ID: 1147691125

View in Genome Browser
Species Human (GRCh38)
Location 17:42315330-42315352
Sequence TGGCATTTGCTTACAGAAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147691121_1147691125 5 Left 1147691121 17:42315302-42315324 CCAGGAGTATGTAGCTATAGGTG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1147691125 17:42315330-42315352 TGGCATTTGCTTACAGAAACAGG 0: 1
1: 1
2: 2
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147691125 Original CRISPR TGGCATTTGCTTACAGAAAC AGG Exonic
900298709 1:1965824-1965846 TGGCCAATGCTTACAGAAACCGG + Intronic
902137456 1:14322330-14322352 TTGCATTTGCCCACAGAAAATGG + Intergenic
902977235 1:20097877-20097899 TGGCACTTGCTCCCAGAACCTGG + Intergenic
905702631 1:40029769-40029791 TAGTATTTCCTTACAGACACTGG - Intergenic
906729571 1:48069655-48069677 TCCCATCTGATTACAGAAACTGG + Intergenic
910692663 1:89980959-89980981 TGTTTTTTGCTTCCAGAAACTGG - Intergenic
911726084 1:101242482-101242504 TGGCATTTCCTTCAGGAAACTGG - Intergenic
912083422 1:105968547-105968569 TGGCATCTTTTTACAGAAACTGG - Intergenic
912118735 1:106441303-106441325 CTGCATATGCCTACAGAAACTGG + Intergenic
912434080 1:109646637-109646659 TGGCATTTTTTTACAGAAATAGG - Intergenic
915819362 1:159005569-159005591 TGGCATTAGCTTTGAGCAACAGG + Intronic
916102199 1:161402221-161402243 TGGCATATACTTCCAGAAACTGG + Intergenic
917435067 1:175012673-175012695 TGGCATTTTGTTACAGCAGCAGG - Intronic
917956798 1:180107739-180107761 TGGCATCTGCTTGCTGAAATTGG + Intronic
1064878617 10:20023844-20023866 TGGCATATGATCACAGAGACAGG + Intronic
1067542513 10:47166210-47166232 TGGCTTTTGCTCACACACACTGG - Intergenic
1071064426 10:81614126-81614148 TGGCATGGGCTTCCACAAACAGG + Intergenic
1071793350 10:88979777-88979799 TGGCATTTGATTAGAGAGTCAGG - Intronic
1072306021 10:94108155-94108177 TGGGATGTTCTTTCAGAAACAGG - Intronic
1075240328 10:120772768-120772790 TGGCATTGGCTCCCAGAGACTGG + Intergenic
1075365513 10:121884871-121884893 TAGGAGTTGCTTAAAGAAACTGG + Intronic
1076202719 10:128571104-128571126 TAGCATGTGCTTACAGACACAGG + Intergenic
1076498624 10:130916595-130916617 TGGCATCTTCGTACAGAAAAAGG - Intergenic
1076606768 10:131694539-131694561 TGACACCTGCTTACAGAGACAGG - Intergenic
1078593044 11:12662340-12662362 TGGCAATTGCTAACAAATACAGG - Intergenic
1079614615 11:22476422-22476444 TGTCATTTGTTTTCAGGAACAGG + Intergenic
1082641287 11:55664762-55664784 TGGCTTTGTTTTACAGAAACAGG - Intergenic
1083162007 11:60860186-60860208 TGGCATCTGATTACAGACTCTGG - Intergenic
1084577173 11:69996855-69996877 TGGCATTCTGTTACAGAGACAGG - Intergenic
1084588187 11:70075501-70075523 TGGCATGTGCCAACAGATACAGG - Intergenic
1084603154 11:70158556-70158578 TGGCATATGCCTGCAGAAGCTGG + Intronic
