ID: 1147670241

View in Genome Browser
Species Human (GRCh38)
Location 17:42172871-42172893
Sequence ATGGAGAAGCATAGTGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147670229_1147670241 22 Left 1147670229 17:42172826-42172848 CCAGTAGCGACGGCAGCAATTGT 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1147670241 17:42172871-42172893 ATGGAGAAGCATAGTGGAGTGGG 0: 1
1: 0
2: 4
3: 28
4: 209
1147670227_1147670241 24 Left 1147670227 17:42172824-42172846 CCCCAGTAGCGACGGCAGCAATT 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1147670241 17:42172871-42172893 ATGGAGAAGCATAGTGGAGTGGG 0: 1
1: 0
2: 4
3: 28
4: 209
1147670235_1147670241 -10 Left 1147670235 17:42172858-42172880 CCCCCTTTAAGACATGGAGAAGC 0: 1
1: 0
2: 0
3: 20
4: 184
Right 1147670241 17:42172871-42172893 ATGGAGAAGCATAGTGGAGTGGG 0: 1
1: 0
2: 4
3: 28
4: 209
1147670228_1147670241 23 Left 1147670228 17:42172825-42172847 CCCAGTAGCGACGGCAGCAATTG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 1147670241 17:42172871-42172893 ATGGAGAAGCATAGTGGAGTGGG 0: 1
1: 0
2: 4
3: 28
4: 209
1147670234_1147670241 -9 Left 1147670234 17:42172857-42172879 CCCCCCTTTAAGACATGGAGAAG 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1147670241 17:42172871-42172893 ATGGAGAAGCATAGTGGAGTGGG 0: 1
1: 0
2: 4
3: 28
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147670241 Original CRISPR ATGGAGAAGCATAGTGGAGT GGG Intronic
900003724 1:29999-30021 ATGGGGAAGCAAGGCGGAGTTGG + Intergenic
900023444 1:200515-200537 ATGGGGAAGCAAGGCGGAGTTGG + Intergenic
900989413 1:6091465-6091487 AAGGAAAAGCAAAGTGGTGTTGG + Intronic
903471458 1:23590546-23590568 ATGGAGAAGCAGGGAGGAGGAGG + Intronic
904873948 1:33639188-33639210 ATGGACTAGCATGGTAGAGTAGG + Intronic
906263728 1:44412428-44412450 ATGCTGAATCATAGTGGTGTGGG + Exonic
906771334 1:48487524-48487546 ATCAACAAGCATGGTGGAGTGGG - Intergenic
909683783 1:78322654-78322676 ATGGAGAAGCTGAGTTCAGTGGG - Intronic
909940724 1:81608699-81608721 ATGGAGAAGAGTAGCAGAGTTGG - Intronic
910079357 1:83322911-83322933 ATTGAGAAGAGAAGTGGAGTGGG - Intergenic
911411351 1:97511442-97511464 ATGGAGAAGCAGTGTAGTGTGGG - Intronic
911413034 1:97534744-97534766 ATGGAGAACTATACTGGATTTGG - Intronic
912326471 1:108768085-108768107 TTGGAGAAGCATCTTGTAGTCGG + Intronic
915170313 1:153972905-153972927 CAGGAGAAGCATTGGGGAGTTGG + Intronic
917335907 1:173924167-173924189 CAGGAGAAGCATAGTGGAGAGGG - Intergenic
918802345 1:188987247-188987269 AAGGAAAAGCATTGTGGTGTGGG - Intergenic
919126664 1:193402860-193402882 ATGAAGAAGTTTAGTGGAGGAGG + Intergenic
921149669 1:212389742-212389764 ATGAAAAAGCATTGTGGAGATGG + Intronic
921723233 1:218496543-218496565 ATGGAGAAGCAGAGGGCATTAGG + Intergenic
924093933 1:240531573-240531595 AGGGAACAGAATAGTGGAGTTGG + Intronic
924248351 1:242106866-242106888 ATGGAGAAGAAGAGTGTTGTAGG + Intronic
924491110 1:244538710-244538732 ATGGGGAAAGATAGTGGAGCTGG + Intronic
1063877280 10:10493343-10493365 CTGGAGATGCATGGTGGAGACGG + Intergenic
