ID: 1147674019

View in Genome Browser
Species Human (GRCh38)
Location 17:42192686-42192708
Sequence CTGAGCCAGCACTTCTGGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147674012_1147674019 13 Left 1147674012 17:42192650-42192672 CCAAGGGGATGTAAGCGTCACAC 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1147674019 17:42192686-42192708 CTGAGCCAGCACTTCTGGGTAGG 0: 1
1: 0
2: 1
3: 25
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147674019 Original CRISPR CTGAGCCAGCACTTCTGGGT AGG Exonic
900999327 1:6140448-6140470 CTGACCCAGCAGTGCTGGGGTGG - Intronic
901138550 1:7013136-7013158 CCGTGCCAGCACTTCTCGCTGGG + Intronic
902941513 1:19803291-19803313 GTGAGCCACCACTCCTGGGCAGG - Intergenic
903312824 1:22473215-22473237 CTGATTCAGAAGTTCTGGGTGGG - Intronic
903490920 1:23727765-23727787 CTGAGCCAGCACGCCTGAGGTGG - Intergenic
904501027 1:30913009-30913031 CTGAGACAGCACTTGTGTTTGGG - Intergenic
905396690 1:37670868-37670890 CTGAGCCACCACTCCTGGCCTGG - Intergenic
905537142 1:38731150-38731172 CTGATTCAGCAGGTCTGGGTGGG - Intergenic
907506913 1:54925825-54925847 CTGATGCAGGACTTCTGGGTGGG + Intergenic
907946616 1:59141446-59141468 CTCAGCAAGCACTTGTGGCTGGG - Intergenic
907960700 1:59278141-59278163 CTTACCCATCATTTCTGGGTTGG + Intergenic
912253930 1:108039852-108039874 CTGAATCAGCAATTCTGGGACGG + Intergenic
912840051 1:113031308-113031330 CTGACACACAACTTCTGGGTGGG + Intergenic
913124723 1:115774874-115774896 ATGAGCCACCACATCTGGCTGGG - Intergenic
913393199 1:118337359-118337381 AAGAGGCAGAACTTCTGGGTTGG - Intergenic
914044569 1:144079868-144079890 CTGAGCAAGCCCTCCTGTGTGGG + Intergenic
914133541 1:144880818-144880840 CTGAGCAAGCCCTCCTGTGTGGG - Intergenic
915520220 1:156437450-156437472 CTGACCCACCAAATCTGGGTTGG - Intergenic
917176330 1:172239669-172239691 CACAGAGAGCACTTCTGGGTTGG + Intronic
917652826 1:177095861-177095883 ATGAGGCAGCTCTCCTGGGTTGG - Intronic
918181238 1:182087280-182087302 CAGAGGCAGAACTTCTGGTTGGG + Intergenic
919794744 1:201314653-201314675 CTGAGCCTGCCCTTCAGGGCTGG + Intronic
919834411 1:201563810-201563832 GTGAGCCACCACTTCTGGCCAGG - Intergenic
920222719 1:204416002-204416024 ATGAGCCAGCACACCTGGCTGGG + Intergenic
920288204 1:204897064-204897086 CTGAATCAGCATGTCTGGGTCGG - Intronic
923001647 1:230011203-230011225 CTGAGTCAGGAATTCTGGGATGG - Intergenic
1063274536 10:4550785-4550807 CTGAGTCAGTAGGTCTGGGTTGG - Intergenic
1063498422 10:6531133-6531155 CTCACCCAGCAGCTCTGGGTGGG - Intronic
1064079502 10:12297007-12297029 CTGATTCAAAACTTCTGGGTTGG + Intergenic
1066310159 10:34188280-34188302 CTAAGTAAGCACTGCTGGGTTGG + Intronic
1066956697 10:42179555-42179577 CTGAGCAAGCCCTCCTGTGTGGG + Intergenic
1069532441 10:69229333-69229355 CTGTGCCCTCACTTGTGGGTAGG + Intronic
1069988686 10:72300779-72300801 GTGGGCCGGCACTGCTGGGTGGG - Intergenic
1070272400 10:74968979-74969001 CTGAGGCCACACTTCTTGGTGGG + Intronic
1070487270 10:76942979-76943001 CTGACCCAGCAGGTCTGGGATGG + Intronic
1070508665 10:77140111-77140133 CTCACCCAGCACATCTGCGTTGG + Intronic
1071498833 10:86189419-86189441 CTGTGTCAGGACTTCTGGGATGG - Intronic
1071519035 10:86317628-86317650 CTCAGCCAGTGCTTCTGGCTGGG + Intronic
1071792141 10:88966099-88966121 CTGAGCCAGGATTTCTGGCATGG + Intronic
1072635796 10:97177051-97177073 CAGAGCCAGCACCTCTAGGATGG + Intronic
