ID: 1147688002

View in Genome Browser
Species Human (GRCh38)
Location 17:42298884-42298906
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 2, 1: 0, 2: 3, 3: 36, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147688002_1147688010 7 Left 1147688002 17:42298884-42298906 CCCTTCGGCCTCCCTTTCCTGAG 0: 2
1: 0
2: 3
3: 36
4: 296
Right 1147688010 17:42298914-42298936 TGGTGGCTCTGCATCCCCAGTGG 0: 2
1: 1
2: 2
3: 21
4: 256
1147688002_1147688008 -10 Left 1147688002 17:42298884-42298906 CCCTTCGGCCTCCCTTTCCTGAG 0: 2
1: 0
2: 3
3: 36
4: 296
Right 1147688008 17:42298897-42298919 CTTTCCTGAGAGAATCTTGGTGG 0: 2
1: 0
2: 1
3: 21
4: 208
1147688002_1147688011 13 Left 1147688002 17:42298884-42298906 CCCTTCGGCCTCCCTTTCCTGAG 0: 2
1: 0
2: 3
3: 36
4: 296
Right 1147688011 17:42298920-42298942 CTCTGCATCCCCAGTGGCCCTGG 0: 2
1: 0
2: 4
3: 54
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147688002 Original CRISPR CTCAGGAAAGGGAGGCCGAA GGG (reversed) Intronic
901322269 1:8347071-8347093 CTCAGAAAAGAGAGGCTGACAGG - Intergenic
902309852 1:15573806-15573828 CTCTGGAAAAGGAGGCACAAGGG - Intronic
902577522 1:17387644-17387666 CTCAGGAAGCTGAGGCAGAATGG + Intronic
904534045 1:31187560-31187582 CTCAGGAAGGGGTGGGCGCAAGG - Intronic
905101150 1:35523146-35523168 CACAGTAAAGGGAGGAAGAATGG - Intronic
907294888 1:53444324-53444346 TTTAGGAAATGGAGGCCTAAGGG - Intergenic
907311319 1:53540679-53540701 CTCAGGAAAGGGAGGTGGCTGGG - Intronic
908422342 1:63971248-63971270 ATGAGGAAAGTGAGGCCTAAGGG - Intronic
911727916 1:101261838-101261860 CTCAGGAATGGGAGGCACAATGG - Intergenic
913391342 1:118316099-118316121 CTCAGGAAAGGAAGGCCCAGAGG + Intergenic
914238217 1:145831707-145831729 CTGAGGAAAGGTAGCCAGAAAGG + Intronic
914746987 1:150508379-150508401 CTCAGAAAAGGAAAGCCAAACGG - Intronic
915593987 1:156886095-156886117 CTCAGGAACAGGAGGCCACAGGG - Intergenic
915725860 1:158017103-158017125 CGCAGGAAAGGGAGCTCGCAGGG - Intronic
916757109 1:167782756-167782778 CTTAGAAGAGGGAGGCAGAAGGG + Intronic
919968387 1:202552831-202552853 CTCAGGAAAGCTGGGCCCAAGGG - Intronic
921367389 1:214386585-214386607 CTTAGGAAAGGGAGGAGAAAAGG + Intronic
922963568 1:229668391-229668413 CTAAGGAAAAGGAGGCTGGACGG - Intergenic
923093821 1:230759333-230759355 AGCAGGCAAGGGAGGCAGAAGGG + Intronic
923551896 1:234970762-234970784 CCCAGGAAAGGAAGGGGGAAAGG + Intergenic
924794877 1:247285943-247285965 CACAGGAAAGGGAGGAGGCAGGG - Intergenic
1064460353 10:15529091-15529113 CTCAAGAAAGGAAGGAAGAAGGG - Intronic
1068778148 10:60890044-60890066 CTGAGGAAACTGAGGCAGAAAGG + Intronic
1069482851 10:68799397-68799419 CTCAGGAAACTGAGGCCCAGAGG + Intergenic
1069763827 10:70836569-70836591 CTCAGGAAAGGGAAAGGGAAAGG - Intronic
1070103496 10:73411291-73411313 CTCAGAAAGGGGAGGGTGAAAGG + Intronic
1070933090 10:80274435-80274457 CACCTGAAAGGGAGGCAGAAAGG - Intronic
1071371094 10:84952488-84952510 CTCAGGATAGAGAGGGGGAATGG + Intergenic
1071456673 10:85856487-85856509 CTCAGGTAAGGGAGGATGGAGGG + Intronic
1072269598 10:93763126-93763148 CTCAGGAAAGGCAGCGCTAATGG - Intronic
