ID: 1147664704

View in Genome Browser
Species Human (GRCh38)
Location 17:42139161-42139183
Sequence AAGCTGTGCTAGCAGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 134}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147664704_1147664715 29 Left 1147664704 17:42139161-42139183 CCATGGATCTGCTAGCACAGCTT 0: 1
1: 0
2: 3
3: 6
4: 134
Right 1147664715 17:42139213-42139235 AGAAGGGCCCCAGGCTTCATGGG 0: 1
1: 0
2: 0
3: 12
4: 146
1147664704_1147664714 28 Left 1147664704 17:42139161-42139183 CCATGGATCTGCTAGCACAGCTT 0: 1
1: 0
2: 3
3: 6
4: 134
Right 1147664714 17:42139212-42139234 CAGAAGGGCCCCAGGCTTCATGG 0: 1
1: 0
2: 2
3: 32
4: 289
1147664704_1147664709 12 Left 1147664704 17:42139161-42139183 CCATGGATCTGCTAGCACAGCTT 0: 1
1: 0
2: 3
3: 6
4: 134
Right 1147664709 17:42139196-42139218 CGGCCAGTGCTGTCCACAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 164
1147664704_1147664707 -8 Left 1147664704 17:42139161-42139183 CCATGGATCTGCTAGCACAGCTT 0: 1
1: 0
2: 3
3: 6
4: 134
Right 1147664707 17:42139176-42139198 CACAGCTTGGCCAGTGTGGTCGG 0: 1
1: 0
2: 1
3: 21
4: 261
1147664704_1147664710 13 Left 1147664704 17:42139161-42139183 CCATGGATCTGCTAGCACAGCTT 0: 1
1: 0
2: 3
3: 6
4: 134
Right 1147664710 17:42139197-42139219 GGCCAGTGCTGTCCACAGAAGGG 0: 1
1: 0
2: 2
3: 26
4: 353
1147664704_1147664712 20 Left 1147664704 17:42139161-42139183 CCATGGATCTGCTAGCACAGCTT 0: 1
1: 0
2: 3
3: 6
4: 134
Right 1147664712 17:42139204-42139226 GCTGTCCACAGAAGGGCCCCAGG 0: 1
1: 0
2: 3
3: 17
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147664704 Original CRISPR AAGCTGTGCTAGCAGATCCA TGG (reversed) Intronic
900911571 1:5600293-5600315 GAGCTGAGCTAGCAGAGCCCGGG - Intergenic
903701282 1:25250254-25250276 AAGCTGTACCAGCAGCTCCTGGG - Intronic
911041146 1:93592005-93592027 ACGCTGTGCTTGCAGACCCCAGG + Intronic
911146322 1:94555602-94555624 AAGTGGTGCTACCAGATCCCAGG - Intergenic
915012041 1:152696636-152696658 AAGGTGTGCTTGCAAGTCCAGGG - Intergenic
917364610 1:174216227-174216249 CTGCTGTGCTAGCAGATACTAGG - Intronic
917809344 1:178642403-178642425 ACTCTGTGCTTGCAGATGCAGGG - Intergenic
920692829 1:208159840-208159862 AACCTGTGCTTCCAGAGCCAGGG + Intronic
920723352 1:208410701-208410723 AAGCTCAGCTAGCAGATCTCTGG - Intergenic
922180572 1:223229908-223229930 TAGCTCTGCTTGCAGAGCCAGGG + Intronic
922933988 1:229410022-229410044 AAGCTGTGCTTACTTATCCAAGG + Intergenic
1066264589 10:33763864-33763886 AAGCTGTGCCAGCAGTCACAGGG + Intergenic
1068004555 10:51377496-51377518 CAGCAGTGCTAGCAGAGCCCAGG - Intronic
1071559546 10:86634245-86634267 GAGCTGTGCTAGCAAATTAATGG - Intergenic
1074296464 10:112193714-112193736 GAGCTGCGCTAGCAGATCCCAGG + Intronic
1075716369 10:124558121-124558143 CAGCTGGGCCAGCAGATCTAGGG + Intronic
1076863915 10:133158146-133158168 AAGCTGTGCCAGCACATGCTGGG + Intergenic
1079201856 11:18383487-18383509 AGGCTGTGCCAGCATCTCCATGG - Intergenic