1072658274 10:97345914-97345936 GTGAGCCACCACTTCTGGCCAGG - Intergenic
1072745314 10:97935498-97935520 CTGACTCAGCAGGTCTGGGTGGG - Intronic
1073009686 10:100349404-100349426 GTGAGCCAGGACTTCTGGTGTGG + Intronic
1073716808 10:106116467-106116489 CTGGGCATGCAATTCTGGGTTGG - Intergenic
1074238203 10:111607613-111607635 ATGAGCCACCACTTCTGGCCAGG + Intergenic
1074824616 10:117205765-117205787 GTGAGCCACCACTTCTGACTTGG - Intronic
1074923845 10:118046892-118046914 CTGCGGCGGCACTTCCGGGTTGG + Intergenic
1075056263 10:119220869-119220891 ATGAGCCACCACTTCTGGCCTGG - Intronic
1075324343 10:121518788-121518810 CAGAGCCAGCACTTCTGCATTGG + Exonic
1076540603 10:131212133-131212155 CTTAGCCTGCACTTTTGGGCAGG - Intronic
1077251374 11:1562161-1562183 CTCACCCAGCACTGGTGGGTGGG - Intronic
1077251800 11:1564046-1564068 TTGAGCCAGCATATCTGGGACGG - Intronic
1077910558 11:6568656-6568678 CTGAGTCAGCACAGCTGGGGAGG - Exonic
1078450728 11:11438674-11438696 CACTGTCAGCACTTCTGGGTGGG - Intronic
1080675254 11:34420556-34420578 CTTAGCCTGTCCTTCTGGGTTGG + Intergenic
1082177698 11:49080901-49080923 GTGAGCCACCACTCCTGGGCAGG - Intergenic
1082221467 11:49643515-49643537 CTGAGTCAGTAGATCTGGGTTGG + Intergenic
1083620683 11:64048010-64048032 CTGAGCCACCACTTCAGAGTGGG + Intronic
1084317359 11:68353390-68353412 CAGAGTCAGCACCTCAGGGTAGG - Intronic
1084738215 11:71119741-71119763 CTGATTCAGCAGGTCTGGGTGGG + Intronic
1084931826 11:72562065-72562087 CTGAGCCAGGCCTTGTGGATAGG + Intergenic
1085216654 11:74838753-74838775 CAGAGCCAGCTCTTCTGTTTTGG - Exonic
1085792136 11:79505290-79505312 CAGAGCCAGAATGTCTGGGTTGG - Intergenic
1086627573 11:88975637-88975659 CTGAGTCAGTAGATCTGGGTTGG - Intronic
1086688022 11:89754975-89754997 GTGAGCCACCACTCCTGGGCCGG + Intergenic
1086717827 11:90084926-90084948 GTGAGCCACCACTCCTGGGCCGG - Intergenic
1087073648 11:94107028-94107050 CTGATTCAGCAGGTCTGGGTCGG - Intronic
1088174361 11:107034228-107034250 CTTTGCGAGCACTTTTGGGTTGG - Intergenic
1088593856 11:111425232-111425254 CAGTGGCAGCATTTCTGGGTAGG + Intronic
1088923827 11:114281032-114281054 CTGGGCCAGCAGGTCTGGGTTGG - Intronic
1089510959 11:118996948-118996970 CTGATTCAGTAGTTCTGGGTTGG + Intergenic
1090277628 11:125431099-125431121 CAGGGCCAGCACCTCTGTGTTGG - Intronic
1090287469 11:125512262-125512284 CTGCCCCAGCCCCTCTGGGTCGG - Intergenic
1090387895 11:126367127-126367149 GTGTGCCAGCCCTTCTGGGAAGG + Intronic
1090390533 11:126384573-126384595 GTGTGCCAGCCCTTCTGGGAAGG + Intronic
1096503686 12:52080352-52080374 CTGATCCCGCACACCTGGGTGGG - Intergenic
1096558088 12:52416117-52416139 CTGAGCCAGCTTTTGTGGTTGGG + Intergenic
1097186021 12:57196910-57196932 CTGAGCCAGGTCTCCAGGGTGGG + Intronic
1097689512 12:62721378-62721400 CTGAGCAAGTAATTCTGGGCAGG + Intronic
1097964086 12:65560535-65560557 ATAAGACAGCACTTGTGGGTAGG - Intergenic
1099023643 12:77438074-77438096 CTGAGCATACACCTCTGGGTGGG - Intergenic
1101829864 12:108248807-108248829 CGGTGCCAGCACTTCTTGGGTGG - Exonic
1102150268 12:110684830-110684852 CAGAGCGACCACTTCTGGGAAGG - Intronic
1102319608 12:111920178-111920200 GTGAGCCACCACTCCTGGCTGGG - Intergenic
1102573548 12:113842257-113842279 CTGAGCCTGCACTCCTCGGCTGG + Intronic
1103370860 12:120418236-120418258 CTGATGCAGCAGTTCTGGGGCGG + Intergenic
1104153614 12:126109144-126109166 CTGACCCAGCACCTTTGAGTGGG + Intergenic