1072721961 10:97786712-97786734 GTCAGGAAGGGGTGGCCGATGGG + Intergenic
1073123689 10:101136702-101136724 CGGAGGAACGGGAGGCCGAGAGG + Exonic
1073790467 10:106934906-106934928 CTCAGAAAAGGGAGGGCGGAAGG + Intronic
1074676705 10:115859481-115859503 CCCAGAAAAGGCAGGCAGAAGGG + Intronic
1074887545 10:117705815-117705837 CTCAGGGAAGGGAGGACCCAAGG - Intergenic
1075645718 10:124094537-124094559 CTCAGGAAACTGAGGTCCAAGGG + Intergenic
1075992850 10:126852658-126852680 CTCAGGAAAGGGAGACCAGATGG - Intergenic
1076565266 10:131394248-131394270 CTCATAAGAGGGAGGCAGAAGGG - Intergenic
1077321596 11:1945337-1945359 CTCAGGAGAGGCAGGCAGAGCGG + Intergenic
1077506604 11:2932488-2932510 CTCAGGCAAGGGAGGCCGAGCGG - Intergenic
1077533108 11:3106485-3106507 CTCAGGAAGGGGAGTCCGGAAGG - Intronic
1078714320 11:13825572-13825594 CTCAGCAAATGGAGGCAGAAGGG + Intergenic
1080392353 11:31860237-31860259 CTCAGGACAGGCAGGACAAATGG + Intronic
1081468145 11:43344353-43344375 CTTAGGAAAGGGAAGGGGAAGGG - Intronic
1081583484 11:44368202-44368224 CTGATGGAAGGGAGGCAGAAAGG - Intergenic
1081675131 11:44964169-44964191 CTCAGGAGAGGGAGGCAGAGTGG - Intergenic
1085087474 11:73680020-73680042 CTCAGGAAGTGGAGGCTGCAGGG + Intronic
1085605104 11:77890451-77890473 CTCAGGAAAGGAAAGGAGAAGGG - Intronic
1085763538 11:79262416-79262438 CTCAGGGTAGGGAGCCCCAAAGG + Intronic
1085929360 11:81062576-81062598 CTCATGAAAGGAAGGGAGAAGGG - Intergenic
1088020316 11:105111325-105111347 CTCAGGCAAGGGAGGCAGTGAGG + Intergenic
1088707545 11:112477428-112477450 CTGAGGAAAGGGAGGAGGACAGG - Intergenic
1090185201 11:124734450-124734472 CTGAGGAAAGGGAGGTGGAAAGG + Intergenic
1090381809 11:126332619-126332641 GTAAGGAAAGGGAGGCTGACAGG + Intronic
1090474810 11:127010386-127010408 CTCAAGAAAGGAAGGACCAAGGG - Intergenic
1090751562 11:129750605-129750627 CTCAGAACAGGGAGGCCGCAGGG - Intergenic
1090913286 11:131140612-131140634 CAGAAGAAAGGGAGGCAGAAGGG + Intergenic
1202804614 11_KI270721v1_random:650-672 CTCAGGAGAGGCAGGCAGAGCGG + Intergenic
1091387153 12:102785-102807 GTCTGCAAAGGGAGGCTGAAGGG + Intronic
1091668461 12:2435938-2435960 CACAGGAAAAGGAGACCGAGAGG + Intronic
1092258160 12:6938217-6938239 CCCAGGAAATGGAGCCCAAAAGG + Intronic
1093016159 12:14156592-14156614 CTCAGGAAACAGAGACCCAAGGG - Intergenic
1093749566 12:22782665-22782687 CTCAGGAAAGAGAAGCCAAGTGG + Intergenic
1093791407 12:23254674-23254696 CTCAGGTAAGGGAGGTGGAGAGG + Intergenic
1095648812 12:44582579-44582601 GTCAGGAAGTGGTGGCCGAAAGG + Intronic
1095930537 12:47620736-47620758 CTCCAGAAAGGGAGGCCCCAGGG - Intergenic
1097530912 12:60798840-60798862 CTCAGGAAAGGGAGGCTCAAGGG + Intergenic
1098541300 12:71661193-71661215 CTCGGGAGACTGAGGCCGAATGG + Intronic
1099218353 12:79881079-79881101 CTCAGGAAAGGGAGAGAGATGGG - Intronic
1101051857 12:100872234-100872256 CTTAGGAAAGGGAAGCTGAAGGG - Intronic
1101489287 12:105196840-105196862 CTGAGGAAAGTGAGGCCCAGAGG + Intronic
1101657250 12:106733609-106733631 CTCTGGAAAGGGAGGCAGACAGG + Intronic
1102807142 12:115791990-115792012 CACAGGAAAGGAGGGCTGAAGGG + Intergenic