1063953532 10:11245882-11245904 ATGGAGAAGCAGTGTGGTTTAGG + Intronic
1064299680 10:14112343-14112365 ATGGAGGAGCACAGAGGAGAGGG + Intronic
1065163998 10:22955426-22955448 ATGGAGAGTTATCGTGGAGTAGG + Intronic
1065193258 10:23235148-23235170 ATGGAAAAGAATAGCGTAGTTGG + Intronic
1065655954 10:27950045-27950067 ATGGAGAAGCTGTGTGGGGTAGG - Intronic
1066046525 10:31600227-31600249 ATAGAGAAGAGTAGTTGAGTGGG - Intergenic
1066211511 10:33243899-33243921 AAGGAGAAGGAGAGTGGAGAAGG + Intronic
1066265232 10:33770391-33770413 TTGGAGAAGTCTGGTGGAGTTGG + Intergenic
1066336116 10:34480219-34480241 AAGGAGAAGCAAGGTGCAGTAGG - Intronic
1067274250 10:44820189-44820211 ATAGAGAAGGGTGGTGGAGTGGG - Intergenic
1068293258 10:55033183-55033205 AGGGAGAGGCATAGTGCAGGAGG + Intronic
1071352922 10:84764519-84764541 ATGGAGAAGAATATTGGGTTAGG + Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071689877 10:87805751-87805773 AGGGAGAAGGTTAGTGGAGGAGG - Intronic
1073008190 10:100340402-100340424 ATGGGGAAGAAAGGTGGAGTTGG + Intergenic
1073653267 10:105384106-105384128 AGGGAGAAGGAGAGTGGAGGAGG - Intergenic
1074238941 10:111617118-111617140 ATGGAGAAGCTCAGTACAGTGGG - Intergenic
1075145323 10:119877684-119877706 ATGGGGAAGAATTGTGGGGTAGG + Intronic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1075350748 10:121722758-121722780 ATGGAGAAACAGAGTGGAATGGG - Intergenic
1080255524 11:30286507-30286529 ATGGAGAAAAATAGGGAAGTGGG + Intergenic
1080610046 11:33896064-33896086 ATGGAGAAGCAAAGTTGAAGGGG + Intergenic
1082057906 11:47834968-47834990 TTGGAGGAGCAATGTGGAGTGGG + Intronic
1082885409 11:58077057-58077079 TTGGAGAGGAGTAGTGGAGTAGG + Intronic
1082891998 11:58149544-58149566 CTGGAGAAGGATAGTGGTGATGG - Intronic
1082892479 11:58154863-58154885 ATGGAAAAGCCCAGTGTAGTGGG - Intronic
1083659041 11:64243719-64243741 ATGGAGAAGGGTAATGGAGATGG - Intronic
1084468452 11:69341066-69341088 ATGGAGAAGCACGTTGGAGAAGG + Intronic
1085736689 11:79045322-79045344 GTGAAGAAGCACAGTGGAGTTGG + Intronic
1085924804 11:81004675-81004697 ATGGAGAATATTAGTAGAGTTGG + Intergenic
1086878262 11:92124209-92124231 AAGGAGGAGCATCCTGGAGTGGG + Intergenic
1087959241 11:104327046-104327068 GAGGAGGAGCAAAGTGGAGTAGG + Intergenic
1090474184 11:127004545-127004567 ATGGAGAAGGATAGGACAGTGGG - Intergenic
1091377143 12:32053-32075 ATGGGGAAGCAAGGCGGAGTTGG + Intergenic
1092232836 12:6786450-6786472 AGGGAGAAGCACAGGGGACTGGG + Intergenic
1092696296 12:11175446-11175468 ATGCAGAAGCATAAAGGGGTAGG + Intergenic
1092887649 12:12939065-12939087 ATGGAGGAGCCTAGTGGACGGGG + Intergenic
1093541153 12:20286963-20286985 AAGGATAAGCATGGTGGAGCAGG + Intergenic
1096196187 12:49650267-49650289 AGGGAGAAGCATAGTGCCTTGGG - Intronic
1096394294 12:51254080-51254102 CTGGAGATGCATAGTGGTGTTGG + Intronic
1096639292 12:52981406-52981428 CTGGAGAAGCATTGTGCAGGAGG - Intergenic
1097472450 12:60011253-60011275 ATGGAGAAGAATATTGGGTTAGG + Intergenic
1098346617 12:69511611-69511633 ATGGAGATGAATAGAGGATTAGG + Intronic
1098513623 12:71348125-71348147 ATGATGAAGCTTAGTGGATTGGG - Intronic