1104403934 12:128501926-128501948 CTGAGTCAGTAGTTCTGGGGAGG + Intronic
1104676178 12:130713996-130714018 CTGATCCAGCAGGTCTGGGGAGG - Intronic
1104898096 12:132174003-132174025 CTGAGCCCCCACTGCTGGCTGGG + Intergenic
1106901436 13:34358108-34358130 CTGATTCAGCAGGTCTGGGTGGG - Intergenic
1107742831 13:43471526-43471548 GTGAGCCACCACTTCTGGCTTGG - Intronic
1108012994 13:46040032-46040054 CTGAATCAGAATTTCTGGGTTGG - Intronic
1108457558 13:50631798-50631820 CTGAGCCACCACATCTGGCCTGG - Intronic
1109199011 13:59410418-59410440 GTGAGCCACCACGTCTGGCTGGG - Intergenic
1110282007 13:73704757-73704779 CTGAGTCGGCACTGCTGAGTCGG - Intronic
1112304469 13:98261242-98261264 CTCTGCCAGCACTTCTCTGTGGG - Intronic
1112465014 13:99636438-99636460 CAGTGCCAGCACATCTGGGCTGG + Intronic
1112720547 13:102239410-102239432 CTGACTCAATACTTCTGGGTTGG + Intronic
1112990403 13:105506551-105506573 CTGATTCAGCAGGTCTGGGTGGG + Intergenic
1117375904 14:55118030-55118052 CTGAGGCAACTCTTCTAGGTTGG + Intergenic
1118253513 14:64184523-64184545 CCGAGCCAGCACCTCTGAGCAGG + Intronic
1119645661 14:76346577-76346599 CTGAGCCTGGATTTCTGGCTGGG + Intronic
1121762285 14:96455954-96455976 GTGAGCCACCACGTCTGGCTGGG - Intronic
1121837779 14:97107284-97107306 CTGATTCAGCAGCTCTGGGTGGG + Intergenic
1123686704 15:22803237-22803259 ATGAGCCACCACATCTGGCTGGG + Intronic
1127380870 15:58429560-58429582 CTGAGCAAGGACTTCTGCCTTGG - Intronic
1128232259 15:66043624-66043646 CAGGGCCAGTTCTTCTGGGTAGG - Intronic
1132352444 15:101148489-101148511 CTGAGCCTGCACAGCTGGGAGGG + Intergenic
1132785815 16:1656541-1656563 AGGAGCCAGCACCTCTGGGGAGG - Exonic
1133974414 16:10590387-10590409 CTGAGCCACCAAGGCTGGGTGGG - Intergenic
1134343152 16:13363925-13363947 CTGATCCAGCAGGTCTGGGAGGG - Intergenic
1135602806 16:23797579-23797601 GTGAGCCAGCAATCCAGGGTGGG + Intergenic
1136281420 16:29213668-29213690 CTGACTCAGCAGGTCTGGGTGGG - Intergenic
1136605103 16:31328253-31328275 CTGAGCCTCCACTTCTGGGCTGG + Intronic
1137604647 16:49779468-49779490 CTGACTCAGCAGGTCTGGGTAGG - Intronic
1138428609 16:56953062-56953084 CAGAGCCAGGATTTCTGGGAGGG - Intergenic
1138683331 16:58703348-58703370 GTGAGCCACCACTCCTGGCTTGG + Intergenic
1139503018 16:67383478-67383500 CTGAGTCAGCAGGTCTGGGTTGG + Intronic
1139683304 16:68582051-68582073 CTGATCCAGCATGTCTGGGCTGG + Intergenic
1139747269 16:69084701-69084723 CTGATCAAGCATCTCTGGGTTGG - Exonic
1140900300 16:79360814-79360836 CTGAGTCATCCCTGCTGGGTGGG - Intergenic
1141238658 16:82244101-82244123 CTGATTCAGCAATTCTGGGGTGG + Intergenic
1142085790 16:88179596-88179618 CTGACTCAGCAGGTCTGGGTGGG - Intergenic
1142572650 17:885052-885074 CTGAGTCAGGCCTCCTGGGTGGG + Intronic
1143018725 17:3905206-3905228 CTGAGCCAGCTCACCTGGGCTGG + Exonic
1144273643 17:13643950-13643972 CTGACCCAGCAGGTCAGGGTGGG - Intergenic
1145917654 17:28585376-28585398 CTGAACCAGCTCTTCTTGCTTGG + Exonic
1146195399 17:30808211-30808233 CTGATTTAGCAGTTCTGGGTGGG - Intronic
1147674019 17:42192686-42192708 CTGAGCCAGCACTTCTGGGTAGG + Exonic
1147793811 17:43028791-43028813 CAGAGCGAGCAATTCTGGGCAGG + Exonic
1147877950 17:43634817-43634839 CTGAGCCAGCAGCTCCGGTTAGG + Intergenic
1148459393 17:47829959-47829981 CTGAATCAGCAATTCTGGGGTGG + Intronic
1148504139 17:48114136-48114158 GTGAGCCACCACTCCTGGCTGGG + Intronic
1148966968 17:51443836-51443858 CTGAGCCACCACTTCTGCCTTGG + Intergenic
