGAGCAGG - Intronic
1130403467 15:83578291-83578313 GCTGAAGCCAGGCTGAGGGCAGG - Intronic
1130862261 15:87901435-87901457 GGTCAAGCCAGGCTGAGTGCTGG + Intronic
1131116227 15:89797755-89797777 GCTGTGGCTGGGCTGGGTGGAGG - Intronic
1131176467 15:90212330-90212352 GCTGAAGCCTGTCGGGGTGGAGG + Intronic
1132642421 16:983915-983937 GCTGAAGCAGGGCTTGGAGATGG + Exonic
1132745411 16:1434220-1434242 CCTGAAGCCGGGCTGGGTTTGGG + Intergenic
1132754208 16:1474812-1474834 GGTGAGGCCGGGCAGGGCGCAGG - Exonic
1132894786 16:2223668-2223690 GCCGAAGCCGGGCGGGAAGCGGG + Exonic
1132944911 16:2527441-2527463 GCCGGGGCTGGGCTGGGTGCTGG + Intronic
1133049619 16:3109849-3109871 GCTGAAGCGGGGAGGGGTCCTGG - Intergenic
1133348062 16:5083570-5083592 GCTCAAGCCAGGCTGGGGGTTGG - Intronic
1133494746 16:6306347-6306369 GCTGGAGCCGGGCAAGTTGCAGG + Intronic
1134105668 16:11484588-11484610 GCTGAAGATGGTCTGGGTGCTGG + Intronic
1134133126 16:11663267-11663289 GCTGAGGGCAGGCTGGGGGCAGG + Intergenic
1135049316 16:19179689-19179711 GCTGAACCCTGGCTGGGTGCTGG - Intronic
1135091923 16:19524172-19524194 GCTGAGGGCGGGCTCTGTGCTGG + Intronic
1135479791 16:22813561-22813583 GCTGTAGACGGGATGGGTGGAGG - Intergenic
1136519521 16:30786880-30786902 GCTGTGGCCGGGGTGGGGGCGGG - Intronic
1136993793 16:35173800-35173822 GCTGAAGCAGGGCTGGAACCAGG + Intergenic
1137289261 16:47040704-47040726 ACTGAAGTCGGGGTGGGTTCAGG + Intergenic
1137475941 16:48810593-48810615 GCTGACGCTGGGCTGGGGGGTGG + Intergenic
1137530366 16:49275503-49275525 CTTTAAGCCTGGCTGGGTGCCGG + Intergenic
1139203805 16:65005876-65005898 GCTGAGTCATGGCTGGGTGCTGG - Intronic
1139214867 16:65117884-65117906 GCAGCAGCCGGGGTGGGGGCTGG - Intronic
1139382087 16:66538880-66538902 GCTGTATCCGGGCTGGGATCTGG + Intronic
1139939187 16:70592211-70592233 GCTGAGGCTGGGCTGGGGCCAGG + Intronic
1139946933 16:70648022-70648044 GGTGAGGCCAGGCTGGGAGCTGG + Intronic
1140416094 16:74774774-74774796 GCAGACGCCGGGCTGCGCGCTGG - Exonic
1142067129 16:88069018-88069040 GCTGGAGCTGGGCTGGGTGCAGG - Intronic
1143345237 17:6244416-6244438 GCGTCAGCCGGGCTGGGGGCAGG - Intergenic
1143954047 17:10655146-10655168 GCTGAAGGAGGGCAGGGTGGAGG - Intronic
1144784365 17:17823670-17823692 GCTGGGGCGGGGCTGGGGGCGGG - Intronic
1144832517 17:18139663-18139685 CCTGAAGGCAGGCTGGGTGTGGG - Intronic
1145062945 17:19743853-19743875 GCTGGATCCGGGCAGGGTGGAGG + Intronic
1145127109 17:20310707-20310729 GCTGCTGCAGGACTGGGTGCTGG + Intronic
1147324474 17:39663708-39663730 GCTGAAGCCTGGCAGGGGGCGGG - Intergenic
1147661885 17:42121195-42121217 GCTGAAGCCGGGCTGGGTGCAGG + Exonic
1148053609 17:44780908-44780930 GCTGCAGCAGGGATGGGTGGGGG - Exonic
1148115609 17:45172891-45172913 GCTGAAGCTGCCATGGGTGCTGG + Intergenic
1148733435 17:49851382-49851404 GCGGGAGCCGGGCCGGGGGCGGG + Intergenic
1148873627 17:50673558-50673580 GCTGCAGCAGGGCTGGGTACGGG - Exonic
1148904690 17:50904835-50904857 GCTGAGGCTGGGCTGGCTACGGG - Intergenic