1085087395 11:73679234-73679256 TAGCCTCTGCTTTCAGAAACAGG - Intronic
1085419719 11:76345471-76345493 TGGCATTTGCTAACAGTAGTTGG - Intergenic
1085450557 11:76629669-76629691 TGGCATTTCCCTTCAGAAAAAGG - Intergenic
1088313104 11:108480875-108480897 TTGTATTTGCTTTCATAAACTGG - Intronic
1088384068 11:109232838-109232860 TGGCATTTGTTTAGATAAATCGG + Intergenic
1090248147 11:125231689-125231711 TTGCATGTGCTTACACACACAGG + Intronic
1090575508 11:128098273-128098295 TGGCATTTTCTTTCAGAAAATGG - Intergenic
1091088762 11:132749278-132749300 TGGCACTTTCTTACAGTAGCAGG + Intronic
1091394391 12:144647-144669 TGACATTTGCTTTCAGAATTCGG + Intronic
1092663099 12:10760878-10760900 TGGCATTTTTTTACAGAAATAGG - Intergenic
1095539557 12:43292918-43292940 TGGAGTTTGCTTTCAGCAACTGG + Intergenic
1099097316 12:78390700-78390722 TGGCATTTGTCAACAGAAATAGG - Intergenic
1104559320 12:129829635-129829657 TGGCATTTCCTGGCAGAAGCAGG - Intronic
1106113631 13:26798258-26798280 TGCCATTTGCCCACAGCAACTGG + Intergenic
1106381406 13:29243459-29243481 TGACATTTGCTTTCAAAGACTGG + Intronic
1106867146 13:33977772-33977794 TGGCTTTTGCTTACATAACTTGG - Intergenic
1108186660 13:47894727-47894749 TGGCAGTTGCTTCCAGGAATGGG + Intergenic
1108401741 13:50051899-50051921 TGGCATTTTCTTCCAGAATAGGG - Intergenic
1109783110 13:67139022-67139044 TGGCATTTCCTTCCTGATACAGG - Intronic
1110704948 13:78594830-78594852 TGGCTTTTGGCTACAGAGACAGG - Intergenic
1111179096 13:84638118-84638140 TGGCATTTGCTTACCTAAGAAGG - Intergenic
1112761945 13:102701357-102701379 AGGCATTTCCTTCCAGAACCTGG - Intergenic
1112874291 13:104016222-104016244 TGTCTTTGGCATACAGAAACGGG + Intergenic
1113787526 13:113010424-113010446 TGACTTTTCCTCACAGAAACAGG - Intronic
1116779236 14:49217827-49217849 TGGCACTTGGTTCCAGAAAAAGG + Intergenic
1118170933 14:63387857-63387879 TGGCATGTGCATACAGAGAGAGG - Intronic
1118248415 14:64134508-64134530 TGGCATTCACTTCCAGAGACAGG - Intronic
1118334380 14:64840344-64840366 TGGCTTTTGCTTTCATAAGCAGG - Intronic
1120278761 14:82411897-82411919 TAGTTTTTGCTTATAGAAACAGG - Intergenic
1121635614 14:95452043-95452065 TTGCATTTGCTCCCAGAAAGAGG - Intronic
1123771196 15:23531123-23531145 TGGCAGTTGCTTACAGTGAATGG - Intergenic
1124056258 15:26243379-26243401 TGGCATTTTGTTACAGCAGCTGG - Intergenic
1125302502 15:38271215-38271237 AGACATTTCCTTACTGAAACAGG - Intronic
1127149565 15:56059566-56059588 GGGCATTTGTTTAAAGAATCAGG + Intergenic
1127232506 15:57012108-57012130 TTTAATTTGCTTACAGAAAATGG + Intronic
1129374701 15:75121761-75121783 TGTATTTTGCTAACAGAAACAGG + Intergenic
1130029277 15:80296824-80296846 TGGCATTTGATTAAAATAACTGG - Intergenic
