ID: 1147661961

View in Genome Browser
Species Human (GRCh38)
Location 17:42121494-42121516
Sequence TCAATGTGGGGCCTTCACTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147661961_1147661968 7 Left 1147661961 17:42121494-42121516 CCTGAGTGAAGGCCCCACATTGA 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1147661968 17:42121524-42121546 TCACTTGTAATCTCTTTTAATGG 0: 1
1: 0
2: 2
3: 14
4: 301
1147661961_1147661969 14 Left 1147661961 17:42121494-42121516 CCTGAGTGAAGGCCCCACATTGA 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1147661969 17:42121531-42121553 TAATCTCTTTTAATGGAGTCCGG 0: 1
1: 1
2: 2
3: 21
4: 221
1147661961_1147661970 15 Left 1147661961 17:42121494-42121516 CCTGAGTGAAGGCCCCACATTGA 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1147661970 17:42121532-42121554 AATCTCTTTTAATGGAGTCCGGG 0: 1
1: 0
2: 0
3: 15
4: 184
1147661961_1147661971 28 Left 1147661961 17:42121494-42121516 CCTGAGTGAAGGCCCCACATTGA 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1147661971 17:42121545-42121567 GGAGTCCGGGAGAGTCACGATGG 0: 1
1: 0
2: 0
3: 2
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147661961 Original CRISPR TCAATGTGGGGCCTTCACTC AGG (reversed) Exonic
904328562 1:29743570-29743592 TCCCTGAGGGGCCTTCATTCAGG - Intergenic
908089404 1:60670547-60670569 TCATTGTGGGGCCTACCCTGAGG + Intergenic
915892832 1:159787478-159787500 TCAATGTGTGGCATTCAGTATGG + Intergenic
916725094 1:167516519-167516541 TCTATGTGCGGCCTTTCCTCCGG + Intronic
917503573 1:175607700-175607722 TCACTGTTGGCCCTTCCCTCTGG - Intronic
918283422 1:183027873-183027895 TCACTGTGGTGACTTCACTGTGG + Intronic
922016484 1:221653708-221653730 TATATGTGGCTCCTTCACTCTGG - Intergenic
1066670930 10:37838069-37838091 TGTATGTGTGGACTTCACTCAGG - Exonic
1071495865 10:86167321-86167343 TCTTGGTGGGGCCTGCACTCAGG - Intronic
1075561975 10:123474580-123474602 TCAATGAGTGGCCCTCATTCTGG - Intergenic
1076200113 10:128551284-128551306 AGAGTGTGGGGCCTCCACTCTGG + Intergenic
1076578618 10:131491354-131491376 TCCATGTGGGGCCGATACTCAGG + Intergenic
1077055969 11:593344-593366 TCGATCTGGGGCCTTCTCTTGGG + Intronic
1077248144 11:1548956-1548978 TCAGTGAAGGGCCTTCATTCTGG - Intergenic
1081499044 11:43647198-43647220 TCTGTTTGGGGCCTTTACTCAGG + Intronic
1086270089 11:85053068-85053090 TGAATCTGGGGCCTGAACTCTGG + Intronic
1086869665 11:92021773-92021795 TATATGTGGTCCCTTCACTCAGG + Intergenic
1089648395 11:119895232-119895254 TCAATGTAGCCCCTTCACCCTGG + Intergenic
1090730561 11:129570077-129570099 TGAATCTGAGGCCTTCACTTTGG - Intergenic
1091636490 12:2200907-2200929 TCAAAGAGGGCCATTCACTCTGG + Intronic
1098569798 12:71975482-71975504 TCAATGTGAGGCCCTGACCCAGG + Intronic
1102490908 12:113289007-113289029 TAAATGAGGGGCCTGGACTCGGG + Intronic
1104171785 12:126288977-126288999 TCAATGTGGTGTCTTCACTGTGG + Intergenic
1104278422 12:127352003-127352025 TTAATGTGGAGCCGTCATTCAGG + Intergenic
1107501815 13:40986636-40986658 TCAAGGCGAGGACTTCACTCTGG + Intronic
1116288299 14:43001522-43001544 CCTATCTGGGGCCTGCACTCCGG - Intergenic
1120379593 14:83758852-83758874 TCATTGTGGGGTCTTGACTCAGG + Intergenic