1149209317 17:54286168-54286190 CAGAGCTTGGACTTCTGGGTTGG + Intergenic
1150638671 17:66934400-66934422 GTGATCCTGCACTTCTGGGCAGG + Intergenic
1152140721 17:78534851-78534873 CTGACCCAACTCCTCTGGGTTGG + Intronic
1152263916 17:79282472-79282494 TTGAGCCAGCAGTTCAGGCTGGG - Intronic
1152527948 17:80900235-80900257 CTGAGCCAGCAGCTCTGGCCTGG + Intronic
1152777885 17:82213573-82213595 CTCAGCCCGCAATTCTGCGTGGG + Intergenic
1153665025 18:7360696-7360718 CTGAGCATGGAGTTCTGGGTGGG + Intergenic
1154009780 18:10564783-10564805 ATGGGCCAGCACCCCTGGGTGGG - Intergenic
1156007818 18:32464367-32464389 CTGAGCCACCACATCTGGCCAGG - Intronic
1156530424 18:37809603-37809625 ATGAGCCAGCATTGCAGGGTAGG - Intergenic
1156594629 18:38533458-38533480 CCTAGCCAGAAATTCTGGGTAGG - Intergenic
1158278711 18:55796993-55797015 TTGAGCCAGGATTTCAGGGTGGG - Intergenic
1158987118 18:62829467-62829489 GTGAGCCACCACGCCTGGGTTGG - Intronic
1160689115 19:452830-452852 CTGACCCAGCAGGTCTGGGGTGG + Intronic
1162451395 19:10757289-10757311 CTGTCCCACCACTTCTGGCTGGG - Intronic
1163262640 19:16200365-16200387 ATTAGCCAGGACTTCTGGCTTGG - Intronic
1164566079 19:29327025-29327047 CTGAGCCAGCACACCTGGCCAGG + Intergenic
1164844851 19:31423297-31423319 CTGGGCCAGGACTTCTGGGGAGG + Intergenic
1166109109 19:40611953-40611975 CGGAGCCAGCAGTGTTGGGTTGG - Exonic
1166898519 19:46040067-46040089 CAGAGACTGCACATCTGGGTGGG + Intronic
1168119230 19:54242423-54242445 AGGAGACAGCAGTTCTGGGTGGG - Intronic
1168348907 19:55664613-55664635 CTGAGTCAGCTCTTCAGGGCAGG + Intronic
1202684128 1_KI270712v1_random:33287-33309 CTGAGCAAGCCCTCCTGTGTGGG + Intergenic
925593180 2:5530040-5530062 CTGAGCCTGCGATTCTGGGACGG - Intergenic
926545423 2:14234043-14234065 CTGAGCCGGGAGTTTTGGGTTGG - Intergenic
926699813 2:15796218-15796240 CTGAGACAGCCTTGCTGGGTGGG + Intergenic
927820564 2:26260361-26260383 GTGAGCCAGCACGCCTGGCTTGG + Intronic
928312928 2:30225209-30225231 CTGAGCTAGCACTTGCTGGTTGG - Intergenic
928397967 2:30957605-30957627 CTGAGGCAGCACCAATGGGTAGG + Intronic
930153272 2:48079527-48079549 CTGATTCAGTAGTTCTGGGTGGG + Intergenic
930339364 2:50093331-50093353 GTGTGCCATCACTTCTGGCTGGG - Intronic
931055320 2:58462963-58462985 TTGACCCAGCACTTTTGGATGGG - Intergenic
931825939 2:66001088-66001110 CTGACTCAGTAGTTCTGGGTGGG - Intergenic
932142909 2:69295267-69295289 CTGATCCAGTAGGTCTGGGTAGG - Intergenic
932734147 2:74242580-74242602 CTGGGCCAGCCTTTCTGGGATGG - Intronic
934247593 2:90321565-90321587 CTGAGCAAGCCCTCCTGTGTGGG - Intergenic
934261731 2:91481036-91481058 CTGAGCAAGCCCTCCTGTGTGGG + Intergenic
934304772 2:91812015-91812037 CTGAGCAAGCCCTCCTGTGTGGG + Intergenic
934328485 2:92040735-92040757 CTGAGCAAGCCCTCCTGTGTGGG - Intergenic
935245099 2:101212042-101212064 ATGAGCCACCACTTCTGGCCAGG + Intronic
937067144 2:119026053-119026075 ATGCGCGGGCACTTCTGGGTAGG + Intergenic
937076340 2:119109914-119109936 CTGACTCAGCATGTCTGGGTGGG - Intergenic
937252368 2:120533112-120533134 CCGAGGCAGCAGGTCTGGGTGGG + Intergenic
937377764 2:121349346-121349368 CTGAGTGAGCAGGTCTGGGTGGG - Intronic
937914236 2:127091192-127091214 CTCAGTGGGCACTTCTGGGTGGG - Intronic
938061460 2:128258384-128258406 CTGAGCCAGCAATGCTGAGGGGG - Intronic
945083413 2:206108395-206108417 ATGAGCCACCACGTCTGGCTAGG + Intergenic
945208397 2:207356784-207356806 CTGAGACAGCAATTCTGTTTGGG - Intergenic
