ID: 1147664192

View in Genome Browser
Species Human (GRCh38)
Location 17:42135613-42135635
Sequence ATGTGTAAGTCCATGAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147664188_1147664192 12 Left 1147664188 17:42135578-42135600 CCCCGATCAGTGCTGTGCACAAC 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG 0: 1
1: 0
2: 0
3: 18
4: 201
1147664190_1147664192 10 Left 1147664190 17:42135580-42135602 CCGATCAGTGCTGTGCACAACTC 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG 0: 1
1: 0
2: 0
3: 18
4: 201
1147664187_1147664192 13 Left 1147664187 17:42135577-42135599 CCCCCGATCAGTGCTGTGCACAA 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG 0: 1
1: 0
2: 0
3: 18
4: 201
1147664189_1147664192 11 Left 1147664189 17:42135579-42135601 CCCGATCAGTGCTGTGCACAACT 0: 1
1: 0
2: 0
3: 13
4: 99
Right 1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG 0: 1
1: 0
2: 0
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147664192 Original CRISPR ATGTGTAAGTCCATGAATGT GGG Intronic
900293776 1:1938304-1938326 GTGTGTGAGTGCATGTATGTGGG - Intronic
900500491 1:3002146-3002168 ATGTGGACGTCCAAGAGTGTGGG - Intergenic
900566918 1:3337877-3337899 ATGTGTGTGTCCGTGCATGTGGG - Intronic
900580936 1:3408608-3408630 GTGTGTGAGTGCATGAGTGTGGG + Intronic
900952999 1:5868728-5868750 ATGTGTGGGTGCATGCATGTGGG - Intronic
900953014 1:5868897-5868919 ATGTGTGGGTGCATGCATGTGGG - Intronic
900953029 1:5869070-5869092 ATGTGTGGGTGCATGCATGTGGG - Intronic
900978214 1:6030824-6030846 ATGTGTAAGTATATGTGTGTAGG + Intronic
903735350 1:25526717-25526739 ATGTGCCATTCCATGGATGTGGG + Intergenic
906716051 1:47970042-47970064 ATGAGTAAGTGCTTGAGTGTGGG - Intronic
908710458 1:67008636-67008658 ATGAATATGTCCATGACTGTAGG - Intronic
909518106 1:76534708-76534730 TAGTGTAACTCCATGAAGGTAGG + Intronic
910939416 1:92517125-92517147 TTGTTTGAATCCATGAATGTGGG - Intronic
911034336 1:93523852-93523874 ATATAAAAGTCAATGAATGTGGG - Intronic
912806074 1:112758150-112758172 AGCTGTCAGGCCATGAATGTTGG - Intergenic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
914343030 1:146776427-146776449 ATGTGGAAGTGCATGGATGAAGG + Intergenic
917667616 1:177240551-177240573 CTGTGAGAGTCCCTGAATGTTGG + Intronic
919263448 1:195229870-195229892 ATGGTTAATTCCAAGAATGTTGG + Intergenic
920348314 1:205321215-205321237 ATGTGTCAGTCCGTGATTGCAGG - Intronic
923227581 1:231953356-231953378 TTGTGTAAGTCCTTGAAAGATGG - Intronic
923235456 1:232028672-232028694 ATGGGTAAGTGCATGATTTTAGG + Intronic
923308015 1:232706132-232706154 GTGTGTAAGTCCATGAGAGGGGG - Intergenic
1063795047 10:9504715-9504737 ATGTGGATTTCCATGAATGTCGG + Intergenic
1067560476 10:47301195-47301217 CTGTGTATGTCCAGCAATGTGGG - Intronic