1106014111 13:25851948-25851970 CTCAGGAAACTGAGGCAGGACGG - Intronic
1107750597 13:43561663-43561685 CACAGAAAAGGGAGGCCCAAAGG + Intronic
1107756377 13:43627814-43627836 CTCAGGATAAGGAAGACGAAGGG - Intronic
1108129675 13:47284630-47284652 CACAGAATAGGGAGGCAGAATGG + Intergenic
1110987400 13:81987791-81987813 CTTAGGAAAGGGAGGTCGGAGGG - Intergenic
1114460143 14:22881216-22881238 CTCAGGAATGGGAGGTCCCATGG - Exonic
1114525907 14:23366597-23366619 CTAATGAAAGGGAGGCCGAGAGG - Intergenic
1115875977 14:37862765-37862787 GTCAGGAAACGGAGGGCCAAGGG - Intronic
1116279035 14:42877888-42877910 CTCAGAAATGGGAAGCAGAATGG + Intergenic
1117253167 14:53954807-53954829 CTCAGGAAAGGGAGGTCGGGTGG - Intronic
1117504250 14:56386349-56386371 CTCACTAAAGGAAGGCAGAAGGG - Intergenic
1118240777 14:64056245-64056267 CACAGGAAACTGAGGCAGAAAGG + Exonic
1118293546 14:64547918-64547940 CTCAGGAGACTGAGGCAGAATGG + Intergenic
1119078637 14:71671151-71671173 TTTAGGAATGGGAGGCCCAAAGG - Exonic
1121939456 14:98055817-98055839 CCCTGGAAAGGGAGGCTTAAAGG - Intergenic
1123942436 15:25223082-25223104 CTCAGGAAAAGCAGGCCCAGTGG - Intergenic
1123988102 15:25662700-25662722 ATCAGGAAAGGGAGGGCTAAGGG + Intergenic
1124378448 15:29143630-29143652 ATTGGGAAAGGGTGGCCGAAGGG + Intronic
1125679885 15:41523932-41523954 CTAAGGAAGGGGTGGCCGAGAGG + Exonic
1125892493 15:43276803-43276825 CTCAGGAAAGGGGTGCCCCATGG - Intronic
1129171341 15:73810018-73810040 CTCAGGAGAGGGAGGAAGGAAGG + Intergenic
1129198910 15:73986983-73987005 CTCAGAGAGGGGAGGCAGAAGGG + Intronic
1129394449 15:75236352-75236374 CACAGGGAAGGGAGGCAGAATGG - Intergenic
1129469273 15:75741460-75741482 ATCAGGAAACTGAGGCTGAAAGG - Intergenic
1129656752 15:77529689-77529711 CTGAGGAAAGGCAGGCCCAAGGG - Intergenic
1130420806 15:83745206-83745228 ATCAGGAAAGGGAGCTGGAAAGG - Intronic
1131827967 15:96334894-96334916 CTCAGGAAAGGGAGCAGGAGAGG - Intronic
1134013401 16:10871698-10871720 CTCAGGAAAGGAAGCCCAGAAGG - Intergenic
1136049040 16:27637675-27637697 ATCAGGACAGGGTGGCAGAAAGG + Intronic
1137674263 16:50296462-50296484 CTCAGGAGGGTGAGGCAGAATGG - Intronic
1138035422 16:53600463-53600485 CCCAGGACAGGGAGGCCCAGTGG + Intronic
1139799174 16:69507400-69507422 ATGAGGAAAGTGAGACCGAATGG + Intergenic
1141029105 16:80572274-80572296 CTTAGGAAAGGGAGGCAGGAGGG + Intergenic
1141045838 16:80715570-80715592 TGGAGGAAAGGGAGGCCGGAGGG - Intronic
1141068166 16:80930715-80930737 CTCAGGAGACTGAGGCAGAATGG + Intergenic
1141095686 16:81161289-81161311 CTTATAAAAGGGAGGCAGAAAGG - Intergenic
1141204458 16:81923014-81923036 CTCAGGACAGGCAGGAAGAATGG + Intronic
1142441380 16:90100530-90100552 CTAAAGAAATGGAGGCCAAATGG - Intergenic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144996211 17:19270949-19270971 CTCAAGAAATGGAGACCGAAAGG + Intronic
1145817600 17:27806558-27806580 CTGAGGAAAGGGAGGCCCGGAGG - Intronic
1145881034 17:28352880-28352902 CTCAAGAAGGGGAGGTGGAATGG - Intronic
1145933399 17:28701489-28701511 TGCAGGAAAAGGAGGCAGAACGG + Exonic
1146255236 17:31388494-31388516 CTAAGCAAAGGGAGGCAGGAGGG + Intergenic
1147148433 17:38499229-38499251 CTCGGCAAAGAGAGGCCGCAGGG - Intronic
