ID: 1147666586

View in Genome Browser
Species Human (GRCh38)
Location 17:42152694-42152716
Sequence GCCTCTGCCTCCCGAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10376
Summary {0: 1, 1: 3, 2: 60, 3: 957, 4: 9355}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147666586_1147666588 16 Left 1147666586 17:42152694-42152716 CCTTGATCTCGGGAGGCAGAGGC 0: 1
1: 3
2: 60
3: 957
4: 9355
Right 1147666588 17:42152733-42152755 TGTGCCACTGCACTCCAGCCTGG 0: 26280
1: 87232
2: 177120
3: 208812
4: 166229
1147666586_1147666589 17 Left 1147666586 17:42152694-42152716 CCTTGATCTCGGGAGGCAGAGGC 0: 1
1: 3
2: 60
3: 957
4: 9355
Right 1147666589 17:42152734-42152756 GTGCCACTGCACTCCAGCCTGGG 0: 52453
1: 149973
2: 210600
3: 182318
4: 112095
1147666586_1147666592 30 Left 1147666586 17:42152694-42152716 CCTTGATCTCGGGAGGCAGAGGC 0: 1
1: 3
2: 60
3: 957
4: 9355
Right 1147666592 17:42152747-42152769 CCAGCCTGGGTGACAAAACAAGG 0: 2
1: 135
2: 1088
3: 2737
4: 5117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147666586 Original CRISPR GCCTCTGCCTCCCGAGATCA AGG (reversed) Intronic
Too many off-targets to display for this crispr