946393169 2:219428862-219428884 CTGAGCCAGCTTCTCTGTGTTGG + Intergenic
947182520 2:227424127-227424149 CTGATTCAGCAGTTCTGGGAGGG - Intergenic
947534832 2:230933974-230933996 CTGACCCAGCACCTCTGGGGTGG - Intronic
948677770 2:239609161-239609183 CTGAGTCAGAAACTCTGGGTTGG + Intergenic
1168842499 20:918426-918448 TGGAGCCAGCACATCTGGATCGG + Intergenic
1168961968 20:1876198-1876220 CAGACCCAGCACTTCTGGGGAGG + Intergenic
1169205868 20:3740116-3740138 CTGAGCCAGCATTTCAGGGCAGG - Intronic
1169698119 20:8414903-8414925 CTGAGTCAGTAGGTCTGGGTGGG - Intronic
1169749002 20:8972845-8972867 CTGATTCAGCACTTCTGGGAAGG - Intergenic
1169787541 20:9376244-9376266 CTGACTCAGCAGGTCTGGGTGGG - Intronic
1170138473 20:13101766-13101788 CTGAGTGAGCAGGTCTGGGTGGG + Intronic
1170816148 20:19716103-19716125 CTGATTCAGGAGTTCTGGGTGGG + Intronic
1171749448 20:29034480-29034502 GTGGGTCAGCACTTCTGTGTAGG + Intergenic
1172310949 20:33917953-33917975 CTGATCCAGCAGGTCTGGGGTGG + Intergenic
1172594785 20:36143227-36143249 CTGAGCCAGGGCTTTGGGGTGGG + Intronic
1172619140 20:36307799-36307821 CTGAGCCCTCACTTGTGGGAGGG + Intronic
1172699605 20:36845166-36845188 CTGATTCAGCAAGTCTGGGTTGG - Intronic
1173843739 20:46175162-46175184 CTGGGCCCGCTCTGCTGGGTGGG - Intronic
1175318054 20:58065638-58065660 CTGATTCAGCAGGTCTGGGTGGG - Intergenic
1175531851 20:59678941-59678963 CTGAGTTAGCAGGTCTGGGTGGG + Intronic
1176587078 21:8597394-8597416 CTGAGCAAGCCCTCCTGTGTGGG + Intergenic
1177441438 21:21131553-21131575 ATGAGCCACCACTCCTGGCTGGG + Intronic
1177775309 21:25560624-25560646 CGGAGCCAGCCCTCCAGGGTTGG + Intergenic
1178906857 21:36643650-36643672 GTGAGCCAGCACACCTGGCTGGG + Intergenic
1179452600 21:41475893-41475915 CTGAGCCAGCCCTGCCGGGATGG + Intronic
1180151067 21:45948226-45948248 ATGGGCCAGCACTTCTGTGACGG - Intergenic
1180255209 21:46622302-46622324 CTGGGCCTGCACTTCTGGAAGGG - Intergenic
1180269907 22:10574391-10574413 CTGAGCAAGCCCTCCTGTGTGGG + Intergenic
1180406219 22:12557610-12557632 GTGGGTCAGCACTTCTGTGTAGG + Intergenic
1182680436 22:32075192-32075214 GTGAGCCACCACATCTGGCTGGG + Intronic
1183694697 22:39415147-39415169 GTGTGCCAGCATTTCTGTGTTGG + Intronic
1183727912 22:39599678-39599700 CTGAAGCAGAATTTCTGGGTGGG + Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1185027949 22:48426248-48426270 CTGAGCAAGCACACCTGGGCAGG + Intergenic
1185129526 22:49031086-49031108 CTGGGCCAGCATTTCCGGGAAGG - Intergenic
949492989 3:4607219-4607241 CTGATGCAGCAAGTCTGGGTGGG - Intronic
950099559 3:10348541-10348563 CTGGGCCAGGACCTCGGGGTGGG - Intronic
950423251 3:12910903-12910925 CTGAGCCAGTCCTCCTGGGCTGG - Intronic
951130954 3:19044424-19044446 CTGACCCAGTAGTTCTGGGGTGG + Intergenic
951522187 3:23620421-23620443 CTGAGGCAGCAGGTCTGGGGTGG - Intergenic
951620010 3:24591388-24591410 CTGATTCAGCAGATCTGGGTTGG - Intergenic
952325094 3:32313655-32313677 CTGACCCAGTAGTTCTGGGATGG - Intronic
952327939 3:32337683-32337705 CTGAATCAGCATTTCTGGGAAGG - Intronic
953156880 3:40383682-40383704 CTGAGCCAGGATTTCTCAGTTGG - Intergenic
953243426 3:41169474-41169496 CAGAACCAGCACTTGTGGGCTGG + Intergenic
953391329 3:42535563-42535585 CTAAGCCAGCAGGTCTGGGGTGG - Intronic
953419409 3:42742781-42742803 CTGAGCCACCCCTTCTAGGCAGG - Intronic
953699366 3:45184053-45184075 CTGAGCCAGTACTTAGGGCTGGG - Intergenic
