ID: 1147684206

View in Genome Browser
Species Human (GRCh38)
Location 17:42276975-42276997
Sequence CGAGTTCCAGGGTGAACCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147684199_1147684206 -2 Left 1147684199 17:42276954-42276976 CCCAGGCCGAATTCACCTGTCCG No data
Right 1147684206 17:42276975-42276997 CGAGTTCCAGGGTGAACCTACGG No data
1147684201_1147684206 -8 Left 1147684201 17:42276960-42276982 CCGAATTCACCTGTCCGAGTTCC No data
Right 1147684206 17:42276975-42276997 CGAGTTCCAGGGTGAACCTACGG No data
1147684197_1147684206 29 Left 1147684197 17:42276923-42276945 CCTGCATGGGCACGGCAGGAATT No data
Right 1147684206 17:42276975-42276997 CGAGTTCCAGGGTGAACCTACGG No data
1147684200_1147684206 -3 Left 1147684200 17:42276955-42276977 CCAGGCCGAATTCACCTGTCCGA No data
Right 1147684206 17:42276975-42276997 CGAGTTCCAGGGTGAACCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147684206 Original CRISPR CGAGTTCCAGGGTGAACCTA CGG Intergenic
No off target data available for this crispr