1147615569 17:41825379-41825401 CTCAGGGAAAGGAGGACGGAGGG + Intronic
1147669441 17:42168275-42168297 CTCAGGAAATGTTGGCAGAAGGG + Intronic
1147678044 17:42220688-42220710 CTCAGGAAAGGGAGGCCGAAGGG + Intronic
1147688002 17:42298884-42298906 CTCAGGAAAGGGAGGCCGAAGGG - Intronic
1149337265 17:55648918-55648940 CTCATAAAAGGGTGGCAGAAGGG - Intergenic
1149434287 17:56620016-56620038 CTCTGGCAAGGGAGGGTGAACGG - Intergenic
1149638116 17:58186332-58186354 CTAAGGAAAGGGAACCCGCAGGG - Intergenic
1151208965 17:72529461-72529483 CTGGGGAAAGGGAGGCCCAGGGG + Intergenic
1152470263 17:80487281-80487303 CTCAGAAAGGTGAGGCCGAGAGG - Intergenic
1153679657 18:7488579-7488601 CTGAGGAATGGGAGGGCGCATGG - Intergenic
1155103107 18:22633386-22633408 CACATGAAAGGGAGGCCTAAGGG + Intergenic
1155374242 18:25138539-25138561 CTCAGGAAAAGCAGGAAGAAAGG + Intronic
1155383297 18:25248385-25248407 TCCAGGAGAGGCAGGCCGAAAGG - Intronic
1155990963 18:32278950-32278972 CTCAGGCAAGGGAGGCCCAGGGG + Intronic
1156449839 18:37260839-37260861 TCCAGGGAGGGGAGGCCGAAGGG - Intronic
1157128062 18:44976442-44976464 CTCAGGAAAGGCAGGCTGCTGGG + Intronic
1157881941 18:51329022-51329044 CTCAGGAAAGAGATGAAGAAAGG + Intergenic
1160262765 18:77310548-77310570 CTCAGAACAGGGAGGCTGAGAGG + Intergenic
1160455267 18:78994872-78994894 CTCAGGAACAGCAGGCTGAAGGG - Exonic
1161086631 19:2338558-2338580 CCAAGAACAGGGAGGCCGAAGGG - Intronic
1161668694 19:5592162-5592184 AACAGGAAAGGGAGGCTGAGAGG - Intronic
1163328504 19:16620694-16620716 TTCAGAAAAGGGAGGCAGTAGGG + Intronic
1165390340 19:35534941-35534963 CTGAGGAAAGGGAGACAGCAGGG - Intronic
1166045405 19:40226866-40226888 GTCAGGAAAGCGAGGCCCAGAGG - Intergenic
1167540619 19:50084944-50084966 CTCAGGAGGCGGAGGCAGAAGGG + Intergenic
1167629098 19:50612871-50612893 CTCAGGAGGCGGAGGCAGAAGGG - Intergenic
1168100371 19:54138175-54138197 CGCAGGAACGGGAGGGCGAGAGG - Intronic
1168666447 19:58208525-58208547 CTTAGGAGAGGGAGGCTGGAGGG + Intronic
1168706437 19:58472922-58472944 CTCAGGAGAGGGATGCCCATGGG + Exonic
1168724787 19:58575221-58575243 CCCAGGAAAGGAAGGAGGAAGGG + Intergenic
926327801 2:11800224-11800246 CCCAGGAAAGGGAGGTCGGTGGG - Intronic
926642004 2:15246993-15247015 GTCAGGAAAGGGTTGCTGAAAGG + Intronic
927005868 2:18847867-18847889 CTAAGGAAAGGGAAGCAGAGTGG + Intergenic
928938187 2:36702241-36702263 AGCAGGAAAGGGAAGCCCAAGGG + Intronic
930034070 2:47074778-47074800 CTCAGGCAGGGGAAGCCAAAAGG - Exonic
931385693 2:61795698-61795720 CTTGAGAAAGGGAGGCCGCATGG - Intergenic
931706768 2:64952653-64952675 CCCAGGAAAGCGAGGCTGATTGG - Intergenic
931882651 2:66582874-66582896 CTGAGGAGAGGGCGGCCGAGAGG - Intergenic
931992123 2:67801314-67801336 CTCAGGAAAGGAAGATGGAAAGG + Intergenic
935513076 2:104000361-104000383 CTCAGGAGACGGAGGACGCAGGG + Intergenic
936004055 2:108866235-108866257 CTTATAAAAGGGAGGCAGAAGGG - Intronic
936386231 2:112032051-112032073 CTCAGGATCAGGAGGTCGAAAGG + Intergenic
937520623 2:122709151-122709173 CACAGGAAAGGGAGGCAGCCTGG + Intergenic
938601674 2:132848713-132848735 CTCAGGAAGCTGAGGCAGAAGGG + Intronic