1148911866 17:50947183-50947205 GCTGGAGGCCGGCTGGGTGGGGG + Intergenic
1152242040 17:79165890-79165912 CCTGCAGCAGGGCTGGGAGCCGG + Intronic
1152377729 17:79927441-79927463 GCTGGGGCCGGGCTCGGTGCGGG + Intergenic
1152423703 17:80207780-80207802 GCTGAGGCCGGGTGGGGTTCTGG - Intronic
1152475636 17:80516302-80516324 GAGGAGGCCTGGCTGGGTGCTGG - Intergenic
1152549892 17:81024030-81024052 GCTGCAGCCAGGGTGGGTGCAGG - Intergenic
1152552005 17:81034791-81034813 GCAACAGCCGGGCTGGGGGCGGG - Intergenic
1152640113 17:81445754-81445776 GCTGAATCCGGGCTGCCTGCAGG + Intronic
1152696604 17:81800786-81800808 GCTGCAGCGGGGCTGGGGGCAGG - Intergenic
1155218223 18:23662261-23662283 CCTGAAGCCTCCCTGGGTGCTGG + Intronic
1156618057 18:38811635-38811657 GCTGATGCAGAACTGGGTGCAGG - Intergenic
1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG + Intergenic
1159103442 18:63980154-63980176 GGAGAAGCAGGGCTGCGTGCAGG - Intronic
1160008740 18:75088240-75088262 GCTGAGGGTGGGCTGGGTGTGGG - Intergenic
1160531416 18:79567165-79567187 GATGAGGCCGGGCTTGGCGCCGG - Intergenic
1160731801 19:644612-644634 GCAGGAGCCGTGCTGGGTGCAGG + Intergenic
1160855322 19:1214710-1214732 GCTGGAGCCTGGGTGGGTGTGGG + Intronic
1161272421 19:3397436-3397458 GCTGCAGCCAGGCTGGGGGCTGG + Intronic
1162501474 19:11056505-11056527 GCTCAAGGCGGGCTGTGTCCAGG + Intronic
1162992477 19:14312490-14312512 GCCGCAGCCGGGGTGGGGGCAGG + Intergenic
1163283289 19:16330506-16330528 TCTGCAGCCTGCCTGGGTGCTGG - Intergenic
1163365572 19:16874173-16874195 GCTGAAGGTGGCCTGAGTGCAGG - Intronic
1164389504 19:27805769-27805791 GCTGAAGCAGGGCTGGAACCAGG - Intergenic
1164919600 19:32079005-32079027 GCTGCAGGGGGGCTGGGTGGGGG - Intergenic
1164923046 19:32103864-32103886 GCTGGAGACAGGCTGGGTGGGGG + Intergenic
1165022155 19:32934123-32934145 GCTGGTGGCTGGCTGGGTGCGGG + Intronic
1165448317 19:35868783-35868805 GGTGAGGCCGGGCCGGGTCCTGG + Exonic
1166003812 19:39893884-39893906 GCAGAGGCGGGGCTGGGGGCGGG - Intronic
1166746784 19:45145551-45145573 TCTGAGTCCGGGCTGGGTGCGGG - Exonic
1166747033 19:45146315-45146337 GCTGGGGCCGGGCTGGGGACAGG + Intronic
1167040564 19:47020652-47020674 GCCCAAGCCGGGCGGGGGGCGGG - Intronic
1167152172 19:47716624-47716646 GCTGAAGCGGGGCGGGGCACGGG + Exonic
1167154597 19:47730317-47730339 GGTGTGGCCGGGCTGGGGGCGGG - Intronic
1167697547 19:51024211-51024233 GTTGAAGCCGGGGTGGGGGAAGG + Exonic
925640392 2:5981412-5981434 CCTGAAGCCGGGGGAGGTGCAGG - Intergenic
926019662 2:9484074-9484096 GCAGGAGCTGGGCTGGGGGCTGG - Intronic
926682420 2:15674090-15674112 GCTGCAGCCCCGCTGGGAGCAGG + Intergenic
926884446 2:17584545-17584567 CCTGACTCTGGGCTGGGTGCTGG - Intronic
927188073 2:20496941-20496963 CCTGAAGCCCAGCTGGGTGGCGG + Intergenic
927515407 2:23669111-23669133 GCTGAAGCCTGGCCGCGTGGGGG - Intronic
927542743 2:23927213-23927235 GCTGACGCCGCGCCGGGGGCGGG - Intergenic
928137947 2:28702719-28702741 CCAGAAGCCAGGCTGAGTGCTGG + Intergenic
