ID: 1147684197

View in Genome Browser
Species Human (GRCh38)
Location 17:42276923-42276945
Sequence AATTCCTGCCGTGCCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147684197_1147684202 17 Left 1147684197 17:42276923-42276945 CCTGCATGGGCACGGCAGGAATT No data
Right 1147684202 17:42276963-42276985 AATTCACCTGTCCGAGTTCCAGG No data
1147684197_1147684207 30 Left 1147684197 17:42276923-42276945 CCTGCATGGGCACGGCAGGAATT No data
Right 1147684207 17:42276976-42276998 GAGTTCCAGGGTGAACCTACGGG No data
1147684197_1147684198 -9 Left 1147684197 17:42276923-42276945 CCTGCATGGGCACGGCAGGAATT No data
Right 1147684198 17:42276937-42276959 GCAGGAATTCACATTCGCCCAGG No data
1147684197_1147684203 18 Left 1147684197 17:42276923-42276945 CCTGCATGGGCACGGCAGGAATT No data
Right 1147684203 17:42276964-42276986 ATTCACCTGTCCGAGTTCCAGGG No data
1147684197_1147684206 29 Left 1147684197 17:42276923-42276945 CCTGCATGGGCACGGCAGGAATT No data
Right 1147684206 17:42276975-42276997 CGAGTTCCAGGGTGAACCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147684197 Original CRISPR AATTCCTGCCGTGCCCATGC AGG (reversed) Intergenic
No off target data available for this crispr