1080894971 11:36441524-36441546 AATCTGTGAGAGCAGACCCAGGG - Intronic
1081882072 11:46462171-46462193 AACTTGTGATAGCAGGTCCAGGG - Intronic
1083205662 11:61147285-61147307 GAGCTTTGCTATCAGAACCAAGG + Intronic
1083982555 11:66185149-66185171 AAGCGGTGAGAGCAGATCAAGGG + Intronic
1084712626 11:70853300-70853322 AAGCTGTGCTCTGAGCTCCAGGG - Intronic
1090882842 11:130849307-130849329 AAGCTGTGCTGGCAGACTGAAGG - Intergenic
1092522675 12:9290211-9290233 AAGCTGAGCTAGGAGAGCCCTGG - Intergenic
1092544610 12:9441686-9441708 AAGCTGAGCTAGGAGAACCCTGG + Intergenic
1094096530 12:26711486-26711508 AAGCTGTGTTTGCAGATGTAAGG - Intronic
1094508343 12:31080384-31080406 AAGCTGAGCTAGGAGAGCCCTGG - Intronic
1095655489 12:44663973-44663995 AATGAGTGCTAGCAGTTCCAGGG - Intronic
1099033964 12:77562448-77562470 AAGCTGTTCTAGCAGACCCAGGG - Intergenic
1102368649 12:112362242-112362264 CAGCTCTGTTAGCAGATCAATGG - Intronic
1102641258 12:114368844-114368866 AAGCTGGGCTAGGAGACCCCTGG - Intronic
1105528855 13:21200282-21200304 AAGCTGTGAGAGCAGCTTCAGGG - Intergenic
1111249642 13:85586535-85586557 AGGTTGTGCCAGCTGATCCACGG + Intergenic
1114136440 14:19857219-19857241 GAGCTATGCTAGCACTTCCAAGG + Intergenic
1116613092 14:47103211-47103233 AAACTGTGCTTACAGATTCAAGG + Intronic
1119170221 14:72529292-72529314 CAGCAGTAATAGCAGATCCAAGG - Intronic
1120341613 14:83227092-83227114 TTGCTGTGCTAGCAGATACTAGG - Intergenic
1120922886 14:89771192-89771214 CAGCCATGCTAGCAGAGCCAAGG - Intergenic
1124232840 15:27960419-27960441 GAGCTGTGCCAGCATATCCTGGG - Intronic
1125980447 15:43995921-43995943 GCCCTGTTCTAGCAGATCCAGGG - Intronic
1126167495 15:45666257-45666279 ATGCTGTGATAGCACATCAAGGG - Intronic
1129040066 15:72678266-72678288 AAGCTGTTCTAGTGGATCCCAGG - Intronic
1130305251 15:82709152-82709174 AGGCTGTGCAAGTACATCCAGGG + Intronic
1133934985 16:10261662-10261684 AAGCTGTACCAGCAGCTCCTGGG - Intergenic
1135323682 16:21512906-21512928 AACCTTTGCTAGCTGAGCCAGGG + Intergenic
1136335167 16:29606171-29606193 AACCTTTGCTAGCTGAGCCAGGG + Intergenic
1137519931 16:49183968-49183990 AAGCTGAGCTAGCAATTCCAAGG - Intergenic
1138078806 16:54069126-54069148 AAGGAATGCTAGAAGATCCATGG + Intronic
1140466894 16:75189855-75189877 AAGCTGTGCCAGCAGCAACAGGG + Intergenic
1143821663 17:9569395-9569417 AAGCTGGGCTTGCAGATGCCTGG + Intronic
1147664704 17:42139161-42139183 AAGCTGTGCTAGCAGATCCATGG - Intronic
1149410258 17:56397715-56397737 AAACTTTGGTAGCAGAACCACGG + Intronic
1150719222 17:67600042-67600064 AAGCTGGGCCACCAGAGCCAGGG + Intronic
1152262177 17:79273159-79273181 TGCCTGTGCCAGCAGATCCAGGG + Intronic
1152777454 17:82211829-82211851 AAGCTGTACCAGCAGCTCCTGGG + Intronic
1153987980 18:10369615-10369637 AAGCTGCTCTTGCAGGTCCAGGG + Intergenic
1155673521 18:28401288-28401310 AAGCTGTGCTAGGGGATTTAAGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1161805570 19:6441346-6441368 CAGCTGAGCTTGGAGATCCAGGG + Exonic