1069612005 10:69779990-69780012 ACGTGAAGTTCCATGAATGTTGG - Intergenic
1070981232 10:80649857-80649879 ATGTGTGTGTGTATGAATGTAGG + Intergenic
1071114962 10:82207358-82207380 ATTTGTTAGTGGATGAATGTGGG + Intronic
1072068228 10:91890883-91890905 ATGTGGAAGGCTATGAATTTGGG + Intergenic
1073507319 10:104009326-104009348 ATGTTAAAGTCAATGAATCTGGG - Intronic
1073796253 10:106991603-106991625 ATGGGTAAATCCATGATTTTTGG + Intronic
1073885038 10:108028438-108028460 ATATGTAAGCCAATCAATGTGGG + Intergenic
1074463453 10:113660188-113660210 ATGTATATGTACATGCATGTGGG - Intronic
1074592860 10:114830045-114830067 ATTTGTATGTCACTGAATGTAGG + Intronic
1074600619 10:114909746-114909768 ATATGTAAGTCCATAGATGTAGG + Intergenic
1076172470 10:128333317-128333339 ATGTACAAGGACATGAATGTTGG + Intergenic
1076480108 10:130779345-130779367 ACGTGTGTGTCCATGCATGTAGG - Intergenic
1076578225 10:131486378-131486400 ATATATATGTGCATGAATGTAGG + Intergenic
1079641143 11:22806981-22807003 ATGGGTAAGTACATGAATCATGG + Intronic
1081689427 11:45067243-45067265 ATGAGTAAGTTCATGCATGTGGG - Intergenic
1082791484 11:57349091-57349113 ATGAGTAAGTCAATGAAGGGGGG - Intronic
1085137368 11:74104500-74104522 ATGTGTATGTACATGTATGGGGG + Intronic
1087909623 11:103738108-103738130 ATGAGTAAGTGAATGAATGGTGG + Intergenic
1088983607 11:114886730-114886752 ATGTGTATATGCATGAATGGAGG - Intergenic
1089110157 11:116049192-116049214 ATGTGTAAGTGTATGTTTGTAGG - Intergenic
1089890182 11:121872940-121872962 ATGGGTAAGTCTGTGATTGTGGG + Intergenic
1090715315 11:129425323-129425345 ATGTGTGGGTGCATGAAGGTAGG + Intronic
1090929870 11:131287602-131287624 ATGAATAAGTAAATGAATGTTGG + Intergenic
1091592540 12:1853507-1853529 ATGTGTGTGCCCATGAGTGTTGG - Intronic
1092585005 12:9890623-9890645 AGATGTAAGTCCATGAAAGAGGG - Intronic
1093198684 12:16160696-16160718 ATGTGTAACTCCATGTATACAGG + Intergenic
1096956026 12:55527142-55527164 ATTTGTGACTCCATGAATGGTGG - Intergenic
1098765004 12:74475812-74475834 ATGTGTTTGTCCATGAACCTTGG - Intergenic
1099147584 12:79066041-79066063 TTGTGTATGTTCATGCATGTGGG - Intronic
1099702533 12:86105495-86105517 ATGTGTAACTCAATCAATATAGG - Intronic
1101328704 12:103739972-103739994 ATGTTTAAGTCAATGAAATTTGG + Intronic
1102165435 12:110802458-110802480 ATGAGTGAGTCTATGAGTGTGGG + Intergenic
1104593909 12:130106530-130106552 ATGTGTATGTCCTTGTGTGTAGG + Intergenic
1106951470 13:34889219-34889241 TTGTGTAAGTTCAGGAATCTAGG - Intergenic
1107387819 13:39931553-39931575 ATGTCTAAGTACATGGATATAGG + Intergenic
1107934977 13:45338641-45338663 ATGTGTAAGTACAAGGAAGTGGG - Exonic
1109328686 13:60900830-60900852 ATCTGTAAGTCCCTGAATGGAGG - Intergenic
1113050140 13:106201879-106201901 ATTTGCCAGTCAATGAATGTAGG + Intergenic