1100592655 12:96043944-96043966 TGGGAGAAGCAGACTGGAGTGGG + Intergenic
1100725736 12:97406472-97406494 ATGGAGAAGCAGAGCAGAATGGG - Intergenic
1100814682 12:98374968-98374990 ATTCAGAAGAATAGTGGAATGGG - Intergenic
1102263640 12:111461984-111462006 AGGGAAAAGGAGAGTGGAGTGGG + Intronic
1106312824 13:28568648-28568670 ATGGAGCAGCACAGTGGTGCTGG - Intergenic
1106800210 13:33248576-33248598 ATGGGGGAGCAGTGTGGAGTGGG - Intronic
1107470005 13:40683025-40683047 ATGGAGAAACATAGTTCAATGGG - Intergenic
1108584974 13:51863239-51863261 AGGGAGAAGCAAGCTGGAGTTGG + Intronic
1109134377 13:58627808-58627830 ATGCAGAATCATAGTGGAAGGGG - Intergenic
1110195943 13:72788586-72788608 AAGGAGAAGGATAGTGGAAAAGG + Intronic
1114705432 14:24721786-24721808 TTGGAGAAGCCTCGTGAAGTGGG + Intergenic
1115320642 14:32076749-32076771 AGGGAGAAGCAGAGGGGAGGAGG + Intronic
1115715949 14:36104002-36104024 AGGGAGAGGAATAATGGAGTTGG - Intergenic
1116118217 14:40685188-40685210 ATGGAAAAGCATTGTGCAGTTGG + Intergenic
1120890426 14:89485969-89485991 ATGGAGAAGCTTTGAGGATTGGG - Intronic
1121050991 14:90818806-90818828 CTGGAGAGGCAGACTGGAGTTGG - Intergenic
1124220871 15:27848505-27848527 ACGGAGAAGCACAGGGGGGTCGG + Intronic
1124361305 15:29038354-29038376 ATGGAGAAGCTCAGAGGATTGGG + Intronic
1124498601 15:30206492-30206514 ATGGATAAGAAGTGTGGAGTGGG - Intergenic
1124744980 15:32332184-32332206 ATGGATAAGAAGTGTGGAGTGGG + Intergenic
1128373731 15:67060486-67060508 CTGGAGATGGATGGTGGAGTTGG - Intergenic
1128748805 15:70133872-70133894 ATGGAGAAGCAAAGGGCAGATGG - Intergenic
1129848525 15:78779015-78779037 TTGGAGATCCAGAGTGGAGTGGG + Intronic
1130433089 15:83868729-83868751 GTGGAGAAGCAGAGTGGTTTGGG + Intronic
1132449778 15:101960941-101960963 ATGGGGAAGCAAGGCGGAGTTGG - Intergenic
1133501546 16:6372107-6372129 ATGGAAAAGTATAGTTGGGTGGG + Intronic
1135832073 16:25783758-25783780 CTGGAAAAGCATAGTGGTGATGG - Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1143418068 17:6764801-6764823 ATGGAGAGCCAGACTGGAGTGGG - Intronic
1146827240 17:36033434-36033456 ATGGAGCAGCATGGTGGGGAAGG - Intergenic
1147670241 17:42172871-42172893 ATGGAGAAGCATAGTGGAGTGGG + Intronic
1150061003 17:62068192-62068214 ATGGAGAAGCAGATTAGAATGGG + Intergenic
1151345739 17:73500262-73500284 ATGGAGAAGGATGGAGGAGATGG - Intronic
1151345746 17:73500292-73500314 ATGGAGAAGGATGGAGGAGATGG - Intronic
1155091421 18:22515167-22515189 CTGGAGAAGACTAGTGGAGGTGG + Intergenic
1158512226 18:58100736-58100758 ATGGAAATGGATATTGGAGTGGG + Intronic
1159519482 18:69499688-69499710 ATGGAGATGCATAGTAGGCTAGG - Intronic
1159568419 18:70083233-70083255 ATGCAGAAGCATACTGGAAGTGG - Intronic
1160635477 19:71606-71628 ATGGGGAAGCAAGGCGGAGTTGG + Intergenic
1160676460 19:393912-393934 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695228 19:480651-480673 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695347 19:481320-481342 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1164906641 19:31973583-31973605 ATGGCGAAGGACAGAGGAGTGGG - Intergenic