953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG + Intergenic
953807720 3:46085855-46085877 CTGATTCAGCATGTCTGGGTTGG - Intergenic
953831167 3:46298623-46298645 CTGATTCAGCAGGTCTGGGTTGG - Intergenic
954632399 3:52054775-52054797 CTTAGCCAGCACCTCTGGGTTGG + Intronic
954716594 3:52529908-52529930 CAGAGCCAGCCCCTCTGGGTTGG - Intronic
954926415 3:54239552-54239574 CTGATCCAACACTTTTGGCTTGG - Intronic
955991451 3:64632156-64632178 CTGATCCAGTAGATCTGGGTGGG - Intronic
956749427 3:72334381-72334403 CTGAGGCAGCTCCACTGGGTTGG - Intergenic
957112638 3:75984773-75984795 CTAAGCCAGATTTTCTGGGTTGG - Intronic
957337992 3:78857627-78857649 CTGAGTCAGCAGGTCTGGGGTGG - Intronic
959357702 3:105353755-105353777 CTGACCCAGGACCGCTGGGTGGG - Intergenic
959392348 3:105792104-105792126 CTGAGTCAGCAATTCTGGGGTGG - Intronic
959874338 3:111364125-111364147 CAGAGCCTGGGCTTCTGGGTAGG - Intronic
960669890 3:120145740-120145762 CTGATTCAGCAGATCTGGGTGGG + Intergenic
961243721 3:125433957-125433979 CTGAGTCAGCAGGTCTGGTTGGG + Intergenic
961383378 3:126510172-126510194 CAGACCCAGCAGTTCTGGGGTGG - Intronic
962088176 3:132213845-132213867 GTGAGCCACCACGTCTGGCTTGG - Intronic
962417125 3:135193278-135193300 CTGAGGAGGCACTTCTGAGTAGG + Intronic
964663526 3:159148009-159148031 CTGATTCAGCAGTTCTGGGGTGG - Intronic
965788175 3:172358606-172358628 CTGTGCCAGCACTGTTGGGATGG + Intronic
967972881 3:195012243-195012265 CAGAACCAGCCCTTCTGGATGGG + Intergenic
969319867 4:6405246-6405268 CTGAGCCAGCTCTGCTGTGCGGG - Intronic
969495357 4:7523194-7523216 CTGAGCCTGCCCTTCTGGGGAGG - Intronic
969867451 4:10084977-10084999 CAGGGCCAGCACTCCTGGGCAGG - Intronic
970450056 4:16157411-16157433 CTGATTCAGCACATCTGGGCAGG + Intergenic
971450528 4:26796549-26796571 ATGAACCACCACTCCTGGGTAGG - Intergenic
971854609 4:32027077-32027099 ATGAGCAAGCACTTCTGGAATGG + Intergenic
972330774 4:38062851-38062873 CTGAGCCAGTGCTGCTTGGTAGG + Intronic
972594617 4:40518910-40518932 GTGAGCCACCACTCCTGGGCTGG - Intronic
975754702 4:77561267-77561289 CTGATCCTGCATATCTGGGTGGG - Intronic
976195527 4:82528323-82528345 CTGAGCCAGAACTTCAGAGGTGG - Intronic
977089608 4:92653701-92653723 GTGAGCCAGCAGATTTGGGTGGG + Intronic
977768734 4:100831509-100831531 TGGAGCCAGCACTTGAGGGTAGG + Intronic
978083093 4:104618683-104618705 CACAGCCAGCACTGCAGGGTTGG - Intergenic
978170011 4:105658682-105658704 CAGAGCCAGCACTTGAGGGTAGG - Intronic
978377482 4:108090476-108090498 CTTAGTAAGCACTTTTGGGTTGG - Intronic
983168913 4:164513504-164513526 CTGAGCTAGCACATAGGGGTGGG + Intergenic
983567932 4:169174433-169174455 CTGATTCAGTACCTCTGGGTGGG + Intronic
983993297 4:174149513-174149535 CTGAGCCATCACTTCTGTTAAGG + Intergenic
984084818 4:175295723-175295745 CTGAGCCACCACACCTGGCTGGG + Intergenic
984796556 4:183665610-183665632 CTGAGCCAGCACAGCTGATTTGG + Intronic
984802105 4:183724991-183725013 CTGTGCCTGCCCTTCTGGGCTGG - Intergenic
985116036 4:186591990-186592012 CTGATCCAACAGGTCTGGGTTGG - Intronic
985431384 4:189884361-189884383 GTGGGTCAGCACTTCTGTGTAGG + Intergenic
985622603 5:963312-963334 CCGAGGCAGCACCTCTGGCTTGG + Intergenic
988801269 5:34698577-34698599 CTGAGCCATCACGATTGGGTAGG + Intronic
988976513 5:36521662-36521684 CTGAGCCAGAATCTCTGGGAGGG + Intergenic
990758534 5:59102742-59102764 CTGATTCAGTACTTCTGGGGTGG - Intronic
