ID: 1147684204

View in Genome Browser
Species Human (GRCh38)
Location 17:42276969-42276991
Sequence GTTCACCCTGGAACTCGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147684204_1147684216 0 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684216 17:42276992-42277014 CTACGGGGGACGGGGCGCCTGGG No data
1147684204_1147684220 17 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684220 17:42277009-42277031 CCTGGGGCCGGTTCCCTTCCTGG No data
1147684204_1147684223 27 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684223 17:42277019-42277041 GTTCCCTTCCTGGGAAAATCTGG No data
1147684204_1147684213 -8 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684213 17:42276984-42277006 GGGTGAACCTACGGGGGACGGGG No data
1147684204_1147684215 -1 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684215 17:42276991-42277013 CCTACGGGGGACGGGGCGCCTGG No data
1147684204_1147684217 1 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684217 17:42276993-42277015 TACGGGGGACGGGGCGCCTGGGG No data
1147684204_1147684218 5 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684218 17:42276997-42277019 GGGGACGGGGCGCCTGGGGCCGG No data
1147684204_1147684211 -10 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684211 17:42276982-42277004 CAGGGTGAACCTACGGGGGACGG No data
1147684204_1147684221 18 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684221 17:42277010-42277032 CTGGGGCCGGTTCCCTTCCTGGG No data
1147684204_1147684212 -9 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684212 17:42276983-42277005 AGGGTGAACCTACGGGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147684204 Original CRISPR GTTCACCCTGGAACTCGGAC AGG (reversed) Intergenic
No off target data available for this crispr