1130233495 15:82114081-82114103 TGGCATTTGCAGACATAACCAGG - Intergenic
1135640856 16:24118743-24118765 TGGGATGTGCTTTCAGAAACAGG - Intronic
1137347092 16:47674016-47674038 TGCCATTATCTCACAGAAACAGG + Intronic
1139737235 16:69001885-69001907 TGGCAGTTGCTTACAGTGAGTGG - Intronic
1143907409 17:10220221-10220243 TGGCATTTTCTTATAGCAGCAGG + Intergenic
1147004281 17:37389386-37389408 TGTCATTTGCTTAAAGAAGGTGG + Intronic
1147453707 17:40521502-40521524 TGGCATCTTGTTACAGGAACAGG - Intergenic
1147691125 17:42315330-42315352 TGGCATTTGCTTACAGAAACAGG + Exonic
1148224224 17:45887217-45887239 TTGCATTTTTTTGCAGAAACGGG + Intergenic
1149142270 17:53446096-53446118 TGGCATTTGCTAACATAATTTGG - Intergenic
1149898120 17:60446873-60446895 TAGCATTTGCTAACAGGACCAGG - Exonic
1150919327 17:69466659-69466681 TGGCATTTTCTTACAGAAACAGG + Intronic
1152415936 17:80161889-80161911 TGGCAGTTGCTTACAGAAAATGG - Intergenic
1152997074 18:417715-417737 TGGAACTTGCTGACAGCAACAGG - Intronic
1153312685 18:3692591-3692613 TGGCCCTCGCTTGCAGAAACAGG - Intronic
1154137131 18:11789701-11789723 TAGCATTTGCTACCAGAATCTGG + Intronic
1154408375 18:14118498-14118520 TGTCATAAACTTACAGAAACAGG + Intronic
1155792266 18:29988107-29988129 TTGCATTTAATTACAGAATCAGG + Intergenic
1159128683 18:64255250-64255272 TGTTATTTTTTTACAGAAACAGG + Intergenic
1160890265 19:1373983-1374005 AGGCCTTTGGATACAGAAACTGG + Intronic
1161883892 19:6978019-6978041 TGGCATGTGCTAAGGGAAACAGG + Intergenic
1162720679 19:12660557-12660579 AGGGATGTGATTACAGAAACAGG + Intronic
1165978393 19:39697661-39697683 TGCAATATGATTACAGAAACAGG + Intergenic
1168560993 19:57383049-57383071 TGGCAGTTGTTTACAGTAAATGG - Intronic
925678679 2:6394027-6394049 TGGCCTTTACTTTCAGAAAAGGG + Intergenic
925850197 2:8073905-8073927 TGGCCTTTGCTTAAAAAAATAGG - Intergenic
926574815 2:14568436-14568458 TGGATTTGTCTTACAGAAACGGG + Intergenic
928571141 2:32609939-32609961 TGGCATTTGATTAGGAAAACTGG - Intronic
928931693 2:36631710-36631732 TGGCAGTTGCTTACAGTGAGTGG - Intronic
930159090 2:48135089-48135111 GGACATTTCCTAACAGAAACAGG - Intergenic
932847101 2:75147129-75147151 TGGCATCTGCTTAGACAAACAGG - Intronic
933140482 2:78786983-78787005 TGGCATTTGATTACAATGACTGG + Intergenic
933818673 2:86089911-86089933 CGGGATTTTCTTCCAGAAACTGG + Exonic
934911197 2:98255981-98256003 TGTCATGTGCTTAAAGACACTGG - Intronic
936459067 2:112698131-112698153 TTCCATTTGCATAAAGAAACTGG - Intergenic
936896654 2:117435320-117435342 TGGCATTTGCCTCCCCAAACAGG - Intergenic
937488979 2:122345802-122345824 TGGCATTGGCTTAGAGGAAGGGG + Intergenic
937810234 2:126191408-126191430 TGGCTTCTGCATACAGAAATTGG - Intergenic
941438190 2:165498080-165498102 TGTCACTTACTTACAGAAAGGGG - Intronic