993132224 5:83913094-83913116 CTGATTCAGCATTTCTGGATTGG + Intergenic
994993885 5:107034851-107034873 CTGATTCAGTACCTCTGGGTGGG - Intergenic
995445839 5:112242929-112242951 ATGAGCCACCACTCCTGGGCCGG - Intronic
996540639 5:124627752-124627774 CTGTGCCAGCAATTGTGGGGTGG - Intergenic
998424512 5:142014941-142014963 CTGAGACAACATTTCTGGCTGGG - Intergenic
998453103 5:142249859-142249881 CTGGCCCAGCAGGTCTGGGTTGG - Intergenic
998743119 5:145227785-145227807 CTGAGCCTGCACTTCAGCCTGGG - Intergenic
999810434 5:155122030-155122052 CTGAGCAAGCACCTCTTGGAGGG + Intergenic
1000973107 5:167736663-167736685 CTGAGCCAGGGCTTCTGTGGAGG - Intronic
1001277494 5:170361185-170361207 CTCCTCCTGCACTTCTGGGTGGG - Intronic
1003492055 6:6631602-6631624 CTGATTCAGTACGTCTGGGTAGG - Intronic
1003532468 6:6949069-6949091 GTGAGCCACCACATCTGGCTTGG + Intergenic
1003570706 6:7254657-7254679 CTGACTCAGCAGGTCTGGGTGGG - Intergenic
1005978464 6:30817870-30817892 TTGATCCATCACTTCTGGTTTGG - Intergenic
1006138411 6:31911583-31911605 CTGAGTCAGTAGGTCTGGGTGGG + Intronic
1006522445 6:34579044-34579066 GTGAGCCACCACATCTGGCTGGG - Intergenic
1007060491 6:38936064-38936086 ATGAGCCACCACGTCTGGCTTGG - Intronic
1007801283 6:44395683-44395705 CTGAGTCAGTACATCTGGGGTGG + Intronic
1015502380 6:133947792-133947814 CTGAGCAAGCACTGGTTGGTTGG + Intergenic
1017786579 6:157761851-157761873 CAGGGCCAGCACATCTGGGGAGG + Intronic
1018080178 6:160252723-160252745 CTGATCCAGCAGATCTGGGTGGG - Intronic
1018172072 6:161151461-161151483 CTGATCCATCCCCTCTGGGTTGG - Intronic
1018411590 6:163554292-163554314 CTCATCCAGCTCTTCAGGGTCGG + Intronic
1018952136 6:168386144-168386166 CTGAGCAGGCACACCTGGGTGGG - Intergenic
1019491065 7:1313864-1313886 CTGGGCCAGCACTTCGGGGCTGG + Intergenic
1020382060 7:7557496-7557518 CAGAGGCAGCACCGCTGGGTGGG - Intergenic
1021195697 7:17672052-17672074 CTAAGCCATCACTTCTAGTTAGG - Intergenic
1022853740 7:34294948-34294970 CTGATTCAGTAGTTCTGGGTGGG + Intergenic
1023602161 7:41890798-41890820 CTGGTCCAGGAGTTCTGGGTGGG + Intergenic
1023711926 7:43003940-43003962 CTCAGCCACCTCTTTTGGGTTGG + Intergenic
1024688787 7:51777315-51777337 CAGAGCCAGCACTTCTAGCTAGG + Intergenic
1027431969 7:78123841-78123863 CTGATTCAGCAGTTTTGGGTGGG + Intronic
1028476970 7:91264357-91264379 CTGAGCCTCCAGTTCTGCGTCGG + Exonic
1029701101 7:102247539-102247561 ATGAGCCACCACTTCTGGCCAGG - Intronic
1030084873 7:105807460-105807482 CTGACGCGGCACTCCTGGGTAGG + Intronic
1030631195 7:111897674-111897696 CTGAGCCAGCACTGGGGGGTGGG - Intronic
1031843230 7:126772454-126772476 CTGACCCAGCAAGTCTGGGGTGG - Intronic
1031889067 7:127273425-127273447 CTAAACCAGCACTTCTGGAGTGG + Intergenic
1032013294 7:128360509-128360531 GGGCGCCAGCACTTCTGGCTGGG - Intronic
1033257724 7:139816640-139816662 CTGATTCAGTAATTCTGGGTTGG - Intronic
1035916804 8:3634046-3634068 CTGACTCAGCACATCTGGGTAGG + Intronic
1036614618 8:10378736-10378758 CTGAGCCAGAAGTTCTGGGGTGG - Intronic
1036744006 8:11391186-11391208 CTGACCCAGCAGGTCTGGGTGGG - Intronic
1037444975 8:18956329-18956351 CTGATCCAGCAGGTCTGGGGTGG + Intronic
1037885450 8:22593815-22593837 ATGCGCGGGCACTTCTGGGTGGG + Exonic
1039273887 8:35913788-35913810 CTGAGTCAGTAGGTCTGGGTTGG + Intergenic
1041349354 8:56933201-56933223 CTGAGTCAGTAATTCTGGGGTGG + Intergenic
1044540692 8:93405512-93405534 CTGAGCCAGCACTGCTTCCTTGG + Intergenic