1121538507 14:94707763-94707785 GCAGTGTTGGGCCTTCTCTCTGG - Intergenic
1122403065 14:101478895-101478917 GCAATGTGGGGGCTTCTCTAAGG - Intergenic
1125815993 15:42584766-42584788 TCAACCTGGGGCTTTCACTGAGG - Intronic
1127647050 15:60969376-60969398 CCAGTGTGGGCCCTTCAATCTGG + Intronic
1129758054 15:78110431-78110453 TCCACTTGGGGCCTGCACTCTGG - Intronic
1133901450 16:9979036-9979058 ACAATGCGGGTCCCTCACTCTGG + Intronic
1135058401 16:19250307-19250329 TCAATGTGGGGCAGACTCTCGGG + Intronic
1135751925 16:25065250-25065272 GCAATGTGGAGGCTACACTCCGG - Intergenic
1137427824 16:48394609-48394631 GAGGTGTGGGGCCTTCACTCAGG - Intronic
1140902162 16:79378981-79379003 TTAAAGTGGGACCTTCTCTCAGG + Intergenic
1143527788 17:7482496-7482518 TCATTGTGGGACCTGGACTCTGG + Exonic
1144148629 17:12421927-12421949 TCTCTGTGGGGCTTTCACTGGGG - Intergenic
1145218143 17:21067556-21067578 ACAATGTGTGGCCTTCTGTCTGG - Intergenic
1146730973 17:35193774-35193796 TCATTGTGGGACCTGGACTCTGG - Exonic
1147661961 17:42121494-42121516 TCAATGTGGGGCCTTCACTCAGG - Exonic
1148576121 17:48712570-48712592 ACACTGTGGGGCCTTCGCTTTGG + Intergenic
1149345051 17:55726236-55726258 GCAATTTGGGGCATTCTCTCTGG - Intronic
1153427999 18:4987610-4987632 TGAAGGTGGGGGCTTCACTGGGG + Intergenic
1154115528 18:11610107-11610129 TCATTGTGGGACCTGGACTCTGG + Intergenic
1154121790 18:11658176-11658198 GCAATGTGAGACCTTCACACGGG - Intergenic
1156825083 18:41421060-41421082 TCAGTGTGGGGCCTCTACTTTGG - Intergenic
1157863534 18:51161999-51162021 TCACTGTGGGCCCTTCAGCCTGG - Intergenic
1166256019 19:41605164-41605186 TCAGTGTGAGGCCTCCACCCAGG + Intronic
926716621 2:15929209-15929231 TGAATGTGTGGCTTTCAGTCTGG + Intergenic
927072885 2:19548434-19548456 TGAAGGTGGGGCCTTTACTGGGG - Intergenic
929647463 2:43641793-43641815 TCAATGTGAGGCTTTAATTCTGG + Intronic
930665931 2:54098345-54098367 TCAACGTGGGCCCTTCATTGGGG - Intronic
932479826 2:72032545-72032567 TGAATGTGGGGCCCCCACCCAGG + Intergenic
933212091 2:79581904-79581926 TCAATATGGTGCCTTTACTTTGG + Intronic
933584385 2:84164024-84164046 TCAATGTGGGTCGTTCACTGTGG + Intergenic
933819187 2:86094378-86094400 CCAGTGTGGGCCCTTCACACAGG + Intronic
937351974 2:121171699-121171721 TGACTCTGGGCCCTTCACTCGGG + Intergenic
937377928 2:121350470-121350492 TCACTTTGGGGCCCTCACTGAGG + Intronic
941269262 2:163404977-163404999 TCAATCTGTGGTCTTCACTTCGG - Intergenic
943961196 2:194265155-194265177 TGAAGGTGGGGCCTTTACTGGGG - Intergenic
948534975 2:238638904-238638926 TCTACGTGTTGCCTTCACTCTGG + Intergenic
1168901361 20:1367802-1367824 TCAGTATTGTGCCTTCACTCAGG - Intronic
1177081749 21:16648189-16648211 TCAATGAGGATGCTTCACTCTGG + Intergenic
1183088829 22:35507351-35507373 TCAATGGGAGGCCTACACTGTGG - Intergenic
1183979738 22:41532453-41532475 TCACTGTGAGGCCGTCACTCAGG - Intronic
1184867335 22:47209059-47209081 TCACTGTGCGGCCTGCACTGGGG - Intergenic
949807827 3:7974845-7974867 TCAAAGTGGGGCCATCTCCCGGG + Intergenic
956357154 3:68406543-68406565 TCAAAGTGGGGCATTCACCCTGG - Intronic
961354722 3:126329956-126329978 TGAATGAGGGGCCATCACTGAGG - Intergenic