928169384 2:28993677-28993699 GGCCAAGCTGGGCTGGGTGCTGG + Intronic
928245058 2:29619804-29619826 GCAGCAGCAGGGCTGAGTGCGGG - Intronic
931188153 2:59973703-59973725 GGAGAAGCCGAGCTGGGTCCAGG - Intergenic
932323956 2:70842598-70842620 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
932377552 2:71251138-71251160 GCTGCAGCCTGGCGGGGGGCAGG - Intergenic
932497559 2:72153880-72153902 GCTGAAACAGAGCTGGGTTCTGG + Intergenic
932770295 2:74497302-74497324 TCTGAAGGCTGGCTGGATGCTGG + Intergenic
932834998 2:75027990-75028012 GCTGGAGGCTGGCTGGATGCAGG - Intergenic
933759754 2:85665395-85665417 GTGGAGGCCAGGCTGGGTGCTGG + Intronic
933981605 2:87555253-87555275 GCTGCAGCTGGGCAGGATGCGGG + Intergenic
935595147 2:104872494-104872516 GCTGAAGAGGGGCTGGGAACGGG - Intergenic
936580570 2:113696913-113696935 ACTGAGGCAAGGCTGGGTGCAGG + Intergenic
936913479 2:117615996-117616018 GCTGAAGCCAGGGTGGGCGTTGG - Intergenic
937984130 2:127630977-127630999 GGTGGAGCGGGGCTGGGAGCAGG - Intronic
938086704 2:128406556-128406578 GCTGATGTGGGGCTGGGTGGAGG + Intergenic
942964359 2:181873130-181873152 GATGAAGCGGGGGTGGGGGCAGG + Intergenic
943233617 2:185290247-185290269 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
944536578 2:200716406-200716428 GCTGTAGCTGGGCTGGTTGTTGG + Intergenic
945974674 2:216260919-216260941 GCTGGAGTCAGGCTGTGTGCTGG + Intronic
946188177 2:217993422-217993444 GATGAAGCCAAGCTGGGAGCAGG + Intronic
946191294 2:218009511-218009533 GCAGCAGCTGGGCTGGGGGCGGG - Intergenic
946200478 2:218068260-218068282 GCTGGAGAAGGGCAGGGTGCTGG + Intronic
946404733 2:219486324-219486346 CATGAAGCCAGGCTGTGTGCAGG + Intronic
946601366 2:221363560-221363582 CCTGAAGTCGTGCTGTGTGCTGG - Intergenic
947235650 2:227938159-227938181 GCTGAAGCCCTGCTGGGTGATGG + Intergenic
947902851 2:233737271-233737293 GCGGCAGCCTGGCTGGGTGAGGG - Intronic
948519318 2:238525378-238525400 GCTGAAGCCTGGTCGGGGGCAGG + Intergenic
948675671 2:239595144-239595166 GCTGAGGCTGGGCTGGGTGTCGG + Intergenic
1168883441 20:1226178-1226200 GCTGTAGGCGGGCTGGGAGATGG + Exonic
1168986763 20:2055900-2055922 GCTGAGGCAGGGCTGGATGGAGG - Intergenic
1169806785 20:9567913-9567935 GCAGAAGCCTGGCTGAGTGAGGG + Intronic
1170907476 20:20528858-20528880 GCTGAGGCTGGGCTGGGGGTGGG + Intronic
1171249006 20:23634641-23634663 GCAGCTGCAGGGCTGGGTGCTGG - Intronic
1171258240 20:23708383-23708405 GCAGCTGCAGGGCTGGGTGCTGG - Intergenic
1171266134 20:23773500-23773522 GCAGCTGCAGGGCTGGGTGCTGG - Intergenic
1171275458 20:23853427-23853449 GCAGCTGCAGGGCTGGGTGCTGG - Intergenic
1171446339 20:25207218-25207240 GCTGAAGAAGGCCTGGGTGGCGG - Exonic
1171486731 20:25491049-25491071 GTTGAAGCAGTGCTGGCTGCGGG + Intronic
1172109473 20:32536780-32536802 GCTGCAGCCCGGCTGGGAGTGGG + Intronic
1172801694 20:37580660-37580682 GCTGTAAACAGGCTGGGTGCAGG + Intergenic
1172843130 20:37913947-37913969 GCTGAAGCAGGACTTGGGGCTGG + Intronic
1173530562 20:43766455-43766477 GCTGGAGTCGGGCTGGGAGGAGG - Intergenic