1162181407 19:8871534-8871556 GAGCTGAGCCAGCAGACCCATGG - Exonic
1162184180 19:8891878-8891900 AAGCTGAGCCAGCTGACCCACGG - Exonic
1163643357 19:18474267-18474289 AAGCTGGCCAAGCAGACCCATGG - Intronic
1164310872 19:24045176-24045198 AAGCTGTACCAGCAGCTCCTGGG + Intronic
1168695289 19:58400787-58400809 AGGCAGTGCTACCAGAACCATGG - Intergenic
925097549 2:1219293-1219315 AACCTGTGCCACCAGAGCCAAGG + Intronic
926737200 2:16082655-16082677 AGCCTGAGCTAGCAGGTCCATGG - Intergenic
926921472 2:17944662-17944684 ACACTGTGCTAGCACACCCAGGG + Intronic
927148027 2:20179726-20179748 AAGCTCTGCCAGCAGGCCCAGGG - Intergenic
928738627 2:34323080-34323102 AAGCTGTGCTATTAGAGTCAAGG - Intergenic
932466138 2:71925551-71925573 ACCCTGTGCTTGCAGATACACGG - Intergenic
935273896 2:101459734-101459756 ATGCTGTGCTGGGAGAACCACGG + Intronic
936573997 2:113638371-113638393 CAGCTGTGCCAGCAGTTACAGGG + Intronic
940346125 2:152630884-152630906 AAGGTGGGATAGCAGATGCAGGG + Intronic
941368389 2:164634609-164634631 CAGCAGTGCTAGTAAATCCAAGG + Intergenic
941943081 2:171064309-171064331 ATGCTGTGTTTGCAGATTCAGGG - Intronic
944632629 2:201642879-201642901 AAGCTGTGATTGCAGCGCCACGG - Intronic
946829792 2:223716960-223716982 AAGCTGTACCAGCAGCTCCTGGG + Intergenic
1171495447 20:25551863-25551885 AAACTTGGCTTGCAGATCCAAGG + Intronic
1174770601 20:53296511-53296533 CAGCTGGGCTAGCATTTCCAGGG + Intronic
1179287947 21:39994425-39994447 AAGCTGTGCTCTCGGATCCATGG - Intergenic
1183643941 22:39111481-39111503 AAGCTGCACTAGCAGCTCCTGGG + Intergenic
1184799825 22:46752623-46752645 AGGCTGTGCCAGCAGAACCCAGG - Intergenic
951322064 3:21257130-21257152 AAGCGGTGCCAGTAGATCAAGGG - Intergenic
952817118 3:37455204-37455226 AAGCAGGACTAGAAGATCCAGGG - Intronic
955937365 3:64113959-64113981 TAACAGTGCTAGCAGATGCAGGG - Intronic
957086747 3:75687064-75687086 AAGCTGCGCCAGCAGCTCCTGGG + Intergenic
958893945 3:99809654-99809676 AAGCTGTACTAGAAAATCCTTGG + Intergenic
959355025 3:105315530-105315552 AAGCTGTTCTAGCTCATTCATGG - Intergenic
960522128 3:118667354-118667376 AAGCTGGCCTAGCAGAGACACGG - Intergenic
961170848 3:124796766-124796788 AAGCTGTCCCAGCAGACACACGG - Exonic
961623634 3:128244049-128244071 AAGCTGTGCCCACAGAACCAAGG - Intronic
961641657 3:128368574-128368596 CAGCTGAGCTACCACATCCAGGG - Intronic
966164900 3:177006402-177006424 AACCTGTGATAGCAGCTGCAGGG + Intergenic
974504705 4:62754202-62754224 AAACTGTTCTATCAGATCCAGGG - Intergenic
974837119 4:67264573-67264595 AAGGTGGGCTAGTAGAGCCAAGG + Intergenic
975919782 4:79371331-79371353 AAGCTGGGCTAGAAGATCCAAGG - Intergenic
976474243 4:85464488-85464510 AATCTGTGCTAAAAGAGCCAAGG + Intergenic
976709218 4:88051119-88051141 AAGCTTTACAATCAGATCCAAGG - Intronic
978019468 4:103789166-103789188 AAGCTGTCCTTGCTTATCCATGG - Intergenic
978964676 4:114725990-114726012 AAGCTGTGGCTGCAGACCCAGGG - Intergenic
979979166 4:127233646-127233668 AAGCTGTGCTATTAGATCCAAGG - Intergenic