938633574 2:133196769-133196791 AGCAGGAAAGGGAGCCCCAAAGG + Intronic
938987224 2:136589145-136589167 CTCAGGGAATAGAGGCCCAAAGG + Intergenic
939437816 2:142201275-142201297 CTCAGGAGAGGGAGAGAGAAGGG - Intergenic
939870367 2:147519951-147519973 CCCAGGTCAGGGAGGCAGAAAGG + Intergenic
942612009 2:177751925-177751947 CTGTGGAAAGGGAAGCCCAAAGG + Intronic
943590157 2:189786373-189786395 TTCAGGAGAGAAAGGCCGAATGG + Intronic
947206575 2:227666740-227666762 CTCAGGATACTGAGGCCCAAAGG - Intergenic
947828754 2:233124479-233124501 CTCAGACCAGGGAGGCCAAAAGG - Intronic
948020803 2:234731699-234731721 CTCATGAAAGAGATGCCCAATGG - Intergenic
949064340 2:241980487-241980509 CAAAGGAAAGGCAGGCCGAGGGG + Intergenic
1169305223 20:4483703-4483725 CTCAGGAAAGGGAGGGAGGGAGG - Intergenic
1169677440 20:8169812-8169834 CTTAGGAATGGAAGGCTGAAGGG + Intronic
1170552310 20:17488628-17488650 CTCAGGAGAGGGTGGCCCTAGGG - Intergenic
1171092850 20:22302501-22302523 CTCTGGAAATGGAGCCCCAAAGG - Intergenic
1172220985 20:33274939-33274961 CTCAGGAATGGGAGGGCCATTGG + Intronic
1172891451 20:38268758-38268780 CCCAGAACAGGGAGGCTGAAGGG + Intronic
1173365436 20:42380594-42380616 CCCAGGAAAGGGCTGCCAAAGGG + Intronic
1174339587 20:49887488-49887510 CTGAGGAGATGGAGGCCTAAGGG + Intronic
1174743243 20:53037226-53037248 CTCAGGAAGCAGAGGCAGAAAGG + Intronic
1174856471 20:54050193-54050215 TTCATGAGAGGGAGGCAGAAGGG - Intronic
1175904954 20:62375192-62375214 TTCACGAAAGGAAGGCTGAAAGG + Intergenic
1177881914 21:26704361-26704383 CTTATAAAAGGGAGGCTGAAGGG - Intergenic
1178357247 21:31919310-31919332 TTCAGGAAAGGGAGGAGGATGGG + Intronic
1178826860 21:36024525-36024547 CTCAGGAGACGGAGGCAGGATGG + Intergenic
1178971117 21:37177689-37177711 CTCAAGAAAGTGATGCCCAAAGG - Intronic
1179060776 21:37976881-37976903 CTCAGGAAGGGGAGACATAATGG - Intronic
1182026553 22:27123707-27123729 CTGAAGAAAGGGAGGCAGAAAGG + Intergenic
1182772971 22:32809164-32809186 CTCAGGCTAGGGAAGCCAAATGG + Intronic
1185173907 22:49308305-49308327 CACAGGTAAGGGGGGCAGAAAGG + Intergenic
1185354642 22:50360468-50360490 CTCAGGAAACTGAGGCAGGAGGG - Intronic
950114361 3:10441085-10441107 CCCAGGAAAGGGAGGTGCAAAGG - Intronic
951273687 3:20659009-20659031 CTCAGGAAGCTGAGGCAGAATGG - Intergenic
952107734 3:30088801-30088823 ATCAGGAAAGGGAGCCGAAAAGG + Intergenic
954114752 3:48460251-48460273 CCCAGCAGAGGGAGGCAGAAGGG + Exonic
955356844 3:58238413-58238435 CTGGGGAAAGGGAAGCTGAAAGG - Intronic
955591199 3:60537670-60537692 GGCAGGAAAGGGAGGCTGAAGGG + Intronic
955594658 3:60575466-60575488 CTCATGGAAGGGAGACCCAATGG + Intronic
956391903 3:68782733-68782755 CTAAGGAGAGGGAGGGGGAATGG + Intronic
957685355 3:83498545-83498567 TTCAGGAAAGGGAAGCAGCATGG + Intergenic
958116328 3:89223279-89223301 ATTAGGAAAGGGAGGCTGAAAGG + Intronic
959948853 3:112155669-112155691 CTCAGGAATGGGAGGCCACCAGG + Intronic
963284157 3:143417119-143417141 CTAAGGAAAGGGAGTGAGAAGGG + Intronic
963709424 3:148729861-148729883 CTCAGAGAGGGGAGGCTGAAAGG - Intronic
963994572 3:151693080-151693102 CACAGGAAAGGGATGCTGAAAGG - Intergenic