1173606350 20:44334552-44334574 GGCGAAGCAGGGCTGGGGGCTGG - Intergenic
1174137480 20:48390618-48390640 GTTGAATTCTGGCTGGGTGCAGG + Intergenic
1174364579 20:50048679-50048701 GCTGGAGCCAGCCTGGGTGTGGG - Intergenic
1175171265 20:57082844-57082866 GGTGAAGTCGGGCTGGGGGAGGG + Intergenic
1175414867 20:58794655-58794677 GCTGAGGCTGGGCTGGCTCCGGG - Intergenic
1175777921 20:61664500-61664522 GCATCAGCCGGGCTGGGAGCCGG + Intronic
1176008132 20:62877201-62877223 CCTGCAGCCGCGCTGTGTGCAGG + Intergenic
1176070989 20:63226393-63226415 GCAGGAGTGGGGCTGGGTGCGGG + Intergenic
1176199906 20:63855527-63855549 CCTGAAGCTGGGCTGGGCGGCGG - Intergenic
1178513787 21:33229803-33229825 GCGGAGGCCGGGCCGGGGGCTGG - Intergenic
1179476609 21:41650631-41650653 GATGGAACCAGGCTGGGTGCAGG - Intergenic
1179549922 21:42137453-42137475 GCAGAAGCAGGCCTGGGTGCCGG + Exonic
1179727299 21:43347645-43347667 GCCAGAGCCGGGCTGGGGGCCGG - Intergenic
1179967982 21:44817881-44817903 GGCGGAGCCGGGCTGGGGGCGGG + Intronic
1179979761 21:44889790-44889812 ACTGAGGCAGGGCGGGGTGCAGG + Intronic
1180166353 21:46032695-46032717 GCAGAAGCTGGGCTCGGAGCTGG + Intergenic
1181051106 22:20238702-20238724 GCTGTAGCCGACCTGGGTGGGGG - Intergenic
1181368598 22:22398823-22398845 GCAGAAGCAAGGCTGGGTGTGGG + Intergenic
1181491874 22:23265306-23265328 GTTCAACCTGGGCTGGGTGCTGG + Intronic
1181582283 22:23834968-23834990 GCTGTCGCCAGCCTGGGTGCAGG + Intronic
1182809754 22:33105755-33105777 TCTTAAGCCAGGCTGGGAGCAGG + Intergenic
1183350426 22:37331755-37331777 GCTGGAGCAGGGCTGGGTCAGGG - Intergenic
1183395022 22:37566656-37566678 GGTGGAGCCGGGGAGGGTGCAGG - Exonic
1183483141 22:38075644-38075666 TCTGAAGGAGGGCTGGGTTCTGG + Exonic
1184110171 22:42389644-42389666 GCTGTGGCTGGGCTGGGTGTTGG + Intronic
1184236935 22:43187484-43187506 GCTGGAGGCGGACTGGGGGCGGG - Intergenic
1184274159 22:43400649-43400671 GCAGCAGCCGGGCTGGCGGCGGG + Intergenic
1184429020 22:44430400-44430422 GCTGAAGCTCGACTGGCTGCAGG - Intergenic
1184474202 22:44711811-44711833 GCAGATGCAGGGCTGGGTGGAGG + Intronic
1184727915 22:46357110-46357132 GAGGAAGCCGGGCTGGCTGAGGG + Exonic
1185272998 22:49937191-49937213 GCCGAAGCCTGGGTGGGGGCTGG + Intergenic
949245247 3:1919220-1919242 GCTAAAGCCTGGCTGGGGGAGGG - Intergenic
951855357 3:27190426-27190448 GTTGAAGCTGGGATGGGTACAGG + Intronic
953044182 3:39280777-39280799 GCAGAAGCATGGCTGGATGCCGG - Intronic
953705416 3:45226431-45226453 GCCGGGGCGGGGCTGGGTGCGGG + Intergenic
954093214 3:48301552-48301574 GATGAAGCCGTTCTGGGCGCCGG + Intronic
954137394 3:48588324-48588346 GCTGAGGCTGCGCTGGGAGCCGG - Exonic
954145064 3:48630410-48630432 CCTGAAACCTGGCTGGGTGGGGG + Intronic
954318058 3:49811989-49812011 GCTGGAGCAGGGCTGTGTCCAGG + Exonic
954618196 3:51981031-51981053 GCTCATGCCAGGCTGGGAGCTGG - Exonic
955818793 3:62874845-62874867 GCCGGAGCCGGGGTGGGTGCAGG - Exonic
957052418 3:75420834-75420856 GCTCAAGCCAGGCTGGGGGTTGG - Intergenic
