ID: 1147684213

View in Genome Browser
Species Human (GRCh38)
Location 17:42276984-42277006
Sequence GGGTGAACCTACGGGGGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147684200_1147684213 6 Left 1147684200 17:42276955-42276977 CCAGGCCGAATTCACCTGTCCGA No data
Right 1147684213 17:42276984-42277006 GGGTGAACCTACGGGGGACGGGG No data
1147684204_1147684213 -8 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684213 17:42276984-42277006 GGGTGAACCTACGGGGGACGGGG No data
1147684201_1147684213 1 Left 1147684201 17:42276960-42276982 CCGAATTCACCTGTCCGAGTTCC No data
Right 1147684213 17:42276984-42277006 GGGTGAACCTACGGGGGACGGGG No data
1147684199_1147684213 7 Left 1147684199 17:42276954-42276976 CCCAGGCCGAATTCACCTGTCCG No data
Right 1147684213 17:42276984-42277006 GGGTGAACCTACGGGGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147684213 Original CRISPR GGGTGAACCTACGGGGGACG GGG Intergenic
No off target data available for this crispr