964819706 3:160756046-160756068 CTCAGGGAAGGGAGGCGGCGCGG + Intronic
967379106 3:188837810-188837832 GGCAAGAAAGGGAGGCAGAATGG + Intronic
967987916 3:195109058-195109080 CTCAGGAAAGTGAACTCGAAAGG + Intronic
968361641 3:198151506-198151528 CTAAAGAAATGGAGGCCAAATGG - Intergenic
968784296 4:2608284-2608306 CTCAGGAGACTGAGGCAGAAGGG - Intronic
968930358 4:3575670-3575692 CCCAGGCCAGGGAGGTCGAAGGG - Intergenic
969060717 4:4432183-4432205 CTCAGGAAAGTCAGGGCTAATGG + Intronic
969527217 4:7709968-7709990 CTTAGGAAAGAGGTGCCGAAGGG - Intronic
969918516 4:10513781-10513803 CTAAGGAAAGAGAGGAGGAAGGG - Intronic
969919014 4:10519488-10519510 GTCAGGAATGGGAGTCCTAAAGG - Intronic
970580034 4:17466690-17466712 CTTATAAAAGGGAGGCAGAAGGG + Intronic
971745913 4:30580636-30580658 CTCAGAGATGGGAGGCTGAACGG - Intergenic
972816447 4:42651766-42651788 CTCAGGACAGTGAAGCAGAAAGG + Intronic
973325130 4:48852985-48853007 CTCAGGAGACTGAGGCAGAATGG - Intronic
974410931 4:61539867-61539889 CACAGAAAAGGGAAGCAGAAAGG - Intronic
974897252 4:67954234-67954256 CTCAGGAGATTGAGGCTGAAGGG + Intronic
977572904 4:98648301-98648323 CCCAGAAAAGGGAGGCTGAAAGG + Intronic
979612128 4:122700433-122700455 CGCAGGAAAGGGACTCTGAAAGG - Intergenic
981419766 4:144535878-144535900 CTCAGGAAGGAGAGGCTGGATGG - Intergenic
984700083 4:182813696-182813718 CTCAGGCAAGGGAGGTGGATGGG - Intergenic
984754302 4:183311682-183311704 CTCAGGAAGCTGAGGCAGAATGG - Intronic
989229723 5:39073507-39073529 CCCGGGAAAGGGAAGCAGAAGGG + Intronic
990161858 5:52949902-52949924 TTCAGGAAAGGAAGGAAGAAGGG - Intronic
991256298 5:64618690-64618712 CTTACAAAAGGGAGGCAGAAAGG - Intergenic
992480956 5:77152178-77152200 CACAGAAAAGAGAGGCCAAACGG - Intergenic
993072853 5:83187565-83187587 CACAGCAAAGGGAGGGAGAATGG + Intronic
994164561 5:96595450-96595472 CTCAGGGAAGGGCCACCGAAGGG + Intronic
995229540 5:109743582-109743604 CACAGGAAAGGGAGGTGGAAAGG - Intronic
996370299 5:122746206-122746228 GTCAAAAAAGGGAGGCAGAAGGG + Intergenic
996656513 5:125943335-125943357 GCCAGGAAGGGGAGGCAGAAAGG + Intergenic
998638771 5:143986248-143986270 CACAGGAAAGGAAGCCCAAAGGG - Intergenic
999278674 5:150349997-150350019 CTAAGGAGTGGGAGGCTGAAAGG - Intergenic
1000138673 5:158380458-158380480 TTCAGGGAATGGAGGCCAAAGGG + Intergenic
1000233460 5:159336264-159336286 CACAGGAAGGGGAGGTGGAAAGG - Intergenic
1000282924 5:159797840-159797862 CTCAGCAAAGGGAGCCCGAATGG + Intergenic
1000783889 5:165519449-165519471 CTCGGGAAACTGAGGCAGAATGG - Intergenic
1002327633 5:178420386-178420408 CTCAGGGAGGGGAGGGGGAAAGG - Intronic
1002327719 5:178420611-178420633 CTCAGGGAGGGGAGGAGGAAAGG - Intronic
1003264537 6:4553692-4553714 CTCAGGAAAGGGTAGAGGAATGG + Intergenic
1005030837 6:21507478-21507500 CTTAGGAATGGGAGGCTGAGGGG + Intergenic
1006011407 6:31045687-31045709 CTGAGGCTGGGGAGGCCGAATGG + Intergenic
1006246905 6:32745419-32745441 TTCAGTAAAGAGAGGCGGAATGG - Intronic
1006401885 6:33822518-33822540 CACAGGAAAGGAGGGCAGAAAGG - Intergenic
1006576233 6:35048479-35048501 TTTAGGAGAGGGAGGCAGAAGGG - Intronic