959059765 3:101605522-101605544 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
959847996 3:111056511-111056533 GCTGAAGCAGGGTGGGGTGTTGG + Intergenic
961305162 3:125953790-125953812 GCTGAAGGAGGGCGGGGGGCTGG + Intergenic
961521219 3:127468366-127468388 TCACAAGCAGGGCTGGGTGCAGG + Intergenic
961738102 3:129014967-129014989 GCTGGGGCTGGGCTGGGTGGTGG - Intronic
961886040 3:130097065-130097087 GCTCAAGCCAGGCTGGGGGTTGG - Intronic
962368958 3:134805090-134805112 GCTGAAGCCGGGAGGTGAGCTGG + Intronic
962655915 3:137543742-137543764 GCTGAAGCAGGGCAAGGTGTCGG + Intergenic
963159970 3:142141083-142141105 GCTGCAGCCGGGTTGGGGGAGGG - Intronic
963250212 3:143095879-143095901 GCTGTAGCCTGGCTGAGTCCAGG - Intergenic
964995018 3:162868204-162868226 GCTGAAGCCTGGTTGGGGGAGGG + Intergenic
966230147 3:177642603-177642625 GCTGCTGCTGTGCTGGGTGCTGG + Intergenic
966372886 3:179266820-179266842 GCTGCAGCTGCGCTGGGGGCTGG - Intronic
967539970 3:190656064-190656086 GCTGAAGAATGCCTGGGTGCGGG - Exonic
969268961 4:6085936-6085958 GCAGAGGCCTGGCTGGGGGCCGG - Intronic
969487491 4:7480481-7480503 TCTGAAGCTGGGCAGCGTGCTGG + Intronic
969488284 4:7484768-7484790 GGTGCAGGAGGGCTGGGTGCAGG - Intronic
969488295 4:7484801-7484823 ACAGGAGCGGGGCTGGGTGCAGG - Intronic
969496527 4:7529524-7529546 ACTGAGGCCAGGCTGGATGCTGG + Intronic
969758766 4:9167584-9167606 GCTCAAGCCAGGCTGGGGGTTGG + Intergenic
969818732 4:9705047-9705069 GCTCAAGCCAGGCTGGGGGTTGG + Intergenic
970852389 4:20617105-20617127 GGTGAAGCCTGCCTGGCTGCTGG - Exonic
972376526 4:38476903-38476925 GCAGCAGCCGGGCTGGGGGAGGG + Intergenic
975844011 4:78506465-78506487 GCTGTAGCCTGGCTGGGGGAGGG - Intronic
976477935 4:85506459-85506481 GCTGCAGCCTGGCTGGGGGAGGG - Intronic
977471777 4:97452133-97452155 GCTGCAGCTGTGCTGGGGGCGGG - Intronic
978184100 4:105836625-105836647 GCTGAGGCGGGGGTGGGGGCTGG + Intronic
980593995 4:134928780-134928802 GCTGCAGCCTGGCTGGGGGAAGG - Intergenic
981550342 4:145936844-145936866 GCAAAACCCGGGCTGGGGGCGGG - Intronic
981772244 4:148323466-148323488 GCTGCAGCCAGGCTGGGGGAGGG - Intronic
985475757 5:78206-78228 GCTGATTCCAGGCTGGGTCCAGG + Intergenic
985682674 5:1264736-1264758 TCTGGAGCAGGGCTGGGTCCAGG - Intronic
986733085 5:10649498-10649520 GCTGACGCCGCGCTCCGTGCGGG + Exonic
990720360 5:58688246-58688268 GCTCAAGCCTGGCTGGCTGAAGG + Intronic
996185145 5:120465079-120465101 GCTGAAGAGGGGCCGGGTTCTGG + Intronic
996690753 5:126337327-126337349 GCAGAAGGTAGGCTGGGTGCTGG + Intergenic
997586314 5:135045679-135045701 CCTGAAGCTGGGATGGGGGCAGG + Intronic
997624950 5:135325202-135325224 GCTGAAGCCAGGCAGTGAGCAGG + Intronic
998139795 5:139693344-139693366 CCTGGAGCCGGGTTGGGTGGGGG - Intergenic
998854223 5:146379040-146379062 CCTGCTGCCGGCCTGGGTGCAGG - Intergenic
999099632 5:149012636-149012658 GCTGAGGCCTGGCTTGGGGCGGG - Exonic
999719868 5:154391729-154391751 CCTAAGGCCGGGCTGGATGCAGG + Intronic
