ID: 1147684218

View in Genome Browser
Species Human (GRCh38)
Location 17:42276997-42277019
Sequence GGGGACGGGGCGCCTGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147684204_1147684218 5 Left 1147684204 17:42276969-42276991 CCTGTCCGAGTTCCAGGGTGAAC No data
Right 1147684218 17:42276997-42277019 GGGGACGGGGCGCCTGGGGCCGG No data
1147684200_1147684218 19 Left 1147684200 17:42276955-42276977 CCAGGCCGAATTCACCTGTCCGA No data
Right 1147684218 17:42276997-42277019 GGGGACGGGGCGCCTGGGGCCGG No data
1147684205_1147684218 0 Left 1147684205 17:42276974-42276996 CCGAGTTCCAGGGTGAACCTACG No data
Right 1147684218 17:42276997-42277019 GGGGACGGGGCGCCTGGGGCCGG No data
1147684210_1147684218 -7 Left 1147684210 17:42276981-42277003 CCAGGGTGAACCTACGGGGGACG No data
Right 1147684218 17:42276997-42277019 GGGGACGGGGCGCCTGGGGCCGG No data
1147684199_1147684218 20 Left 1147684199 17:42276954-42276976 CCCAGGCCGAATTCACCTGTCCG No data
Right 1147684218 17:42276997-42277019 GGGGACGGGGCGCCTGGGGCCGG No data
1147684201_1147684218 14 Left 1147684201 17:42276960-42276982 CCGAATTCACCTGTCCGAGTTCC No data
Right 1147684218 17:42276997-42277019 GGGGACGGGGCGCCTGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147684218 Original CRISPR GGGGACGGGGCGCCTGGGGC CGG Intergenic
No off target data available for this crispr