962222611 3:133576194-133576216 TCAATCTGGGGGTTTCACTTTGG - Intronic
965072021 3:163926110-163926132 TCAATGAGGTTTCTTCACTCTGG + Intergenic
966455252 3:180107707-180107729 TCAGTGAGGGGCCTTTCCTCAGG + Intergenic
970315531 4:14825413-14825435 TCAATGTGGAGGCTCCACTGGGG + Intergenic
978407801 4:108398411-108398433 TCACTGTGCGGCCAGCACTCTGG + Intergenic
978749750 4:112232604-112232626 TCAATCTGAGGCATTAACTCCGG - Intronic
980497097 4:133600168-133600190 TCATTTTGTGGCCTCCACTCAGG + Intergenic
980985353 4:139689884-139689906 TCAATGTGGGCACATCACTTGGG - Intronic
985370220 4:189278926-189278948 TCTATGTGGGGGTTGCACTCAGG + Intergenic
988316080 5:29630174-29630196 TCAATGTTTGGCCTGCACTATGG - Intergenic
994240874 5:97419333-97419355 TCCATCTAGGGCCTACACTCTGG + Intergenic
1000397960 5:160796009-160796031 TCAACGTGGGGTCTGAACTCAGG - Intronic
1017772273 6:157652524-157652546 TCAATGCTGAGCCTTCACTGGGG + Intronic
1021130369 7:16905330-16905352 TCAATGAGGTCTCTTCACTCTGG + Intergenic
1021421881 7:20454699-20454721 TCAATGTGTGACTTTCAATCTGG + Intergenic
1022576125 7:31498599-31498621 TCTGTGTGGGGCCAGCACTCGGG - Intergenic
1022806282 7:33825641-33825663 TTAATGTGGGGCCTTTGCTTTGG + Intergenic
1026396383 7:69958608-69958630 ACACTGTGTGGCCTTCTCTCTGG + Intronic
1026483508 7:70798441-70798463 ACAAAGTGGGGCCTTGTCTCAGG + Intergenic
1026766292 7:73161974-73161996 TCAAGGTGGGGCCTGCCATCCGG + Intergenic
1027042765 7:74971670-74971692 TCAAGGTGGGGCCTGCCATCCGG + Intronic
1027080877 7:75230687-75230709 TCAAGGTGGGGCCTGCCATCCGG - Intergenic
1028210839 7:88072588-88072610 GAGATGTGGGGCTTTCACTCTGG + Intronic
1031301212 7:120063486-120063508 TCAATGAGGTACCTGCACTCTGG + Intergenic
1031319415 7:120304449-120304471 TCAATGTGTGGCCTCCATGCCGG + Intronic
1031392937 7:121238239-121238261 TCAATTTGGGGCCTTCTCTAAGG - Intronic
1032268267 7:130383243-130383265 TGCTTGTGGGGCCATCACTCAGG - Intronic
1032790679 7:135240394-135240416 TGAATTTGGGGCCTTTACTTGGG + Intronic
1037289839 8:17338641-17338663 TCAATTTGTGCCCTTCTCTCTGG - Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1044677007 8:94739218-94739240 TCAATGTGGGGATTTGTCTCAGG + Intronic
1055938551 9:81626581-81626603 TCAATGTGTGCCCTTCAGACTGG - Intronic
1056235169 9:84587075-84587097 GGAAGGTGGGGCCTTCACGCTGG + Intergenic
1056699686 9:88891997-88892019 CCAAGGTGGGGACATCACTCAGG - Intergenic
1061232876 9:129325157-129325179 TCACTGTGGGACCTTCAGCCGGG - Intergenic
1062619964 9:137416290-137416312 TCCCTGTGGGTCCCTCACTCTGG - Intronic
1203495356 Un_GL000224v1:146159-146181 TCAATGTTTGTCCTTCACTTAGG + Intergenic
1203507982 Un_KI270741v1:88082-88104 TCAATGTTTGTCCTTCACTTAGG + Intergenic
1188871807 X:35382356-35382378 TCCCTGTGGGGCCTGAACTCAGG - Intergenic
1190876709 X:54465290-54465312 TCAATGTGGGCCTTTCAGTTTGG + Intronic
1193818651 X:86134613-86134635 TCAATATGAGGCCTTTACTCTGG - Intergenic
1194419152 X:93650483-93650505 TGAAGGTGGGGCCTTGGCTCAGG + Intergenic
1196990812 X:121326685-121326707 TCAATGTGGGGCCTTGACACTGG - Intergenic
1200070110 X:153525034-153525056 TCAGCTGGGGGCCTTCACTCAGG - Intronic