1001454074 5:171847449-171847471 ACTGAACCCTGGCTGTGTGCAGG + Intergenic
1001492356 5:172164842-172164864 GCTGAAGCAAGGCCGGGTTCCGG + Intronic
1001523454 5:172412235-172412257 GCTGTAGCAGGGCTGTCTGCTGG + Intronic
1001607826 5:172975503-172975525 GCTGAAGCCGCTCATGGTGCCGG - Intergenic
1002139950 5:177132642-177132664 GCTGCAGCCCGGCTCGGTGCCGG + Intergenic
1002988652 6:2217022-2217044 GCTGAAGCCAGGGCGGCTGCGGG - Intronic
1003078786 6:3004436-3004458 GCTGAAGCTGAGTTGGGGGCAGG - Intronic
1003150259 6:3542252-3542274 CCTGCAGCAGGGCTGTGTGCAGG + Intergenic
1003159326 6:3621785-3621807 GGTTAAGCCGTGCTTGGTGCTGG - Intergenic
1003647512 6:7926096-7926118 GCTGCAGCCTGGCTGGGGGAGGG + Intronic
1004270027 6:14186788-14186810 CCTGAACCCGGGGTGGGTGGGGG - Intergenic
1004570276 6:16838247-16838269 GCTGAGGCCAGGCTGAGAGCAGG - Intergenic
1006113975 6:31765655-31765677 GCTGGGGCAGGGCTGGCTGCGGG - Exonic
1006117045 6:31781003-31781025 CCTGCAGGTGGGCTGGGTGCTGG - Exonic
1006297181 6:33174910-33174932 GGTGAAGCAGGAGTGGGTGCTGG - Intronic
1006642459 6:35496404-35496426 GCAGAAACCGGCCTGGGCGCTGG + Intronic
1006642478 6:35496453-35496475 GCTGAGGCCGGGCGGGCTCCGGG + Intronic
1007424918 6:41740595-41740617 GCTGGAGCCCTGCTGGCTGCAGG + Exonic
1007606076 6:43119139-43119161 GGTGAGGCAGGGTTGGGTGCAGG + Intronic
1007902337 6:45423172-45423194 GCTGAAGTCGGGGTGGCAGCGGG - Intronic
1007943234 6:45801720-45801742 GCTTAGGCCAGGCAGGGTGCTGG - Intergenic
1010512608 6:76739004-76739026 TCTGAAGGCAGGCTGGGTGTGGG + Intergenic
1011518612 6:88179947-88179969 GCTGGCTCCGGGCTGGGTTCAGG - Intergenic
1011527004 6:88276412-88276434 GCTGTAGCTGTGCTGGGTGAGGG + Intergenic
1013390245 6:109679253-109679275 GCTGGAGCCTGGCTGGGGGAGGG + Intronic
1013578303 6:111507438-111507460 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1014799238 6:125759361-125759383 GCTGGAGCAGGGCTGCGGGCAGG - Exonic
1015752725 6:136576628-136576650 GTTGATTCCGGGCTGGGGGCAGG - Intronic
1015817788 6:137228570-137228592 TGAGAAGCCTGGCTGGGTGCAGG + Intergenic
1017653198 6:156601702-156601724 CCTGAAGGCAGGCTGGCTGCAGG + Intergenic
1017954801 6:159169251-159169273 GCTGGAGGCGGGCGGGGCGCGGG - Intergenic
1019176647 6:170162606-170162628 GCTTGACCCGGGCTGTGTGCTGG - Intergenic
1019197118 6:170289457-170289479 CCTGAAGCTGGGCGGGCTGCAGG - Intronic
1019358057 7:591241-591263 GGTGAGGCAGGGCTGGGAGCTGG + Intronic
1019379122 7:712228-712250 GCTGAGGCCGGGTTTGGGGCGGG - Intronic
1019476334 7:1246456-1246478 GCAGAGGCCGGGCTGGGAGGCGG + Intergenic
1019569426 7:1703898-1703920 GCTGTCGCCGGACTGTGTGCTGG + Intronic
1019739987 7:2667977-2667999 ACGGTGGCCGGGCTGGGTGCAGG + Intergenic
1020241992 7:6402194-6402216 GTGGAAGCAGGGCTGGGAGCCGG + Intronic
1020277970 7:6636485-6636507 GGTGCAGGCGGGCTGGGAGCTGG + Intergenic
1020319493 7:6929531-6929553 GCTCAAGCCAGGCTGGGGGTTGG - Intergenic
1020774136 7:12432065-12432087 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1023736609 7:43241200-43241222 GCTGAAGGTGGGCTGCGAGCAGG + Intronic