1113413822 13:110112858-110112880 ATCTGTGAGGTCATGAATGTAGG - Intergenic
1115524132 14:34262515-34262537 ATTTGTATGTATATGAATGTGGG - Intronic
1117558987 14:56916670-56916692 ATGTCTAAAACCATAAATGTGGG - Intergenic
1119582893 14:75803649-75803671 ATGTGTATGTCCCTGAAAGCAGG + Intronic
1121537226 14:94699238-94699260 TTCTGCAAGTCCCTGAATGTTGG - Intergenic
1126745898 15:51826295-51826317 ATTTGTAAATAAATGAATGTTGG - Intergenic
1127604517 15:60573005-60573027 CTGAGTAAGTACATGAGTGTGGG + Intronic
1130790220 15:87146538-87146560 ATGGGTAAGTCATTGAATTTTGG + Intergenic
1132384514 15:101390579-101390601 AGGAGTAAGCCAATGAATGTGGG + Intronic
1134083274 16:11339175-11339197 ATGTGAAAGTCGATGCATCTTGG - Intronic
1134176624 16:12012261-12012283 ATGTGAAAGTGCAGGGATGTGGG + Intronic
1134533921 16:15008999-15009021 ATGTGAATGTCCATGAAGGTTGG + Intronic
1135628073 16:24013623-24013645 ATCTGTAAATCCCTGAAGGTGGG + Intronic
1135638980 16:24103749-24103771 ATCTTTATGTCCATGAGTGTAGG + Intronic
1135738360 16:24952017-24952039 ATTTGCAAATCCATTAATGTGGG + Intronic
1135853275 16:25983789-25983811 CTGTGTGAGTCCATGATTCTGGG - Intronic
1139862116 16:70031726-70031748 ATGTGAATGTCCATGAAGGTTGG - Intergenic
1139990956 16:70938901-70938923 ATGTGGAAGTGCATGGATGAAGG - Intronic
1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG + Intergenic
1141266915 16:82505985-82506007 ATGGGTAAGTGAATGAATGGAGG + Intergenic
1141710903 16:85698437-85698459 TTGTGCAAATGCATGAATGTGGG - Intronic
1141783394 16:86180678-86180700 ATGTGTATATACATGCATGTGGG - Intergenic
1144078268 17:11738291-11738313 GTGTTTAACTCCCTGAATGTGGG - Intronic
1146368077 17:32245237-32245259 ATGTGCAAGTCCAGGTAGGTGGG - Intronic
1147664192 17:42135613-42135635 ATGTGTAAGTCCATGAATGTGGG + Intronic
1152128338 17:78460862-78460884 ATGAGTATGTACATGAATGAAGG - Intronic
1152172282 17:78759747-78759769 ATTTGTGCGTCCATGATTGTAGG - Intronic
1152632406 17:81416288-81416310 ATGTGTGTGTCCATGAGGGTGGG + Intronic
1153788740 18:8558061-8558083 AAGTGTAAGTTCATTACTGTGGG + Intergenic
1154928189 18:20961417-20961439 ATGTATAAGTCCATGAATACAGG + Intronic
1156435168 18:37119122-37119144 CTCTGTAAGTCCATGGATGGTGG + Intronic
1156505839 18:37591401-37591423 ATGTGTAAATGCAAGAATATTGG + Intergenic
1157300488 18:46475330-46475352 GTGTGTGTGTACATGAATGTGGG - Intergenic
1157300500 18:46475620-46475642 ATGTGTGTGTACATGAGTGTGGG - Intergenic
1158109199 18:53921071-53921093 ATGTGTATGTGCATGGGTGTGGG + Intergenic
1158458479 18:57627644-57627666 TTCTGTAAGTCCATAGATGTGGG - Intergenic
1161982838 19:7638828-7638850 ATGGGGAAGACCCTGAATGTGGG + Intronic
1163164155 19:15483858-15483880 GTGTGTGAGTGCCTGAATGTGGG - Intronic
1166555179 19:43694585-43694607 ATGTGAACGTTCATGGATGTTGG - Intergenic
