ID: 1147684208

View in Genome Browser
Species Human (GRCh38)
Location 17:42276977-42276999
Sequence AGTTCCAGGGTGAACCTACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147684201_1147684208 -6 Left 1147684201 17:42276960-42276982 CCGAATTCACCTGTCCGAGTTCC No data
Right 1147684208 17:42276977-42276999 AGTTCCAGGGTGAACCTACGGGG No data
1147684199_1147684208 0 Left 1147684199 17:42276954-42276976 CCCAGGCCGAATTCACCTGTCCG No data
Right 1147684208 17:42276977-42276999 AGTTCCAGGGTGAACCTACGGGG No data
1147684200_1147684208 -1 Left 1147684200 17:42276955-42276977 CCAGGCCGAATTCACCTGTCCGA No data
Right 1147684208 17:42276977-42276999 AGTTCCAGGGTGAACCTACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147684208 Original CRISPR AGTTCCAGGGTGAACCTACG GGG Intergenic
No off target data available for this crispr