1023861024 7:44217848-44217870 TCTGAAGCCAGGTTGGGTGGGGG - Exonic
1023880038 7:44313132-44313154 GTGGAGGCTGGGCTGGGTGCTGG - Intronic
1024004524 7:45215818-45215840 GCTGAAGCCTGCCTGGGAGTAGG + Intergenic
1024522181 7:50315074-50315096 GCAGAAGCCGGACTAGGAGCCGG - Intronic
1025713390 7:63931615-63931637 GCTGAAGCAGGGCTGGAACCAGG + Intergenic
1025996662 7:66531598-66531620 GCGGAAGCTGGCCTGGGTCCAGG - Intergenic
1026905444 7:74060378-74060400 GCTGCAGCTGGGCTTGGTGCTGG + Exonic
1026988717 7:74571001-74571023 GCGGAAGCTGGCCTGGGTCCGGG - Intronic
1027239022 7:76315321-76315343 GCTAAAGGCGTGCTGGGTGTGGG - Intergenic
1027701795 7:81478864-81478886 GCTGAAGCCTGGCAGGGGGAGGG + Intergenic
1031586279 7:123534907-123534929 GCTAGAGGCGGGCTGGGGGCCGG + Intronic
1032167647 7:129558269-129558291 GCTGGAGCCGGGGTGGGGGCGGG - Intergenic
1032250679 7:130254760-130254782 GCTGCAGCCAGGCTGGGGGAGGG - Intergenic
1034262237 7:149764423-149764445 GTTGAGGCCGCGCTGGGTCCGGG + Exonic
1034282016 7:149861215-149861237 CCGGAAGCCTGGCTGGGTGGTGG + Exonic
1034411199 7:150943064-150943086 CCAGCAGCCGGGCTGGGTGTTGG - Intergenic
1034536415 7:151728474-151728496 GCCGCAGCCTGGCTGGGTGCTGG - Intronic
1034745272 7:153518434-153518456 GCTGGAGATGAGCTGGGTGCAGG + Intergenic
1035239987 7:157523267-157523289 GCTGGTGCCGGGCAGGGGGCTGG - Intergenic
1037398346 8:18467290-18467312 GCAGAAGCCTGGCAGGGTGAGGG + Intergenic
1037783495 8:21887571-21887593 GAAGAAGCCTGGCTGGATGCAGG - Intergenic
1039467952 8:37797217-37797239 GCTGGGGCCGGGCTGCGCGCCGG - Intronic
1041281155 8:56211798-56211820 GCTGGAGACGGCCTGGGTGCTGG + Exonic
1042533063 8:69834156-69834178 GCTGAATTCAAGCTGGGTGCGGG - Intronic
1042762526 8:72286455-72286477 GCTGAGGCCAGGCAGGATGCAGG - Intergenic
1043889919 8:85643667-85643689 GCTGAGGCCGGGCATGGAGCTGG + Intergenic
1043891457 8:85655575-85655597 GCTGAGGCCGGGCATGGAGCTGG + Intergenic
1043892530 8:85662412-85662434 GCTGAGGCCGGGCATGGAGCTGG + Intergenic
1043893027 8:85714923-85714945 GCTGAGGCCGGGCATGGAGCTGG - Intergenic
1043895714 8:85736377-85736399 GCTGAGGCCGGGCATGGAGCTGG - Intergenic
1043896965 8:85745431-85745453 GCTGAGGCCGGGCATGGAGCTGG + Intergenic
1043899289 8:85763798-85763820 GCTGAGGCCGGGCATGGAGCTGG + Intergenic
1043900899 8:85775992-85776014 GCTGAGGCCGGGCATGGAGCTGG + Intergenic
1043902863 8:85791267-85791289 GCTGAGGCCGGGCATGGAGCTGG + Intergenic
1043904473 8:85803460-85803482 GCTGAGGCCGGGCATGGAGCTGG + Intergenic
1043906085 8:85815651-85815673 GCTGAGGCCGGGCATGGAGCTGG + Intergenic
1043907693 8:85827841-85827863 GCTGAGGCCGGGCATGGAGCTGG + Intergenic
1044800121 8:95945306-95945328 CCTGAAGCCAGGCTGGGCTCTGG + Intergenic
1047437808 8:124849271-124849293 GCAGATGCTGGCCTGGGTGCTGG + Intergenic
1049682558 8:143926200-143926222 GCTCAGGCAGGGCTGTGTGCTGG - Intronic
1049734948 8:144199851-144199873 ACTGCAGCCAGGCTGGGGGCAGG + Intronic