925938134 2:8787776-8787798 ATGTTTAAGTCCAGGAATAAAGG - Intronic
926293316 2:11548383-11548405 ATGTGTATGTGTATGTATGTGGG - Intronic
926558380 2:14387406-14387428 ATCTATAGGTTCATGAATGTTGG - Intergenic
927845789 2:26472148-26472170 ATGTGTGTGTGCATGTATGTGGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930508205 2:52311302-52311324 TTGTGTATGTCCATGAATAAGGG - Intergenic
932078233 2:68686574-68686596 AAGAGTAAGTCCAGAAATGTTGG + Intronic
934578790 2:95421416-95421438 ATATGTATGTGCATGCATGTGGG - Intergenic
934600657 2:95655287-95655309 ATATGTATGTGCATGCATGTGGG + Intergenic
936500329 2:113061610-113061632 ATGTGTGAGTGCAGGTATGTAGG + Intronic
936534025 2:113297411-113297433 ATATGTATGTGCATGCATGTGGG + Intergenic
936840414 2:116761763-116761785 ATGTGTAAATCCAGCAATTTAGG + Intergenic
937854662 2:126663636-126663658 ATGTGAAGGTCCATCCATGTAGG + Intronic
939755468 2:146104012-146104034 TTTTGTCAGTCCATGAATGGGGG - Intergenic
941189770 2:162366758-162366780 ATGTATAAGTTTATGAATGGTGG + Intronic
944162181 2:196675318-196675340 AATTATAAGTCCATGAAAGTAGG - Intronic
1169726689 20:8741390-8741412 ATGAGTAAGTAGATGAATGATGG + Intronic
1171110879 20:22480978-22481000 ATGTGTAAGTATGTGAAAGTAGG - Intergenic
1171283468 20:23919786-23919808 ATGTGTACATACATGTATGTGGG - Intergenic
1171510288 20:25676988-25677010 ATGTGCAAGTCCAAGATTCTTGG + Exonic
1173395943 20:42679621-42679643 ATGTGTCAGTACATAAATATTGG - Intronic
1173941712 20:46916382-46916404 GTGTGTGAGTATATGAATGTGGG + Intronic
1174260130 20:49288240-49288262 ATGTCTTATTACATGAATGTTGG - Intergenic
1175582469 20:60111149-60111171 ATGTGTCAGTCATTGGATGTGGG + Intergenic
1176292114 21:5051832-5051854 ATGTGTGAGTAAGTGAATGTGGG - Intergenic
1179865143 21:44211818-44211840 ATGTGTGAGTAAGTGAATGTGGG + Intergenic
1180877298 22:19180561-19180583 AAGTGTACGCCCAGGAATGTTGG - Intronic
1181840425 22:25653986-25654008 ATGTGTACGTTAAAGAATGTGGG - Intronic
1184226615 22:43132494-43132516 TTGGGTATGTCCATAAATGTGGG + Exonic
949428855 3:3950524-3950546 ATGGGGAAGGCCATGTATGTGGG + Intronic
949865879 3:8546752-8546774 AGGTGTAAGTCCATGAGTGAAGG + Intronic
951561938 3:23976284-23976306 ATTTGTAAGCCCCTGAATTTTGG - Intronic
953060508 3:39424928-39424950 TTGTGTTAGGCCAAGAATGTGGG + Intergenic
954583672 3:51717304-51717326 CTGTGTAAGTGCATGTATGTGGG - Intronic
955883945 3:63577607-63577629 GTGTGTAGGTGTATGAATGTAGG + Intronic
957890893 3:86356117-86356139 AAGTGTAAGACCATCACTGTTGG + Intergenic
959653110 3:108771118-108771140 AAGAGTAAGTCCAAAAATGTAGG + Intergenic
963476246 3:145808286-145808308 ATGTGAAATTCCTTGAATGAAGG - Intergenic
963671955 3:148261981-148262003 ATAAGTAAGTACATGAATTTGGG + Intergenic
964222334 3:154361695-154361717 ATGTGGAAGTCTAGGAATCTGGG + Intronic