944667079 2:201967521-201967543 TGGCATTTGCCTTTGGAAACCGG - Intergenic
945244651 2:207707063-207707085 AGGCATTTGCTTAGAAAACCAGG + Intergenic
945827554 2:214742737-214742759 TGGCATTTGGTTACATATACAGG - Intronic
1169809274 20:9592958-9592980 TGGCATTTGCTAAGAGTTACTGG - Intronic
1170851013 20:20004527-20004549 TGGCATTTGTCTCAAGAAACAGG + Intergenic
1172113767 20:32562197-32562219 TGGCATTTGCCTAGTGACACTGG + Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1172306416 20:33883954-33883976 TTACATTTGCATAAAGAAACTGG - Intergenic
1172607839 20:36226910-36226932 TGGTTTTTCCTTACAGTAACAGG - Intronic
1173010672 20:39178871-39178893 TGGTATTTTGTTACAGCAACAGG - Intergenic
1175344167 20:58259567-58259589 TGGAATTTGCATACAGGAAGAGG + Intergenic
1181130433 22:20728382-20728404 TGGAACTTTCTTAAAGAAACAGG + Intronic
1183502202 22:38187530-38187552 TAACACTTGTTTACAGAAACAGG - Intronic
1185100358 22:48836971-48836993 TGCCATTTTCCTCCAGAAACAGG - Intronic
951431192 3:22608929-22608951 TGGCATTTGTATGAAGAAACAGG + Intergenic
951808415 3:26672642-26672664 TTACATTTGCTAATAGAAACTGG - Intronic
951976100 3:28510798-28510820 TTGACTTTCCTTACAGAAACTGG - Intronic
952535837 3:34307907-34307929 TGGCATATCCTTACAGTATCAGG + Intergenic
953176623 3:40559332-40559354 TGGCAGTTGCTTACAGTGAGTGG - Intronic
953291876 3:41673423-41673445 TGGCATTTCCTTTTAGGAACTGG - Intronic
954840176 3:53504656-53504678 TGGTATTTGCTTTCAGTAAGTGG - Intronic
956337829 3:68184641-68184663 TCCCATTTGCTAACAAAAACAGG + Intronic
956955673 3:74336552-74336574 TGCCATTTGCTTTCCCAAACTGG + Exonic
958012236 3:87894427-87894449 TTGTATTTTCTTACAGAGACAGG + Intergenic
958024159 3:88030576-88030598 TGGGATTTGCTTTCTGAATCAGG + Intergenic
959758768 3:109931435-109931457 TGGCATTTGCTTTCTGAAGTGGG + Intergenic
961641500 3:128367547-128367569 TGGCTCTTGCTTACAGGCACAGG - Intronic
964591893 3:158373896-158373918 TGGCTTTTGCTCACAGAAAATGG + Intronic
970116065 4:12696654-12696676 TGGCATTTATTTACAGCAAGAGG - Intergenic
970123825 4:12787308-12787330 TGGCATATGCAAACAGAAAGTGG - Intergenic
972789895 4:42361470-42361492 TAGCATTTACTTACAGCAAGAGG + Intergenic
973766330 4:54166578-54166600 TGGCATTTTATTACAGCAGCAGG - Intronic
975412559 4:74070877-74070899 TGGCAGTTGCTTACAGTGAGTGG - Intergenic
976085782 4:81405798-81405820 TGCCATTTGCCTACAAAAAAAGG + Intergenic
978146127 4:105373990-105374012 TAACATTTACTTACAGAAAATGG + Intronic
979130648 4:117040456-117040478 TGCCCATTGCTTCCAGAAACAGG + Intergenic
981269952 4:142834239-142834261 TGTCCTTTGCTGGCAGAAACTGG - Intronic
982125885 4:152183436-152183458 TGGCATTTTGTTACAGCAGCAGG - Intergenic
987632707 5:20495588-20495610 TGGCATCTACCTACAGAAACAGG + Intronic