1165207255 19:34200561-34200583 ATGGAGAAACAGAGTGGGTTTGG + Intronic
1167670832 19:50852346-50852368 ATGGAGGATCAGATTGGAGTTGG + Intergenic
1168312576 19:55468333-55468355 ATGGAGAACCATAGAGGGTTTGG + Intergenic
925337483 2:3108795-3108817 ATGGAGGAGCAGCGTGGAGCCGG - Intergenic
927180182 2:20440364-20440386 ATGTAAATGAATAGTGGAGTTGG - Intergenic
928204123 2:29271974-29271996 AAGGAGAAGGATAGAGGGGTAGG + Intronic
929906801 2:46053425-46053447 ATGGAGATGGATAGTGGTGACGG - Intronic
932210212 2:69921752-69921774 ATGGAGAAGAATAGGTGAGTTGG + Exonic
933669263 2:84991265-84991287 AGGGAGAAGCATTTTGGAGATGG + Intronic
935574213 2:104692207-104692229 ATGGAGATGAATAGTGGTGATGG - Intergenic
936566006 2:113583441-113583463 ATGGGGAAGCAAGGCGGAGTTGG - Intergenic
938695425 2:133830857-133830879 ATGCAGAAGAAAAGAGGAGTGGG + Intergenic
940881989 2:158955957-158955979 ATTGTGAAGCAGAGTAGAGTGGG - Intergenic
941273210 2:163456758-163456780 AAGGAGAAGCAAAGAGGAGGGGG + Intergenic
942650420 2:178161147-178161169 TTGGAGAAGCATTGTGAACTGGG + Intergenic
946336294 2:219038814-219038836 ATGGAGGGGCCTAGTGGGGTGGG - Intronic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
1168881290 20:1208372-1208394 ATGTAGAGGCAGAGTGGAGGGGG + Intergenic
1169028590 20:2390692-2390714 ATGGAGGAAAATAGTGGAGAAGG + Intronic
1169203457 20:3727249-3727271 ATGCAGAATCAAAATGGAGTGGG - Intergenic
1169669829 20:8084582-8084604 ATGGATAAGCAAATTGTAGTAGG - Intergenic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1173927853 20:46794018-46794040 ATGAAGAAGCAAAGTAGGGTGGG - Intergenic
1174160875 20:48549555-48549577 ATGGAGAACAGGAGTGGAGTTGG - Intergenic
1175543915 20:59765847-59765869 AGGGAAAAGCCTAGTGGAGCTGG - Intronic
1176218452 20:63959014-63959036 TTGGAGCAGCCTCGTGGAGTAGG - Exonic
1178862503 21:36300907-36300929 ATGGACAAGCCTAGTGAAGACGG - Intergenic
1181341779 22:22186693-22186715 ATACAGAAGCACAGTGGAGGTGG + Intergenic
1183621952 22:38979034-38979056 ATGGAGAAGGATGGTGGTGGTGG + Intronic
949654967 3:6207265-6207287 CTGGAGAAGCATGGTGAAGATGG - Intergenic
949732225 3:7126725-7126747 AAGGAGAAGCAGAGAGGAGGGGG - Intronic
950761073 3:15227217-15227239 ATGGATAAGAATGGTGGATTTGG + Intronic
952989770 3:38821586-38821608 AAGGAGAATCATTTTGGAGTGGG - Intergenic
953249638 3:41232842-41232864 ATGGAGAAAAATAATGGAGTGGG - Intronic
953354736 3:42246081-42246103 CTGGAAAAGAATGGTGGAGTTGG - Intergenic
954140987 3:48605345-48605367 ATGGAGAAGGATTATGGGGTGGG - Intronic
955286611 3:57647681-57647703 ATGGAGAAGTACCCTGGAGTAGG + Intronic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957885371 3:86281353-86281375 AAGGAGAATGATAATGGAGTAGG - Intergenic
962210142 3:133470985-133471007 ATGGAGGAGCATGGTGCAGGTGG + Intronic
962534340 3:136314357-136314379 ATGGAGAAGAAAAGTGGAATTGG + Intronic
964977590 3:162638795-162638817 ATGAAGAAACATAATGAAGTTGG - Intergenic
965350292 3:167603375-167603397 TTAGAGAAGGATAGAGGAGTTGG - Intronic
965417105 3:168409761-168409783 ATGGTAAAGCATAGTGTAGTTGG + Intergenic