964665860 3:159171274-159171296 TTGTTTACGTACATGAATGTAGG + Intronic
970651925 4:18188229-18188251 GTGTGTGTGTCCATGTATGTGGG + Intergenic
971892825 4:32546597-32546619 ATGTGAAAGTCCAGAAATATTGG + Intergenic
972197571 4:36672615-36672637 ATATGTGAGTCTATGAATTTTGG + Intergenic
972223313 4:36981740-36981762 ATGTTTAAGTGTATGTATGTTGG - Intergenic
972629949 4:40834184-40834206 ATCTGTCAGTCCATGACGGTGGG + Intronic
974525729 4:63047775-63047797 ATGTGTAAGTGCTGAAATGTGGG - Intergenic
977725548 4:100292842-100292864 ATGTGGAAGTCTTTGAATGTAGG - Intergenic
977779152 4:100959915-100959937 GTGATTAAGTCCATGAATGTGGG + Intergenic
978475136 4:109118954-109118976 ATGTTTTAGTCCAAAAATGTGGG - Intronic
979733276 4:124051483-124051505 ATATGTAAGTACATGAAAGAAGG + Intergenic
980814517 4:137926415-137926437 ATGTGTAAGCACATAGATGTTGG + Intergenic
981284946 4:143005724-143005746 ATGTGTATGTGCATGAAAGTAGG - Intergenic
982347845 4:154380894-154380916 ATGTGTCAGTCAATGGATATTGG - Intronic
985833777 5:2255885-2255907 ATGTGTATGTGCATGTGTGTGGG + Intergenic
985882000 5:2645480-2645502 ATGAGGAAGTCCATGCATGGAGG + Intergenic
988143947 5:27279983-27280005 ATGGGTAAGACCAAGACTGTAGG - Intergenic
989559344 5:42833256-42833278 ATGTGCTAGTCCATTAATATAGG - Intronic
990861820 5:60335720-60335742 TTGTGTAAGTCTTTTAATGTGGG + Intronic
991301608 5:65134050-65134072 ATGTGTAAGTTGCTAAATGTGGG - Intergenic
993153651 5:84193364-84193386 ATGTGTCAGTGGATGAATATTGG + Intronic
993254594 5:85573131-85573153 ATGTGTAATTCCAAAACTGTGGG - Intergenic
997324226 5:133006410-133006432 ATGATTAAGACCATGAATCTGGG + Intronic
998233998 5:140382139-140382161 ATGTGTCACTCCTTGACTGTAGG - Intergenic
998811270 5:145968480-145968502 ATGTGTTTGTGCATGTATGTGGG + Intronic
1003515663 6:6816396-6816418 TTGTGTAATTCCATGCATGGGGG + Intergenic
1004747437 6:18524841-18524863 ATCTGGAAGGCCATGTATGTTGG + Intergenic
1006269885 6:32956169-32956191 ATGGGTTAGTGCATAAATGTTGG - Intronic
1007814649 6:44512946-44512968 ATGTGTCAGAGAATGAATGTGGG + Intergenic
1007922315 6:45621425-45621447 ATGTGGAAGTCCCTGAATGGTGG + Intronic
1008888661 6:56459655-56459677 ATAGGTAACTCCAAGAATGTAGG + Intronic
1009043871 6:58214318-58214340 ATGTGTAAGACCCTGAATGCTGG + Intergenic
1009219706 6:60968575-60968597 ATGTGTAAGACCCTGAATGCTGG + Intergenic
1009329893 6:62404839-62404861 ATGATTTAGTCCATTAATGTTGG + Intergenic
1010387305 6:75296409-75296431 ATTTCTAAGTCCATAAATATAGG + Intronic
1012769201 6:103407110-103407132 ATATGTAACTATATGAATGTGGG - Intergenic
1013199642 6:107880644-107880666 ATGTGTGAGCCCATGGCTGTGGG - Intronic
1013914334 6:115316662-115316684 ATGTGTACATACATGTATGTGGG + Intergenic
1015760183 6:136650196-136650218 ATGAGTAAGTTGATGAATGATGG + Intronic