983761191 4:171408476-171408498 CAGCTGAACTAACAGATCCATGG + Intergenic
985288338 4:188360635-188360657 AAACTTTTCTAGAAGATCCATGG + Intergenic
985694198 5:1330827-1330849 AAGCAGGGGAAGCAGATCCATGG + Intronic
985876493 5:2602592-2602614 CAGCTGTGCTAGCAGTTCCTGGG - Intergenic
985932571 5:3070146-3070168 AAGCTGAGCTCCCATATCCATGG - Intergenic
986445775 5:7819961-7819983 AAGCTGAGCTGACAGATGCAAGG + Intronic
987145187 5:14984857-14984879 TAGATGTTCTAGCAGCTCCAGGG + Intergenic
988465376 5:31485826-31485848 AAGGTTTGCAAGCAGAGCCAGGG + Intronic
999842988 5:155449321-155449343 AACCTGTGATAGCAGCTACAGGG - Intergenic
1003403109 6:5807089-5807111 AAGCTGTGAGAGCAGCTTCAGGG + Intergenic
1004001746 6:11602689-11602711 AAGATGTGCTGGTAGATCAAAGG - Intergenic
1007339604 6:41182109-41182131 ACTCTGTCCTAGCAGATCCTGGG + Intergenic
1009975147 6:70664161-70664183 AAGCTGCTGTAGCAGATGCAAGG - Intergenic
1011351585 6:86429822-86429844 AAGCTGTGCTAACAAATCAGTGG + Intergenic
1014038505 6:116796725-116796747 AACCAGTGCTTGCAGACCCAGGG - Intronic
1014183487 6:118409123-118409145 CAGCAGTGCTAGCAGATGCAAGG - Intergenic
1014688435 6:124532366-124532388 AAGCTGTGAAAGAAGATGCAGGG + Intronic
1017111073 6:150933222-150933244 CAGCTATGCTAGCATATCCTTGG + Intronic
1018740606 6:166725728-166725750 AAGCTGTGCAAGCAGAAACTCGG - Intronic
1019115464 6:169757696-169757718 AAGCTGTGCTTGCCAAGCCAGGG + Intronic
1022358288 7:29636694-29636716 AAGCTGTACCAGCAGCTCCTGGG - Intergenic
1022359694 7:29646203-29646225 AAGCTGTACCAGCAGCTCCTGGG - Intergenic
1022525423 7:31034028-31034050 AAGCTGGAATGGCAGATCCAAGG - Intergenic
1026247766 7:68636324-68636346 AAACTATACTAGCAGGTCCATGG - Intergenic
1029866489 7:103636440-103636462 AAGCTGGGCCAGAAAATCCAGGG + Exonic
1031934288 7:127720094-127720116 ATTCTGTGCTAGAAGATCTAAGG + Intronic
1032720662 7:134548703-134548725 AAGCTGTACCAGCAGCTCCTGGG + Intergenic
1032721988 7:134557548-134557570 AAGCTGTACCAGCAGCTCCTGGG + Intronic
1034815440 7:154168310-154168332 AAGCTGGCCGCGCAGATCCAGGG + Intronic
1034856431 7:154552553-154552575 AAGCTGTGCTGGATGGTCCATGG + Intronic
1038227815 8:25673025-25673047 AGGCTGTGTTAGCAGACTCAGGG + Intergenic
1038727459 8:30094612-30094634 AAGCTGTACCAGCAGCTCCTGGG - Intergenic
1041956193 8:63559843-63559865 AGGCTGTGCTGTCAGTTCCATGG - Intergenic
1043264729 8:78250259-78250281 AAAGTATGCTAGCAGATACAAGG + Intergenic
1044986691 8:97762183-97762205 AAGCTGTACCAGCAGCTCCTGGG + Intergenic
1045055219 8:98362829-98362851 CAGCTGTGGGAGCAGACCCAGGG - Intergenic
1050101902 9:2128481-2128503 ACACTGTGCTAGAAGATGCAGGG + Intronic
1051915636 9:22203773-22203795 AAGCTGAGTCAGCAGAGCCACGG + Intergenic
1052984487 9:34476555-34476577 GAGCTGTGCTAGAAGAACAAGGG + Intronic
1055907787 9:81314260-81314282 AAGCTGTGCGAACAGATATAGGG - Intergenic
1189676429 X:43465261-43465283 AATCTGTGCTGACAGATCAATGG - Intergenic
1199177360 X:144806141-144806163 ATGCTGTGCTAGCAAATACTAGG + Intergenic