970602164 4:17649259-17649281 ATGTAAAAGCATAGTGTATTTGG + Intronic
971336777 4:25730381-25730403 ATGGGGATGCATAGAGGAGTAGG + Intergenic
973546914 4:51991408-51991430 ATGGAGAAGGATAGTGGATTTGG - Intergenic
975303045 4:72814018-72814040 ATAGAGAAGCACAGTGGTTTAGG - Intergenic
976843525 4:89460133-89460155 ATGGCGAAACACAGTGGAGTAGG - Intergenic
977789072 4:101076544-101076566 ATGGAAACGCAGACTGGAGTGGG + Intronic
980907384 4:138961680-138961702 ATGGGGAGGGATAGTGGAGCTGG - Intergenic
984310250 4:178049164-178049186 ATTGAGAAGGGTAGTGAAGTAGG - Intergenic
985780910 5:1871389-1871411 AGGGAGAGGCACAGTGGAGTGGG - Intergenic
986731379 5:10637171-10637193 ATGGAAAACCAAAATGGAGTGGG - Intronic
987427880 5:17794252-17794274 AGGGAGATGCGTGGTGGAGTGGG + Intergenic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
989127539 5:38071677-38071699 ATGCAGAAGCATGCAGGAGTGGG + Intergenic
989254592 5:39352454-39352476 AGGGAGAAGCATATTTGAGAGGG - Intronic
990088315 5:52007140-52007162 TTTGAGAAGGATAGTGGAGATGG + Intergenic
990320820 5:54628340-54628362 AGGGAGAAGAATAGTGCAGTGGG - Intergenic
992933023 5:81670366-81670388 ATAGAAAAGCATAGAGGAGTAGG - Intronic
997385025 5:133465629-133465651 ATGGAGGAGCACAGTGGGGTTGG + Intronic
999498680 5:152125246-152125268 AGGGAGAAGCTAAGTGGTGTGGG - Intergenic
1000091384 5:157932265-157932287 ATGGAGAAGGATGGAGGAGGAGG + Intergenic
1004194511 6:13491125-13491147 ATGGAGATGCACAGTGGAGTAGG + Intergenic
1005019788 6:21406773-21406795 ATAGAGAAGCATAGGTGTGTTGG - Intergenic
1005021670 6:21424393-21424415 ATGGAGAAACATAATGGCTTTGG - Intergenic
1005228491 6:23671555-23671577 ATTGAGAAGAAAAGTGGGGTTGG - Intergenic
1005438601 6:25840722-25840744 ATGGAGAAGTCTAGTAGAGTTGG + Intronic
1005510404 6:26507301-26507323 ATGAAGAAGCACAGAGGATTGGG + Intronic
1007999133 6:46340225-46340247 AAGGAGTTGGATAGTGGAGTAGG - Intronic
1008868305 6:56241646-56241668 AGAGAGAAGCATTGTGGAGAAGG - Intronic
1015474827 6:133648665-133648687 ATGCAGAGCCATTGTGGAGTGGG + Intergenic
1017339896 6:153308984-153309006 AGGAAGAAGCAAAGTGGAGTAGG - Intergenic
1018652246 6:166002300-166002322 ATGGGGAACCATGGGGGAGTTGG + Intergenic
1019653419 7:2173099-2173121 CAGGAGATGCAGAGTGGAGTTGG - Intronic
1021182756 7:17527458-17527480 ATGAAGAAGAATAGTGGACTGGG + Intergenic
1022728261 7:32999855-32999877 GTGGAGAAGCATAGTGGAATGGG - Intronic
1022836748 7:34124473-34124495 ATGGATTAGCATTGTGAAGTGGG + Intronic
1022892137 7:34712307-34712329 ATGGAAAAGTAGAGTGGAGAAGG - Intronic
1024104164 7:46064922-46064944 GTGGAGAATCATTGTGCAGTGGG + Intergenic
1025037729 7:55608595-55608617 ATGTGGAAGAAAAGTGGAGTGGG + Intergenic
1025045390 7:55688162-55688184 GTGGAGAAGCATAGTGGAATGGG + Intergenic
1026433120 7:70367984-70368006 AAAGAGAAGCAAAGTGGAGTGGG + Intronic
1027297125 7:76788197-76788219 ATGGAGAAGAGAAGTGGAGTGGG - Intergenic
1027631603 7:80612771-80612793 ATGTATAAGCATTGTGGAATGGG + Intronic
1028091579 7:86709282-86709304 ATGGAGCAGTGTGGTGGAGTTGG - Intronic
1028407285 7:90489731-90489753 ATAAAGAACCAAAGTGGAGTAGG + Intronic