1007777710 6:44233070-44233092 CTCAGTAGAGGGAGGGCAAAAGG + Intronic
1007946770 6:45834052-45834074 CTCAGAAAAGGGAGGTGGGAAGG - Intergenic
1010010326 6:71041196-71041218 CTTAGGAAAGGAAGTCCAAATGG - Intergenic
1010788091 6:80029161-80029183 GTCAGGGAAGGGAGGAAGAATGG + Intronic
1011602672 6:89074568-89074590 CTCAGGTAAGGAAGGCATAATGG + Intergenic
1017674022 6:156795333-156795355 ATAAGGGAAGGGAGGCCGGAAGG + Intronic
1018371143 6:163169716-163169738 CTCAGGAGAGAGAGGCCGCTGGG + Intronic
1018743779 6:166748769-166748791 CTGAGGAAATGGGGGCCCAAGGG - Intronic
1018743825 6:166748880-166748902 CTGAGGAAATGGGGGCCCAAGGG - Intronic
1018743872 6:166748992-166749014 CTGAGGAAATGGGGGCCCAAGGG - Intronic
1019114224 6:169744632-169744654 CTCAGGGTAGGGAGGAAGAAAGG - Intronic
1019254042 7:37216-37238 CTAAAGAAATGGAGGCCAAATGG + Intergenic
1021695226 7:23269737-23269759 CTCAGGAAAGTGAGGCCCTGGGG - Intronic
1022124672 7:27343877-27343899 CTCAGGAAAGAAAGGCAGAGGGG + Intergenic
1022567119 7:31414717-31414739 CACAGAAAAGGGAGGCAGAGAGG - Intergenic
1024152088 7:46582257-46582279 CTCAGGAAACAGAGGCCAAATGG + Intergenic
1025847494 7:65213640-65213662 CTCAGGAAAGGAAAGGAGAAGGG + Intergenic
1025897742 7:65719530-65719552 CTCAGGAAAGGAAAGGAGAAGGG + Intergenic
1026325508 7:69305977-69305999 CTCAGGAGACTGAGGCAGAAGGG - Intergenic
1026526819 7:71160939-71160961 CTCAGGAAGCTGAGGCAGAAGGG - Intronic
1029551541 7:101239448-101239470 TTCAGGAAAGGGAGGAAGGAAGG + Intronic
1030395092 7:108976025-108976047 ATCAGGAAAGGTAGGCTGAAGGG - Intergenic
1030581415 7:111360366-111360388 CTTGGGAAAGGGAGGCCTTATGG - Intronic
1030900571 7:115118485-115118507 ATCAGGAAAGGTGGGCAGAAAGG - Intergenic
1032061204 7:128726867-128726889 CTCAGGTAAGGGAGGGCACAGGG + Exonic
1032389370 7:131546084-131546106 CTCAGGAAAGGGAGGGCATGGGG - Intronic
1032451019 7:132031091-132031113 CTTAGGAAAGGGTGTCAGAAAGG + Intergenic
1032521241 7:132546961-132546983 TCCAGGAAAGGGAGCCCAAAAGG + Intronic
1032549488 7:132771333-132771355 CTCAGCAAAGGCAGGCTCAAAGG + Intergenic
1032624963 7:133581854-133581876 CTCAGGAAACTGAGGCCTCATGG + Intronic
1033281458 7:140009522-140009544 CTCAGGAGAGCGAGGCTGGATGG - Intronic
1034081961 7:148287491-148287513 GTCAGGAAAAGGAGGGCCAATGG - Intronic
1034283254 7:149868117-149868139 TTCACCAAAGGGAGGCCGCACGG - Intergenic
1035055119 7:156030154-156030176 CCCAGGACAGGGAGGCAGAGGGG - Intergenic
1035453330 7:158993103-158993125 ATCAGGAAAGGAAGGCAGGAAGG - Intergenic
1037583218 8:20258871-20258893 CGCAGGAATGGGAGGCAGAAAGG - Intronic
1039915736 8:41859057-41859079 CTCAGGAACAGGACGCTGAAAGG + Intronic
1040487070 8:47883834-47883856 CTGAGGAAAGGGACGCCAGAGGG - Intronic
1040561081 8:48524068-48524090 CCCAGGAAAGGGAGCACGGAGGG - Intergenic
1041570918 8:59336141-59336163 CTCAGGATTGGGAGTGCGAATGG + Intergenic
1043378207 8:79673633-79673655 CTGAGGAAACAGAGGCCAAAGGG - Intergenic
1045478509 8:102574294-102574316 CTTAGAAGAGGGAGGCAGAAGGG + Intergenic
1045503226 8:102759041-102759063 CTCAAGGAGGGGAGGCCAAAGGG + Intergenic