988682182 5:33494560-33494582 TGGTAATTGTTTAGAGAAACAGG + Intergenic
988850007 5:35171671-35171693 TGGAATTTGCCAACTGAAACAGG + Intronic
991202732 5:64013195-64013217 TGACATTTGCTTACACAGAATGG + Intergenic
992762439 5:79962509-79962531 TGGCATTTCCTCACAGACACTGG + Intergenic
994363283 5:98880534-98880556 TGCCATTTGTTTGAAGAAACAGG - Intronic
997758559 5:136423114-136423136 TGGCATCTGCTGACAGAAGAAGG + Intergenic
998044455 5:138975238-138975260 TGGCTTGTGCTTCCAGACACTGG - Intronic
1000458284 5:161480295-161480317 TGGGGTTTGATTACAGAAGCTGG + Intronic
1003205921 6:4011190-4011212 TAGAATTTGCTTTCAAAAACAGG - Intergenic
1004799399 6:19129750-19129772 TGTCATATGCTTGCAGAAAGAGG + Intergenic
1005382768 6:25254264-25254286 TGGCTTTTACTTACAGCTACAGG - Intergenic
1006032784 6:31189546-31189568 TTGTATTTGCTTGCAGAGACAGG + Intergenic
1006797331 6:36740156-36740178 TGGCATTTACTGAGTGAAACGGG - Intergenic
1011841648 6:91508373-91508395 TTGAATTTTCTTTCAGAAACTGG + Intergenic
1011885206 6:92085331-92085353 TGGCATTTGGTGAATGAAACAGG + Intergenic
1012124376 6:95409209-95409231 TGGAATTTTCTTCCAGAAAGTGG - Intergenic
1012256147 6:97034801-97034823 TGGTATTTGTGTACACAAACAGG - Intronic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1014932907 6:127354986-127355008 TGGCATTTTTTCACAGAAATAGG + Intergenic
1015105863 6:129536032-129536054 TGGAATTTGCAAACCGAAACTGG - Intergenic
1016149549 6:140722520-140722542 TGGAATTTGCTTATAGAATCTGG + Intergenic
1016168958 6:140984375-140984397 TTACATTTGCTTATAGAAAATGG + Intergenic
1017397278 6:154016982-154017004 TTGTATTTGATTACATAAACAGG - Intronic
1018387313 6:163316712-163316734 TAGAAAATGCTTACAGAAACAGG - Intergenic
1019196498 6:170286384-170286406 TGGGATTTGCTGACTGAAGCCGG - Intronic
1020523837 7:9231745-9231767 TGGGAGCTGCTTACAGAATCAGG + Intergenic
1021012376 7:15486252-15486274 TGGAATTTTCTGACAGTAACGGG + Intronic
1021473455 7:21033226-21033248 TGTGATTTGATTACAGACACTGG - Intergenic
1024695734 7:51855058-51855080 TGGCATTTGCTTACAGCAAGAGG + Intergenic
1027709154 7:81575745-81575767 TGAGAATTGCTTAAAGAAACTGG + Intergenic
1027903334 7:84147799-84147821 TTGCATTTGCTTATAGCACCAGG - Intronic
1027985955 7:85289879-85289901 TGGAATTTGCTTACAACAGCAGG + Intergenic
1030042440 7:105464348-105464370 TGGCATTTGATTAGAGTGACCGG + Intronic
1031359433 7:120830268-120830290 TGTCATTTTTTTACAGAAACAGG + Intronic
1033052514 7:138019117-138019139 TGGCACTTGCTTACAGTGAGTGG + Intronic
1034010260 7:147521927-147521949 TGGCATTTGGTTACAGTAGCTGG - Intronic
1035243987 7:157550575-157550597 TGGCATTTCCTGGCAGGAACAGG + Intronic
1037468345 8:19183038-19183060 TGGCATTTGGCAAGAGAAACAGG - Intergenic
1038052218 8:23824736-23824758 TGTCATCTGCTTACACAAATTGG + Intergenic