1028591357 7:92499062-92499084 ATTGAGAAACATAATGGTGTTGG + Intronic
1034111793 7:148544385-148544407 CTGGAGAAACATAGTGTATTTGG - Intergenic
1035890197 8:3335139-3335161 AGAGAGAAACATAGTGGTGTAGG - Intronic
1038947819 8:32380591-32380613 ATGTAGAAGCACAGGGGAGGTGG - Intronic
1039233195 8:35472213-35472235 ATGGTGAAGCAGAGTTGTGTAGG + Intronic
1039406309 8:37315714-37315736 GTGGCGAAGCATGGTGGAGCTGG + Intergenic
1040287367 8:46107280-46107302 ATGGAGATGCAGCGTGGAGTGGG - Intergenic
1040287489 8:46107923-46107945 ATGGAGCAGCAGTGTGGCGTGGG - Intergenic
1040302909 8:46197203-46197225 ACGGGGCAGCACAGTGGAGTGGG + Intergenic
1040305965 8:46211910-46211932 ACGGTGACGCAGAGTGGAGTGGG + Intergenic
1040306691 8:46215591-46215613 ACGGCGACGCAGAGTGGAGTGGG + Intergenic
1040307843 8:46221444-46221466 ATGGAAAAGCAGGGTGGCGTAGG + Intergenic
1040334434 8:46408879-46408901 ACGGAGAGGCAGAGTGAAGTGGG + Intergenic
1040336592 8:46419177-46419199 GTGGAGATGCAGAGTGGAGTGGG + Intergenic
1044036431 8:87309309-87309331 ATGGAGAAGCAGAGATGATTTGG - Intronic
1046151485 8:110232108-110232130 ATGGAGAAAGATGGTGGAGAGGG + Intergenic
1046545158 8:115640409-115640431 ATGGGGAGGCATTGTGGAGTAGG - Intronic
1046727711 8:117692766-117692788 ATGGAAAAACAGAGTGGAGCAGG - Intergenic
1049265502 8:141665869-141665891 ATGGAGAAGCTGAGTGGAGGAGG + Intergenic
1049886420 9:29777-29799 ATGGGGAAGCAAGGCGGAGTTGG + Intergenic
1050579818 9:7041471-7041493 ATTGAGAAGCAAACTGGAATTGG - Intronic
1051386003 9:16509530-16509552 ATGGATATGCACAGAGGAGTCGG - Intronic
1053245574 9:36531981-36532003 AAGAAGAAGAATAGTGGAATGGG + Intergenic
1055157088 9:73077396-73077418 ATAGAGAATGATAGTGGAGAAGG + Intronic
1058491109 9:105500460-105500482 ATGGAGTAGCTCATTGGAGTTGG + Intronic
1058703921 9:107623448-107623470 ATGAAGAAGAAAAGTGGTGTTGG - Intergenic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1059729674 9:117044414-117044436 ATGGAGCAGCAGAGGGGTGTGGG + Intronic
1060019171 9:120114327-120114349 TTGGAGAAGCCAAGTGGAGCAGG - Intergenic
1060341757 9:122783517-122783539 CTTGAGAAGCACAGTGGAGAGGG + Intergenic
1060497917 9:124131405-124131427 ATGGGGAAGCAGAGGGGAGCGGG + Intergenic
1186124112 X:6394214-6394236 ATGGAGATGGATATAGGAGTAGG - Intergenic
1186581660 X:10826149-10826171 ATCTAGAAGGATAGTGGTGTAGG - Intronic
1186812133 X:13200704-13200726 ATTGAGATGCATTTTGGAGTTGG - Intergenic
1187311666 X:18150225-18150247 ATGGAGAAATATATTGGATTTGG + Intergenic
1187596821 X:20782553-20782575 ATGGAAATACATAGTGAAGTTGG + Intergenic
1188444675 X:30243849-30243871 ATGGAGAGCCAAAGGGGAGTTGG + Exonic
1193426826 X:81349624-81349646 ATGGTGATGCATGGTGGAGAAGG + Intergenic
1195758196 X:108220058-108220080 CTGTAGAAGCATAATGGAGAGGG - Intronic
1197039605 X:121920589-121920611 GTGGAGTAGCAGTGTGGAGTAGG + Intergenic
1198009065 X:132531834-132531856 ATGGAAAAGAATATTGGATTTGG - Intergenic
1198840833 X:140855939-140855961 ATGGTGAAGCATAGTGCTGTAGG - Intergenic
1201107779 Y:10776245-10776267 ATGGAAAAGCATAGAGAAGAAGG - Intergenic