1045242351 8:100413705-100413727 CTGAATCAGAATTTCTGGGTTGG + Intergenic
1045368469 8:101497624-101497646 CTGATTCAACACTGCTGGGTTGG - Intronic
1045482864 8:102606635-102606657 CTGAGCCACCACGCCTGGCTGGG + Intergenic
1046367007 8:113247248-113247270 CTGAGCCAGAACTGCTCAGTGGG - Intronic
1046560907 8:115836202-115836224 GAGAACCAGCACTTCTGAGTGGG + Intergenic
1046860050 8:119080557-119080579 TTGAGACAGGACTTGTGGGTAGG + Intronic
1047450600 8:124962034-124962056 CTGACTCAGCACCTCTGGGGTGG - Intergenic
1048221585 8:132546973-132546995 CAGAGCCTGCTGTTCTGGGTTGG - Intergenic
1049230541 8:141479195-141479217 CTGAGCCAGTACCTTTGGGGAGG + Intergenic
1049309139 8:141924172-141924194 CCGAGGCAGCAGGTCTGGGTTGG - Intergenic
1049458534 8:142708792-142708814 GTGAGCCACCACGTCTGGCTGGG + Intergenic
1049992014 9:999516-999538 CTCAACCAGAACTTCTGGGAGGG + Intergenic
1052083882 9:24239966-24239988 CTGATTCAGCAAGTCTGGGTGGG + Intergenic
1053720555 9:40942391-40942413 GTGGGTCAGCACTTCTGTGTAGG + Intergenic
1053943309 9:43278184-43278206 CTGAGCAAGCCCTCCTGTGTGGG - Intergenic
1054406899 9:64771274-64771296 CTGAGCAAGCCCTCCTGTGTGGG - Intergenic
1054440523 9:65256740-65256762 CTGAGCAAGCCCTCCTGTGTGGG - Intergenic
1054489884 9:65765184-65765206 CTGAGCAAGCCCTCCTGTGTGGG + Intergenic
1054711331 9:68514098-68514120 CTGAGTCAGTAGATCTGGGTTGG - Intronic
1054775895 9:69123039-69123061 CTGATTCAGCAGATCTGGGTGGG - Intronic
1055499947 9:76893432-76893454 CTGACCCATCACTTCAGGGAGGG - Intronic
1056642430 9:88382850-88382872 CAGAGGCAGCTCTTCTGTGTTGG - Intergenic
1056807965 9:89743465-89743487 CTAAGCCAGCTCTTCTGCCTGGG - Intergenic
1056999751 9:91496872-91496894 CTGGCCCAGCAGGTCTGGGTGGG + Intergenic
1057273394 9:93663463-93663485 CTGACCCCCCACTTCTGTGTGGG + Intronic
1058983281 9:110189738-110189760 CTGAGTCAACAGGTCTGGGTGGG + Intergenic
1062254102 9:135613021-135613043 CTCAGCCAGGACCTCTGGCTGGG + Intergenic
1062496488 9:136833850-136833872 CTGTGCCGGCACTGCTGGGGAGG + Intronic
1062730137 9:138104060-138104082 GTCAGCCAGCACAGCTGGGTGGG - Intronic
1203454574 Un_GL000219v1:153479-153501 GTGGGTCAGCACTTCTGTGTAGG - Intergenic
1203586429 Un_KI270747v1:8089-8111 CTGAGCAAGCCCTCCTGTGTGGG - Intergenic
1203617035 Un_KI270749v1:75108-75130 CTGAGCAAGCCCTCCTGTGTGGG + Intergenic
1186714049 X:12231632-12231654 CTTATCCAGCAAATCTGGGTAGG - Intronic
1186904841 X:14100124-14100146 CTGATTCAGTACATCTGGGTGGG - Intergenic
1187496557 X:19800967-19800989 GGGAGCCAGCTCTACTGGGTAGG - Intronic
1188022293 X:25172084-25172106 CTGATCCAGCAGATCTGGGGTGG - Intergenic
1190654337 X:52597971-52597993 CTGAGCCAGAAATGCTGGCTTGG - Intergenic
1190706561 X:53033651-53033673 GTGAGCCACCACGTCTGGCTAGG - Intergenic
1192139185 X:68633017-68633039 CTGAGCAAGCCCTTCTGGAAAGG - Intergenic
1192307747 X:69981138-69981160 CTGAGACAGCAGTTTGGGGTTGG - Intronic
1197175928 X:123485879-123485901 CTGATCCAGCAGGTCTGGGATGG + Intronic
1197749097 X:129952907-129952929 CTGAGGCAGCACCTTTCGGTTGG + Intergenic
1197832937 X:130664159-130664181 CTGAGCCATCAATTCTGGCACGG - Intronic
1200929973 Y:8688246-8688268 GTGAGCCACCACTCCTGGCTGGG + Intergenic
1200979663 Y:9251014-9251036 ATGAGCCACCACGTCTGGGCTGG - Intergenic
1201142965 Y:11043655-11043677 CTGATTCAGCAGGTCTGGGTGGG + Intergenic
1202131723 Y:21618247-21618269 ATGAGCCACCACGTCTGGCTTGG + Intergenic