1017798529 6:157870175-157870197 ATGTGTGAGAGCATGAGTGTGGG - Intronic
1018765597 6:166930793-166930815 ATGTGTGTGTACATGCATGTGGG - Intronic
1018765599 6:166930832-166930854 ATGTGTGTGTACATGCATGTGGG - Intronic
1019282706 7:208379-208401 ATGGGTATGTACATGACTGTGGG + Intronic
1022971149 7:35518507-35518529 AAGTGTGAGTGCAGGAATGTGGG + Intergenic
1029307807 7:99633729-99633751 ATGTTTAAATCCATGAGTGCAGG - Intergenic
1030886279 7:114941935-114941957 GTGAGTGAGTCCATGCATGTAGG - Intronic
1031194397 7:118593566-118593588 GTGTGTATGTGCATGCATGTTGG - Intergenic
1032841250 7:135715241-135715263 ATGTGTATGTGTATGAGTGTGGG + Intronic
1036579721 8:10062625-10062647 ATCGGTAAGTCCATAACTGTTGG + Intronic
1036816561 8:11906922-11906944 ATATTTAAGCCCATGAAAGTTGG + Intergenic
1036846020 8:12171109-12171131 ATGTTCAAGTCCTTGGATGTAGG + Intergenic
1036867385 8:12413428-12413450 ATGTTCAAGTCCTTGGATGTAGG + Intergenic
1037174824 8:15934686-15934708 ATGTTTAAATATATGAATGTAGG + Intergenic
1041448063 8:57975407-57975429 TTCTGTAAGTCCATGGATGGTGG + Intergenic
1041469268 8:58190824-58190846 ATGTCTCAGTCCATGTATGAAGG - Intronic
1042840784 8:73121350-73121372 GTGTGTGAGGGCATGAATGTGGG + Intronic
1044584236 8:93854413-93854435 ATATCTAAATCCATGAATGATGG - Intergenic
1045036004 8:98176905-98176927 TTGTGTAAGTCTCTGAATATTGG + Intergenic
1045551348 8:103175491-103175513 ATGTGTAAATCCATTAATTTGGG + Intronic
1046268543 8:111862255-111862277 AAGTGTAAGTCCACAAAAGTAGG - Intergenic
1046617407 8:116492407-116492429 ATGTGTATATCTATAAATGTAGG - Intergenic
1049262010 8:141644647-141644669 TTGTGTAATTACACGAATGTTGG + Intergenic
1051379376 9:16439801-16439823 ATGTGTGAGTACGTGCATGTGGG + Intronic
1057270773 9:93649901-93649923 ATGAGTATGTCTATGAGTGTTGG - Intronic
1057526285 9:95805209-95805231 ATGTGTGTGTGCATGCATGTTGG + Intergenic
1058855669 9:109059348-109059370 ATATGTAAGTCTCTTAATGTAGG - Intronic
1060245595 9:121943401-121943423 ATGTGTGAGTCCGTGAATGCAGG + Intronic
1062561099 9:137142272-137142294 GTGTGGACGTGCATGAATGTGGG - Intronic
1062681679 9:137785341-137785363 CTGGGCAAGGCCATGAATGTGGG + Intronic
1186013252 X:5161810-5161832 ATGTATTAGTCCATGCATGGTGG + Intergenic
1190781527 X:53601082-53601104 ATATGTAAGTCCTTGTTTGTTGG + Intronic
1191824188 X:65346795-65346817 ATCTGTAAGTCCCTGACTGGAGG - Intergenic
1192761994 X:74103846-74103868 ATGTCTATGTCCATGAAGGGTGG - Intergenic
1193347415 X:80420904-80420926 ATGTGTCAGTCAATTAATGTAGG - Intronic
1194620554 X:96165533-96165555 ATGTGTAAGTTGATGTAGGTAGG - Intergenic
1196752016 X:119126656-119126678 GTGTGTAAATCCATTGATGTGGG - Intronic
1196752477 X:119130356-119130378 ATGTGTAATTTCAAGGATGTGGG - Intronic
1197619493 X:128732247-128732269 ATGAGTAAATCCATGAATTGGGG - Intergenic