1039943855 8:42113700-42113722 TGGCATTTTCTTATAGCAGCAGG - Intergenic
1040291840 8:46129564-46129586 TGGCATTTTCCTAGAGACACAGG + Intergenic
1040359005 8:46647084-46647106 TGTCATTTTCATACATAAACAGG + Intergenic
1041041746 8:53853571-53853593 TTGCATTTGAATACAGAAAGAGG + Intronic
1041547970 8:59067839-59067861 TGCCATTTGATCAGAGAAACGGG - Intronic
1045018972 8:98024877-98024899 AGGTATTTGCTTTCAGACACAGG - Intronic
1045225610 8:100242240-100242262 TGGAGTTTACTTACAGAAATGGG + Intronic
1045607815 8:103797526-103797548 TGGAATTTACTTAAAGAATCTGG + Intronic
1046058057 8:109102049-109102071 TGGAAATTGCATTCAGAAACTGG - Intronic
1047218734 8:122901285-122901307 TGACATTTTCTTCCAGAAGCAGG - Intronic
1048535746 8:135292539-135292561 TGGCACATGCTTACAGTACCTGG + Intergenic
1048721241 8:137327723-137327745 AGGTATGTGCTTTCAGAAACTGG + Intergenic
1050038039 9:1458495-1458517 TGGTAACTGCTGACAGAAACTGG + Intergenic
1050046406 9:1550932-1550954 TGGCATATACTTAGACAAACAGG - Intergenic
1050311815 9:4361003-4361025 TGACATTTTCTTTCTGAAACAGG + Intergenic
1050434624 9:5596192-5596214 TGGCATTTAATTACAGAAGTAGG - Intergenic
1051834784 9:21323472-21323494 TGGGATTTGCTTGCACATACTGG + Intergenic
1053096766 9:35335297-35335319 TGGCATATGCTTGCAAACACAGG - Intronic
1054917355 9:70507522-70507544 TGGCATTTAATTCAAGAAACTGG - Intergenic
1055355965 9:75437154-75437176 AGGGATTTTCTTCCAGAAACAGG - Intergenic
1056065450 9:82929087-82929109 TGGCATTTGCTTATTCAAGCAGG - Intergenic
1056106927 9:83355992-83356014 TGGGATTTGCTGACACAAAAGGG - Intronic
1056941761 9:90962109-90962131 GGGGATTTGCTTTCTGAAACGGG - Intergenic
1057738192 9:97687002-97687024 TGGCTTTTGCTTACAGAGTGTGG - Intronic
1058286083 9:103180351-103180373 TGCCAGTTGCTTATACAAACTGG + Intergenic
1059774293 9:117460087-117460109 TGGCATCTGCTCAGAGAAAGGGG - Intergenic
1060756307 9:126216729-126216751 TGGTATATGCATGCAGAAACAGG - Intergenic
1060872988 9:127057548-127057570 TGCCATCTGCATACACAAACAGG + Intronic
1188228350 X:27629831-27629853 TGGCATTTTTTTACAGACATAGG - Intronic
1189099221 X:38171867-38171889 TGGCATTTTCTTACCCACACAGG + Exonic
1189318250 X:40070905-40070927 TGGCATCTGCTTGGAGAAATGGG - Intronic
1193077798 X:77374028-77374050 TGGCATTTGGTGGCAGAAGCAGG - Intergenic
1194140722 X:90205391-90205413 TGGCAGTTGGTTAAAGAAAAAGG + Intergenic
1196906097 X:120436631-120436653 TAGCATTTGTATAAAGAAACTGG - Intronic
1199896062 X:152129092-152129114 TGGCAGTTGCTTTCACACACAGG + Intergenic
1200130920 X:153845271-153845293 AGGCATTTGCTTACACATATCGG + Intergenic
1200486488 Y:3774518-3774540 TGGCAGTTGGTTAAAGAAAAAGG + Intergenic
1200492861 Y:3849988-3850010 TGGCAGTTGCTTAAAGTAAATGG + Intergenic