1046583425 8:116122044-116122066 CTGAGGAAAGTCAGGCTGAAGGG - Intergenic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1048443024 8:134473922-134473944 CTCAGGAAAGAGATGCAGAATGG + Intergenic
1049627879 8:143634365-143634387 CTGCGGACAGGGAGGCTGAAAGG + Intergenic
1049798590 8:144507507-144507529 CACAGGAAAGGGAGCCAGGAAGG - Intergenic
1050120667 9:2303908-2303930 CTTAGGACAGGGAGGCTCAAGGG - Intergenic
1051398028 9:16647447-16647469 CTCAGGGAAAGGAGGTCAAAGGG + Intronic
1052170271 9:25386289-25386311 CTTAGGAAAGGAAAGCAGAAAGG + Intergenic
1052893136 9:33721877-33721899 CTCAGAACAGGGAGGCCGCAGGG - Intergenic
1053505600 9:38640913-38640935 CTGAGGAAAGGGAAGCTGAGAGG + Intergenic
1054983172 9:71230935-71230957 CACAGGAAAGGAAAGCAGAAAGG + Intronic
1055605071 9:77960560-77960582 CACAGGAAAGGCATGCCGCAGGG + Intronic
1056112146 9:83406539-83406561 CTCAGGAAAGGAAGGAAGGATGG + Intronic
1057312304 9:93950035-93950057 CTGTGGAAAGGGAGGCCTGAGGG - Intergenic
1058132181 9:101265555-101265577 CTCAGGACAGGGAGGAAGAAAGG + Intronic
1060648572 9:125304164-125304186 CTCAGGAGGGTGAGGCAGAAGGG - Intronic
1185463363 X:342414-342436 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463371 X:342441-342463 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463379 X:342468-342490 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463470 X:342792-342814 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463478 X:342819-342841 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463486 X:342846-342868 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463494 X:342873-342895 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463502 X:342900-342922 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463769 X:343819-343841 CTCAGCAACGGGAGGCGGTAGGG + Intronic
1185463782 X:343873-343895 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463798 X:343927-343949 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463806 X:343954-343976 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463814 X:343981-344003 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185463861 X:344143-344165 CTCAGCAACGGGAGGCGGGAGGG + Intronic
1185975371 X:4714017-4714039 CACAGGAAAGGGAGGGAGAGTGG - Intergenic
1186194480 X:7097515-7097537 TTCAGGAAAGAGATGCCAAAGGG - Intronic
1186760604 X:12718188-12718210 TTGGGGCAAGGGAGGCCGAAGGG + Exonic
1189174733 X:38944728-38944750 GTCAGGAAGGGGAGGCTGAATGG - Intergenic
1189898363 X:45680214-45680236 CTTAGGAAAGAGAGGCAAAATGG - Intergenic
1193396129 X:80985672-80985694 CTGAGGAGAGGGAGGGAGAAGGG + Intergenic
1196477393 X:116104520-116104542 CTTAGGAAAGGGAAGGGGAAGGG + Intergenic
1197865636 X:131013914-131013936 CTGAGGAAACTGAGGCCTAAAGG - Intergenic
1199690053 X:150302680-150302702 CTCAAGAATGGGAGGCAGCAGGG - Intergenic
1199847669 X:151702707-151702729 CTCTGGAAAGGGAGGACGAGAGG - Exonic
1201701216 Y:16884091-16884113 CACAGGACAGGGAGGCAGAGTGG + Intergenic
1201858997 Y:18574259-18574281 CTCGGTAAAGGGAGGCAGATAGG + Intronic
1202304200 Y:23450805-23450827 CTCAGGAAAGCTGGGCCCAAGGG - Intergenic
1202566610 Y:26219786-26219808 CTCAGGAAAGCTGGGCCCAAGGG + Intergenic