1049791228 8:144473584-144473606 CCTGATGCAGGGCTGGGGGCGGG - Exonic
1049998711 9:1053345-1053367 GTTGCAGCCAGGCTGGGTCCTGG - Intronic
1052063781 9:23992098-23992120 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1052743375 9:32415665-32415687 GCTGATGCCGGTGTCGGTGCAGG + Intronic
1053114745 9:35490585-35490607 GCAGTCGCCGGCCTGGGTGCCGG - Intronic
1053434463 9:38066389-38066411 GCTGAAGCTTGGCTTGGTGCAGG - Intronic
1053462694 9:38282821-38282843 GCAGAAGTGGGGCTGGGGGCTGG + Intergenic
1053477398 9:38392551-38392573 GCTGAAGCGGTGCGGGCTGCCGG + Intergenic
1053753624 9:41280486-41280508 GCTGAAGCCGGGGGTGCTGCTGG - Intergenic
1054076957 9:60546018-60546040 GCTGAGGCCGGGCTGGCCCCGGG - Intergenic
1054259147 9:62844846-62844868 GCTGAAGCCGGGGGTGCTGCTGG - Intergenic
1054332632 9:63775191-63775213 GCTGAAGCCGGGGGTGCTGCTGG + Intergenic
1056684258 9:88746648-88746670 GCAGTAGCCAGGGTGGGTGCAGG - Intergenic
1056849498 9:90070426-90070448 GCTGAAGCTGGGCTGGCCTCAGG - Intergenic
1057197684 9:93123999-93124021 GCTGGACCCTGGCTGTGTGCAGG - Intronic
1060153013 9:121300637-121300659 GCTGGGGCCGGGGAGGGTGCAGG - Intronic
1060897207 9:127225422-127225444 GGTGCGGCCGGGCGGGGTGCCGG + Intronic
1061149939 9:128822885-128822907 ACTGAAGACAGGCTGGGAGCGGG - Intronic
1061152300 9:128835853-128835875 GCTGCAGGTGGGCTGGGTCCTGG - Exonic
1061377763 9:130236264-130236286 GCTGAAACCGCGCTGGGAACAGG - Exonic
1061659380 9:132118484-132118506 GCTGAAGTCAGGGTGGGTGGTGG + Intergenic
1061924873 9:133801074-133801096 GCAGGCTCCGGGCTGGGTGCTGG - Intronic
1062043016 9:134412693-134412715 GCTGAAGCCGGGGAGGGGGCAGG + Intronic
1062262107 9:135667902-135667924 GCTGATGGTGGGGTGGGTGCTGG - Intergenic
1062491292 9:136806295-136806317 GCTGCAGCCAGGCTGGGAGCTGG + Intronic
1062574266 9:137199265-137199287 GCAGAGGCCTGGCAGGGTGCGGG + Exonic
1062686233 9:137814873-137814895 GGTGCTGCCGGGCTGGGTACAGG + Intronic
1189268801 X:39736066-39736088 GCTGAAGGTGGGCTGTGAGCTGG - Intergenic
1190219309 X:48500772-48500794 GGTGACGAAGGGCTGGGTGCTGG - Intergenic
1190227655 X:48558800-48558822 ACTGAAGCCGGGCTACCTGCAGG - Intronic
1190542904 X:51496621-51496643 GATGAAGCTGGGCGGGGCGCAGG + Intergenic
1190622260 X:52299128-52299150 GCTGCAGCCTGGCTGGGGGAGGG + Intergenic
1190683407 X:52849273-52849295 GCTGCAGCCTGGCTGGGGGAGGG - Intergenic
1192395902 X:70780735-70780757 GCTGCAGCCTGGCTGGGGGAGGG + Intronic
1192436276 X:71145487-71145509 GCTGCAGCGGTGCTGGGCGCGGG - Intronic
1195402740 X:104478921-104478943 GCAGCAGCCCAGCTGGGTGCAGG - Intergenic
1196707388 X:118727822-118727844 GCCGAAGCTGGGGTGGGTGCTGG + Intronic
1197446053 X:126552945-126552967 GCTGAGGCCGGGCGGGGTGAAGG + Intergenic
1199538064 X:148926116-148926138 GCTTAAGCGTGGCTGGGTGTGGG - Intronic
1199649778 X:149939698-149939720 GCTGAGGATGGGCTGGGGGCGGG + Intergenic
1200110598 X:153738861-153738883 GCTGGAGGCGGGCTGTGTGCAGG - Intronic
1201899582 Y:19035044-19035066 GCTGCAGCCAGGCTGGGGGAGGG + Intergenic